ID: 1125450192

View in Genome Browser
Species Human (GRCh38)
Location 15:39799845-39799867
Sequence CAGACTGGGTAGAAGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 904
Summary {0: 1, 1: 0, 2: 4, 3: 77, 4: 822}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125450192_1125450204 21 Left 1125450192 15:39799845-39799867 CCCTCCCTCTTCTACCCAGTCTG 0: 1
1: 0
2: 4
3: 77
4: 822
Right 1125450204 15:39799889-39799911 AGGAAGTGAAGAGCTCATCTGGG 0: 1
1: 0
2: 0
3: 21
4: 262
1125450192_1125450201 -2 Left 1125450192 15:39799845-39799867 CCCTCCCTCTTCTACCCAGTCTG 0: 1
1: 0
2: 4
3: 77
4: 822
Right 1125450201 15:39799866-39799888 TGGCTCTACAACGACAGGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 87
1125450192_1125450202 1 Left 1125450192 15:39799845-39799867 CCCTCCCTCTTCTACCCAGTCTG 0: 1
1: 0
2: 4
3: 77
4: 822
Right 1125450202 15:39799869-39799891 CTCTACAACGACAGGGAAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 123
1125450192_1125450199 -7 Left 1125450192 15:39799845-39799867 CCCTCCCTCTTCTACCCAGTCTG 0: 1
1: 0
2: 4
3: 77
4: 822
Right 1125450199 15:39799861-39799883 CAGTCTGGCTCTACAACGACAGG 0: 1
1: 0
2: 0
3: 4
4: 54
1125450192_1125450203 20 Left 1125450192 15:39799845-39799867 CCCTCCCTCTTCTACCCAGTCTG 0: 1
1: 0
2: 4
3: 77
4: 822
Right 1125450203 15:39799888-39799910 GAGGAAGTGAAGAGCTCATCTGG 0: 1
1: 0
2: 0
3: 13
4: 227
1125450192_1125450200 -6 Left 1125450192 15:39799845-39799867 CCCTCCCTCTTCTACCCAGTCTG 0: 1
1: 0
2: 4
3: 77
4: 822
Right 1125450200 15:39799862-39799884 AGTCTGGCTCTACAACGACAGGG 0: 1
1: 0
2: 2
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125450192 Original CRISPR CAGACTGGGTAGAAGAGGGA GGG (reversed) Intronic
900483981 1:2912800-2912822 CAGGCTGGGGAGGGGAGGGAAGG + Intergenic
900718317 1:4159208-4159230 CAGAGTGAGAACAAGAGGGAGGG - Intergenic
900722141 1:4183826-4183848 CAGACTGTATAGAGGTGGGAGGG + Intergenic
900841177 1:5049783-5049805 CAGACTGTGTAGAGGCGGGAAGG - Intergenic
901188552 1:7390121-7390143 GTGACTGGGCAGAAGTGGGAAGG - Intronic
902446494 1:16468818-16468840 CAGACATGGCAGGAGAGGGAGGG - Intergenic
902800450 1:18826338-18826360 CAGGCTGGCTAGGAGAAGGAGGG + Intergenic
902808061 1:18872999-18873021 CAGCCTGGGCAGAAGGGGAAGGG + Intronic
903239550 1:21973884-21973906 CAGTCTGGGAAGGAGAGGGAGGG - Intergenic
903243356 1:21998810-21998832 CAGTCTGGGAAGGAGAGGGAGGG - Intergenic
903849754 1:26298746-26298768 CAGCCTGGGTAACAGAGTGAGGG + Intronic
904593023 1:31625719-31625741 GAGACTGGGAGGTAGAGGGAGGG - Intronic
904711951 1:32436716-32436738 CAGACTGTATAGAGGTGGGAAGG - Intergenic
905060100 1:35132883-35132905 CAGACTGTATAGAGGTGGGAAGG + Intergenic
905222192 1:36455976-36455998 CAGACTTGGAACAAGTGGGATGG + Intronic
905362645 1:37431086-37431108 CAGAGTGGATAGGAGAAGGAGGG + Intergenic
905752602 1:40478816-40478838 CAGACGGGGTTTAAGAGGGCAGG - Intronic
906744199 1:48210312-48210334 CAGACTGTATAGAGGTGGGAAGG + Intergenic
906931046 1:50169775-50169797 CTGACTGAGTAGAGTAGGGAAGG - Intronic
907289504 1:53403672-53403694 CAGACTGGGCAGAAAATGAAGGG - Intergenic
907292946 1:53428670-53428692 CAGACTGTATAGAGGTGGGAAGG - Intergenic
907566332 1:55437810-55437832 CTGAGGGGGTAGAAGAGGGGTGG - Intergenic
907706844 1:56839747-56839769 AATACTGGGTAGAAGAGGGTGGG - Intergenic
908126152 1:61032022-61032044 CAGAATATGTAGAAAAGGGACGG + Intronic
908852725 1:68390642-68390664 CAGACTGTATAGAGGTGGGAAGG - Intergenic
909035787 1:70592669-70592691 CAGACTGTATAGAGGTGGGAAGG - Intergenic
909792662 1:79697672-79697694 CAGACTGTATAGAGGTGGGAAGG + Intergenic
910196886 1:84651118-84651140 CAGCCTGGGTAGTATAGCGAGGG + Intronic
910826788 1:91417653-91417675 AAGACTGGGGACAAGAGGGTGGG - Intergenic
911546678 1:99225375-99225397 AATACTTGGTAGAAGAGGGCGGG - Intergenic
912178063 1:107184870-107184892 CAGACAGGGTAAAATAAGGATGG + Intronic
912296784 1:108477359-108477381 CAGACTGTATAGAGGTGGGAAGG - Intergenic
912698193 1:111856773-111856795 CAGACTGGATGGAGGAGGGAGGG + Intronic
912760409 1:112361102-112361124 CCGCATTGGTAGAAGAGGGATGG - Intergenic
912813904 1:112813827-112813849 CAGACTGTATAGAGGTGGGAAGG - Intergenic
913611018 1:120509861-120509883 CTGGCAGGGGAGAAGAGGGAAGG - Intergenic
913983804 1:143547152-143547174 CTGACAGGGGAAAAGAGGGAAGG + Intergenic
914200591 1:145481137-145481159 CAGACATGGGAGGAGAGGGAGGG + Intergenic
914204637 1:145516651-145516673 CAGACTGCATAGGGGAGGGAAGG + Intergenic
914479705 1:148054264-148054286 CAGACATGGGAGGAGAGGGAGGG + Intergenic
914483761 1:148089838-148089860 CAGACTGCATAGGGGAGGGAAGG + Intergenic
914580172 1:149012378-149012400 CTGGCAGGGGAGAAGAGGGAAGG + Intronic
914994400 1:152529256-152529278 CATACTGTGTTGAATAGGGATGG + Intronic
915490638 1:156248236-156248258 CTGACTGGCTAGAACAGGGTAGG + Intergenic
915899565 1:159836651-159836673 GGAACTGGGGAGAAGAGGGAAGG - Exonic
916216333 1:162398114-162398136 CAGACAGAGTAGAATGGGGATGG + Intronic
916942036 1:169686548-169686570 CAGACTGTATAGAGGTGGGAAGG - Intronic
917083118 1:171276860-171276882 CAGTTTGAGTAGAAGAGGTAGGG + Intronic
918232378 1:182548050-182548072 CAGAATGGGTAAAGGAGGGAAGG + Intronic
918341017 1:183568004-183568026 CAGAGTGGGGAGTAAAGGGAGGG - Intronic
918802848 1:188995655-188995677 CAGACTGGGAAGTAAAGGGAAGG + Intergenic
919436431 1:197567979-197568001 CAAACTGGGGAGATGAGGGGAGG + Intronic
920201044 1:204259806-204259828 CAGACTGGGAAGAAGAGGAGTGG + Intronic
920829638 1:209452691-209452713 CAGACTGTATAGAGGTGGGAAGG - Intergenic
921205535 1:212845479-212845501 CAGACTGTATAGAGGTGGGAAGG - Intronic
921520378 1:216149317-216149339 CAGACTGTATAGAGGTGGGAAGG - Intronic
921572952 1:216800371-216800393 CAGGCTGGACAGAAAAGGGAGGG + Intronic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
921732659 1:218595135-218595157 CAGACTGTATAGAGGTGGGAAGG + Intergenic
921879052 1:220232832-220232854 CAGACTGGGAAGATGATGGTTGG - Exonic
922048722 1:221970317-221970339 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
922056094 1:222043818-222043840 CAGGCTGGGCAGGAGGGGGAAGG + Intergenic
922162968 1:223091660-223091682 CAGACTTGGCAGAAGGTGGAAGG + Intergenic
922167483 1:223128156-223128178 AAGACTGGGAGGATGAGGGAAGG - Intronic
922363149 1:224841226-224841248 CAGACTGTATAGAGGTGGGAAGG + Intergenic
922648513 1:227317668-227317690 CAGAATGCATAGAAGGGGGAGGG + Exonic
922979907 1:229816877-229816899 CAGAGTGGGAAGAGGAGAGAAGG - Intergenic
923245072 1:232122560-232122582 CAGACTGTATAGAGGTGGGAAGG - Intergenic
923408313 1:233684766-233684788 CAGACTGTATAGAGGTGGGAAGG + Intergenic
923663919 1:235982120-235982142 CAGCCTGGGGAGAACAGGGAGGG + Intronic
923770429 1:236933597-236933619 CAGACTGTATAGAGGTGGGAAGG + Intergenic
924044389 1:240012337-240012359 CAGATTGGCCAGAAAAGGGAGGG - Intergenic
924181014 1:241438561-241438583 CAGACTGTATAGAGGTGGGAAGG - Intergenic
924698371 1:246423763-246423785 CAGCCTGTTTAAAAGAGGGAGGG + Intronic
924895792 1:248337013-248337035 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1063132877 10:3193686-3193708 CAGGCAGGGCAGGAGAGGGAAGG + Intergenic
1063197841 10:3759695-3759717 AGGACAGGGAAGAAGAGGGAGGG + Intergenic
1063363512 10:5475696-5475718 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1064785215 10:18887661-18887683 AATACTGGGTAGAAGAGGGCGGG + Intergenic
1064823413 10:19366054-19366076 CATACTGGGGAGTAGGGGGAAGG + Intronic
1064927494 10:20585270-20585292 GAGATAGGGTTGAAGAGGGAAGG - Intergenic
1065438041 10:25721598-25721620 CAGACTGTATAGAAGTGGGAAGG - Intergenic
1065721297 10:28630784-28630806 CAGAGTGGTTAGAATAGGGCAGG - Intergenic
1066048733 10:31617047-31617069 CAGGCAGGGAGGAAGAGGGAGGG + Intergenic
1067211752 10:44265377-44265399 CAGATTGGGTAGAAGAAGATAGG + Intergenic
1067386518 10:45821748-45821770 CAGCCTGGGCAGCAGAGTGAGGG + Intergenic
1067636751 10:48006010-48006032 CAGCCTGGGCAGCAGAGTGAGGG + Intergenic
1067673331 10:48346536-48346558 CAGACTGGGAAGCAGGGGGGAGG + Intronic
1067776603 10:49168769-49168791 AGGCCTGGCTAGAAGAGGGAGGG - Intronic
1067876737 10:50014331-50014353 CAGCCTGGGCAGCAGAGTGAGGG - Intergenic
1068687153 10:59881969-59881991 CAGAGAGGGAAGGAGAGGGAGGG + Intronic
1069222284 10:65899819-65899841 CAGATTAGGTATTAGAGGGAAGG - Intergenic
1069515008 10:69070450-69070472 CAGCCTGGGTAACATAGGGAGGG - Intergenic
1069953571 10:72036037-72036059 CAGGCTGGGGAAAGGAGGGAAGG - Intergenic
1070133301 10:73670025-73670047 CAGCCTGGGCAGCAGAGTGAGGG + Intergenic
1071550887 10:86565326-86565348 CAGCCTGGGGAGAAGGGGAAAGG + Intergenic
1071570873 10:86696180-86696202 GAGACTGCGCAGCAGAGGGAGGG - Intronic
1071770652 10:88726081-88726103 CAGACTTGAAAGAAGAGGGGAGG - Intronic
1071916523 10:90299370-90299392 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1071961449 10:90811886-90811908 CAGACTGTATAGAGGTGGGAAGG - Intronic
1072114596 10:92358303-92358325 CAGCCTGGGCAGCAGAGTGAAGG - Intergenic
1073013786 10:100382284-100382306 CAGCCTGGGGAGAAGGGGGGAGG - Intergenic
1073208762 10:101782242-101782264 CAGATTGGTGAGAAGAGGGGAGG - Exonic
1073471827 10:103727371-103727393 CAGACAGGGAGCAAGAGGGAGGG + Intronic
1073539944 10:104310031-104310053 CAGAGTGGGGCGGAGAGGGAGGG + Exonic
1074040989 10:109788286-109788308 GAGACTGGGGAGAAGAGTAAGGG - Intergenic
1074280369 10:112045763-112045785 CAGAGTGCGTAGAAAAGGGTTGG + Intergenic
1074377836 10:112952877-112952899 CAGGCTTCTTAGAAGAGGGAGGG - Intronic
1074741124 10:116485190-116485212 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1075008997 10:118852083-118852105 GAGACTGGGAAGAAGAGAGTGGG - Intergenic
1075014333 10:118899152-118899174 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1076148679 10:128145644-128145666 CAGAGTAGGAAGAAGAGAGAAGG - Intergenic
1076357471 10:129863797-129863819 CAGGCTGGGGAGCAGAGGAAAGG - Intronic
1076519565 10:131073260-131073282 CAGACTGGGCAGGTGAGGGAGGG - Intergenic
1076752924 10:132552719-132552741 CATATTGGGTAGGATAGGGAGGG + Intronic
1076752963 10:132552890-132552912 CATATTGGGTAGGATAGGGAGGG + Intronic
1076753026 10:132553177-132553199 CATATTGGGTAGGATAGGGAGGG + Intronic
1076753169 10:132553871-132553893 CATATTGGGTAGGATAGGGAGGG + Intronic
1076858929 10:133130609-133130631 CAGACAAGGAGGAAGAGGGAGGG - Exonic
1077231284 11:1459161-1459183 CAGAATGGAGAGAGGAGGGAGGG - Intronic
1077612515 11:3652312-3652334 CAGACTGTATAGAGGTGGGAAGG - Intronic
1077850483 11:6071173-6071195 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1078081479 11:8207476-8207498 CAGAGGGTCTAGAAGAGGGAGGG + Intergenic
1078106296 11:8360081-8360103 CAGACTGGGACAAAGAGGCAGGG - Intergenic
1079033381 11:17002124-17002146 AAGGCAGGGTAGAAGAGTGATGG - Intronic
1079354251 11:19716631-19716653 CAGAACGGGAAGATGAGGGAAGG + Intronic
1079424512 11:20327371-20327393 TAGAATGGGGAGAAGAGGAAGGG - Intergenic
1079726767 11:23888522-23888544 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1079835606 11:25328995-25329017 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1080027591 11:27630415-27630437 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1080640345 11:34154902-34154924 CAGCCTGAGCAGGAGAGGGAGGG - Intronic
1081369985 11:42288470-42288492 GAGACTGGGGAGAGGAAGGAGGG + Intergenic
1081687523 11:45053323-45053345 GAGACTGCGTAGCAGAGGGGAGG + Intergenic
1082921643 11:58501413-58501435 GAGGCTTGGGAGAAGAGGGAAGG + Intergenic
1083411552 11:62496764-62496786 CAGCCTGAGCAGCAGAGGGAGGG + Intronic
1083734206 11:64670341-64670363 GGGTCTGGGTAGAAGAGGGAAGG + Intronic
1084208263 11:67608533-67608555 CAGCCTGGACAGAATAGGGAAGG - Exonic
1084232619 11:67764034-67764056 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1084354628 11:68629510-68629532 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1084355869 11:68638072-68638094 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1085196660 11:74676768-74676790 CAGACAGGTGGGAAGAGGGAGGG - Intergenic
1085254825 11:75166540-75166562 GTGAGTGGGTAGGAGAGGGAAGG - Intronic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085736713 11:79045469-79045491 CACACTAGGTAGGAGAGGAAAGG - Intronic
1085934594 11:81126159-81126181 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1086135856 11:83443434-83443456 CAGACTGCGTGGAGGTGGGAAGG + Intergenic
1086160321 11:83715146-83715168 CAGACTTGGGACCAGAGGGAAGG - Intronic
1086210233 11:84309392-84309414 CAGAAGGGCTAGGAGAGGGAGGG + Intronic
1086477820 11:87198498-87198520 CAGAGCGGGGAGGAGAGGGAAGG - Intronic
1087099986 11:94354218-94354240 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1087167658 11:95021173-95021195 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1087197303 11:95314442-95314464 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1087467450 11:98526309-98526331 AATACTGTGTAGAAGAGGGCAGG - Intergenic
1087707954 11:101516584-101516606 CAAACTTGGTAGAATAAGGAAGG + Intronic
1087761413 11:102107819-102107841 CAAAATGGGCAGAAGAGGAAGGG + Intergenic
1087839189 11:102905208-102905230 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1088056918 11:105594067-105594089 CAGAATGAGTGGAAGAAGGAAGG - Intergenic
1088555302 11:111054778-111054800 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1088691781 11:112334581-112334603 CTGACTGGTTAGAACAGGAAAGG - Intergenic
1089349316 11:117813020-117813042 CAGACTGTATAGAGGTGGGAAGG - Intronic
1089466550 11:118689779-118689801 CATACTGGGAATAAGAGGGCGGG + Intergenic
1089498669 11:118920436-118920458 CAGCCTGAGCAGAAGACGGAGGG - Intronic
1089663590 11:120002143-120002165 CAGACTGAGTCGGAGAGGGGAGG - Intergenic
1089953761 11:122552262-122552284 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1089987992 11:122831491-122831513 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1090526452 11:127543860-127543882 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1090546141 11:127770202-127770224 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1090850270 11:130565700-130565722 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1091054535 11:132405880-132405902 CAGGCTGGGTAGGGGAGGGAGGG + Intergenic
1091068531 11:132541309-132541331 CACACTGTGAATAAGAGGGAGGG - Intronic
1091456556 12:612415-612437 CAGGCTGGGTAGAGTAGGGGCGG + Intronic
1091553879 12:1557474-1557496 CAGAAGGGGTGGAAGAGGGAAGG + Intronic
1092414687 12:8281385-8281407 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1092739008 12:11611042-11611064 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1092790030 12:12062762-12062784 CAGACTGTATAGAGGTGGGAAGG - Intronic
1092833954 12:12470568-12470590 CAGACAGGGAAGCAGGGGGATGG - Intergenic
1093267730 12:17023214-17023236 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1093358886 12:18200334-18200356 CAGACTGTATAGAGGTGGGAAGG - Intronic
1093579127 12:20767743-20767765 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1093584211 12:20818346-20818368 CAGACTGTATAGAGGTGGGAAGG + Intronic
1093936198 12:25003373-25003395 CAGCCTGGGCAACAGAGGGATGG - Intergenic
1094494952 12:30983291-30983313 CAGCCTTGGTTGCAGAGGGAAGG - Intronic
1094826179 12:34270867-34270889 CAGACTGTATAGAGAAGGGAAGG - Intergenic
1095175477 12:39087084-39087106 CAGACTGTGTATTATAGGGATGG + Intergenic
1095662282 12:44751185-44751207 CAGACTAAGTGGAAGGGGGAAGG + Intronic
1095787994 12:46131800-46131822 AAGACTGGGGAGTAAAGGGATGG + Intergenic
1095871856 12:47036650-47036672 CTGACTGGAAAGAAGAGGTATGG + Intergenic
1095933890 12:47656360-47656382 CAGACTGGGTGGGACAGGGAAGG - Intergenic
1096195082 12:49644510-49644532 CAGCCTGGGTGGCAGAGGGCAGG + Exonic
1096411862 12:51382798-51382820 CAGTGTGGATGGAAGAGGGAGGG + Intronic
1096596172 12:52696954-52696976 CACATGGGGAAGAAGAGGGAGGG + Intronic
1097032927 12:56102425-56102447 CAGACTGTCAAGAAGAGGAAAGG + Exonic
1097398899 12:59106218-59106240 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1097947648 12:65389626-65389648 CAGACTGGGAAGAAAGGGAAGGG - Intronic
1098224402 12:68307185-68307207 CAAAAGGGGGAGAAGAGGGAGGG + Intronic
1098629669 12:72710020-72710042 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1099291778 12:80784417-80784439 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1099375539 12:81893062-81893084 CGGACTGTGCAGAAGAGAGATGG + Intergenic
1100351179 12:93784477-93784499 CACAGTGGTTAGAAGAGGAAAGG - Intronic
1100526666 12:95426045-95426067 TAGACTGGGTTGAATAGAGAAGG - Intergenic
1100561675 12:95753538-95753560 CAGACTGTATAGAGGTGGGAAGG - Intronic
1100779390 12:98007973-98007995 CAGCCTGGGTGGGAGAGTGAGGG + Intergenic
1100876482 12:98967618-98967640 AAGAGAGGGTAGAAGAGGGGAGG + Intronic
1102317873 12:111904668-111904690 CAGCCTGGGGTGAAGGGGGAGGG - Intergenic
1102933754 12:116880806-116880828 GGGACTGGGTAGAAGAGGAGAGG + Intronic
1103170414 12:118813956-118813978 CGGGCTGGGTGGAAGAGGGGTGG - Intergenic
1103338785 12:120210212-120210234 CAGGCTGGGGAGCAGCGGGATGG - Intergenic
1105669810 13:22600601-22600623 CAGACTGGGCGGAAGGGGTATGG + Intergenic
1106090755 13:26591173-26591195 CAGAGTGGTTAGGGGAGGGAAGG + Intronic
1106896881 13:34312752-34312774 ATGACTGGGTGGAAGATGGAAGG + Intergenic
1107015638 13:35706213-35706235 CAGAAGGGGTTGAAGGGGGAGGG + Intergenic
1107574408 13:41702278-41702300 TAGACTAGATAGAAGAGGGGTGG - Intronic
1107758328 13:43650083-43650105 AAGAATGGGGTGAAGAGGGAAGG + Intronic
1108019035 13:46106452-46106474 AAGACAGGGTAGAAGAGACAGGG + Intergenic
1109219313 13:59625427-59625449 CAGACTAGGTAGAAGTGGCATGG - Intergenic
1109343943 13:61093115-61093137 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1109353320 13:61209962-61209984 CGGACTGCGTAGAGGTGGGAAGG - Intergenic
1109499619 13:63217487-63217509 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1109709350 13:66142665-66142687 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1109716419 13:66227718-66227740 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1110169449 13:72483518-72483540 CAGACAGAGAGGAAGAGGGAGGG - Intergenic
1110765800 13:79278517-79278539 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1111034861 13:82659302-82659324 AATACTGGGTAAAAGAGGGCAGG + Intergenic
1111361786 13:87187755-87187777 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1111587521 13:90301370-90301392 CAAACTGAGAGGAAGAGGGAAGG + Intergenic
1111630747 13:90843798-90843820 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1111695264 13:91615310-91615332 CATACTAGTTAGAAGAAGGAGGG + Intronic
1112057330 13:95702232-95702254 CAGACTGGGAAGAGGCAGGAGGG - Intronic
1112657539 13:101467618-101467640 AAGGCTGGGTAGAAGAATGAGGG + Intronic
1112888961 13:104208895-104208917 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1112917311 13:104567322-104567344 CAGGCTGGGTAGGGTAGGGAGGG + Intergenic
1113324657 13:109269795-109269817 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1114862587 14:26543581-26543603 AAGACTGGGTAGAATACCGAAGG + Intronic
1115379717 14:32722411-32722433 AATATTGGGTAGAAGAGGGCAGG + Intronic
1115996843 14:39203764-39203786 GAGAGTGGGCAGAAGAGTGAGGG + Intergenic
1116490208 14:45496180-45496202 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1116573771 14:46548289-46548311 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1116613747 14:47107955-47107977 CAGACTGTATAGAGGTGGGAAGG - Intronic
1116702042 14:48256502-48256524 CAAACTGTGTAGAGGTGGGAAGG + Intergenic
1116702976 14:48263701-48263723 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1117532655 14:56674556-56674578 CAGACTGAGAAGGAGAGTGAGGG + Intronic
1117801493 14:59448457-59448479 CAGACTGTATAGAGGTGGGAAGG - Intronic
1117940971 14:60964291-60964313 CAGACCTTGGAGAAGAGGGAGGG - Intronic
1117957560 14:61134542-61134564 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1118175966 14:63440271-63440293 CAGACTGGGAATAAGTGGTAGGG + Intronic
1118773213 14:68956218-68956240 CACTCTGGGAAGCAGAGGGAGGG + Intronic
1118811502 14:69278035-69278057 CAGCCTGGGTCACAGAGGGAGGG - Intronic
1119022732 14:71128679-71128701 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1120141297 14:80932788-80932810 CAGACTGGGAGGCAGAGAGAAGG - Intronic
1120437730 14:84501549-84501571 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1120618558 14:86735733-86735755 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1120659583 14:87235995-87236017 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1120806077 14:88752622-88752644 AATACTGGGTAGAAGAAGGTGGG + Intronic
1121315756 14:92960174-92960196 CCGGCTGGGGAGTAGAGGGAGGG + Intronic
1121395164 14:93615371-93615393 GAGGGTGGGGAGAAGAGGGAGGG - Intronic
1121980215 14:98448058-98448080 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1122389939 14:101373357-101373379 CGGCCTGGGCAGTAGAGGGAGGG - Intergenic
1122814937 14:104307653-104307675 CAGCCTGGGCAGGAGAGGGCCGG + Intergenic
1122960573 14:105092092-105092114 CAGACTGGGGAGGTGAGGGAAGG - Intergenic
1124592442 15:31065268-31065290 CAGAGTGGGTAGAATGGGGATGG - Intronic
1124646054 15:31438108-31438130 AAGACTGGGCATGAGAGGGAAGG + Intergenic
1125046008 15:35242526-35242548 CAGACTGTATAGAGGTGGGAAGG - Intronic
1125304473 15:38294162-38294184 GAGACTAGGTAGAAGAGAAAAGG - Intronic
1125450192 15:39799845-39799867 CAGACTGGGTAGAAGAGGGAGGG - Intronic
1126330475 15:47525771-47525793 CAGTGAGGGTAGAAGAGGCAAGG + Intronic
1126912097 15:53428176-53428198 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1127461639 15:59204649-59204671 CTGTAGGGGTAGAAGAGGGAGGG - Intronic
1127856912 15:62960829-62960851 CAGATTGAGGGGAAGAGGGAGGG + Intergenic
1128291089 15:66478978-66479000 CAGGGTGGGTAGAAGAGGACAGG + Intronic
1128560009 15:68658453-68658475 CAACCTGGGTAGAAGCGGGAGGG + Intronic
1128665694 15:69536792-69536814 CAGCCTGGGGAAGAGAGGGAAGG + Intergenic
1129980169 15:79861938-79861960 CAGGCTGGGAAGAAGAGGGGTGG + Intronic
1131448090 15:92516092-92516114 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1131684505 15:94755145-94755167 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1132934359 16:2473410-2473432 CAGTCTGGGTAGAAGGTGGGAGG - Exonic
1132995315 16:2819574-2819596 CAGACAGGGGAGCAGAGGGAAGG - Intronic
1133651714 16:7819115-7819137 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1133724390 16:8523802-8523824 AAGACTGGCTGAAAGAGGGAAGG - Intergenic
1133765406 16:8834363-8834385 CAGACTGTATAGAGGTGGGAAGG + Intronic
1133766412 16:8841260-8841282 CAGACTGTATAGAGGTGGGAAGG + Intronic
1133869164 16:9671865-9671887 CAGACTGTATAGAGGTGGGAAGG + Intronic
1134036318 16:11033889-11033911 CGGACTTGATAGAAGAGCGAAGG - Intronic
1134447798 16:14343986-14344008 CAGCCTGGGTGACAGAGGGACGG - Intergenic
1134690571 16:16188709-16188731 CAGAGTGGGAGGGAGAGGGATGG - Intronic
1135381937 16:22002951-22002973 CAGACTGTTTGGAAGAGGAAAGG - Intergenic
1135487305 16:22877418-22877440 CAGACTGGTTATAAGTGGGCCGG + Intronic
1135549681 16:23388440-23388462 CAGCCTGGGTGAAAGAGTGAGGG + Intergenic
1135887977 16:26329615-26329637 AATTCTAGGTAGAAGAGGGAGGG - Intergenic
1137033573 16:35547653-35547675 CAGACTGTGCAGATCAGGGAGGG + Intergenic
1137402099 16:48162247-48162269 CAGAGTGGGTAGAATGGTGAGGG + Intergenic
1137505609 16:49051545-49051567 AGGACTGAGTACAAGAGGGAAGG + Intergenic
1137684557 16:50377225-50377247 GAGGCTGGGAAGAATAGGGAAGG - Intergenic
1137896254 16:52216192-52216214 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1138134680 16:54511515-54511537 GAGACAAGGTAGCAGAGGGAGGG + Intergenic
1138758686 16:59518285-59518307 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1138988475 16:62361422-62361444 CAGCCTGGGCAGAAGAAAGAAGG + Intergenic
1139225597 16:65231161-65231183 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1139230267 16:65276593-65276615 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1139459284 16:67109352-67109374 AGGACTGGGTAGAAGAGGAAGGG - Intergenic
1139942734 16:70617814-70617836 CAGACTGTATAGAGGTGGGAAGG + Intronic
1139943401 16:70622132-70622154 CAGACTGTATAGAGGGGGGAAGG + Intronic
1140595749 16:76408464-76408486 CGGAATGGGTACAAGAGGGTTGG - Intronic
1141234548 16:82203433-82203455 GAAACTGGGTAGAACAGAGAAGG - Intergenic
1142146844 16:88496330-88496352 CAGGCTGGATAGGAGAGGGAGGG + Intronic
1143149791 17:4800784-4800806 CTGACTTGCTAGTAGAGGGAGGG - Intergenic
1143619451 17:8072737-8072759 CAGAATGGGGAGAGGAGAGACGG + Exonic
1143652980 17:8275747-8275769 AAGACTGGAAAGAAGAGGGGTGG + Intergenic
1143704548 17:8687573-8687595 GAGAGTGGGAAGAGGAGGGAAGG - Intergenic
1144104898 17:11975642-11975664 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1144585120 17:16483038-16483060 CAGAGTGGGAAGTAGAGGGAGGG + Intronic
1144706700 17:17373209-17373231 CAGACTGGGGATGGGAGGGAGGG + Intergenic
1145046862 17:19625341-19625363 CAAACTGGGAAGAAGCCGGATGG - Intergenic
1146602857 17:34233801-34233823 CTGACTGGGAAGCAGAGGGAGGG - Intergenic
1146954778 17:36931182-36931204 TAGACTGGGGAGAAGAGGCAGGG - Intergenic
1148149150 17:45385745-45385767 CAGACAGGGTTGAAGCGTGAGGG - Intergenic
1148579575 17:48734401-48734423 CTGACTGGGTTGGAGAAGGAAGG - Intergenic
1148736494 17:49868088-49868110 TGGAATGGGTGGAAGAGGGAAGG + Intergenic
1148934874 17:51156969-51156991 CAGCCTGGGCAACAGAGGGAGGG + Intronic
1149120341 17:53155881-53155903 CAGGCTGTGGAGAAAAGGGAAGG - Intergenic
1149440971 17:56673571-56673593 CAATCTGGGGAGAAGAAGGAGGG + Intergenic
1149543711 17:57487841-57487863 TAGACCGGGTAGGGGAGGGAGGG - Intronic
1150993159 17:70284425-70284447 CAGACTGGGGTGAGGAGGAAGGG - Intergenic
1151202017 17:72475684-72475706 CAGGCTGGGTACCTGAGGGAGGG - Intergenic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1151553852 17:74836841-74836863 CAGACTGGGTGGAAGGTGGGTGG - Exonic
1151698270 17:75729246-75729268 CAGCCTGGGCAGAGGTGGGAGGG - Exonic
1151839434 17:76607293-76607315 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1152076900 17:78165334-78165356 CAGACTTGGTAGAAGTGAGATGG - Intronic
1152089875 17:78240438-78240460 GAGACAGGTGAGAAGAGGGATGG + Exonic
1152361977 17:79837040-79837062 CGGAGAGGGTAGAAGGGGGAAGG - Intronic
1152454382 17:80404893-80404915 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1152868508 17:82738049-82738071 CAGGCAGGGAAGAAGAGGGCTGG - Intronic
1152982178 18:289017-289039 CAGCCTGGGTGACAGAGGGAGGG + Intergenic
1154046921 18:10915009-10915031 TAGATAGGGTGGAAGAGGGAGGG - Intronic
1154101926 18:11483737-11483759 TAGAGTGGGGAGAAGTGGGAAGG + Intergenic
1154124120 18:11674358-11674380 CAGTCTGGGGAGAGGAGGCAGGG + Intergenic
1154174741 18:12078019-12078041 TAGATAGGGTGGAAGAGGGAGGG + Intergenic
1154236388 18:12610058-12610080 CAGGCTGGGAAGAGGAGGGAGGG - Intronic
1155683617 18:28520413-28520435 AATACGGGGTAGAAGAGGGTGGG + Intergenic
1155696678 18:28694355-28694377 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1155941942 18:31808734-31808756 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1156086121 18:33404947-33404969 GAGGCTGGGTAGAGGAGGAATGG + Intronic
1156251579 18:35357449-35357471 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1156938843 18:42741027-42741049 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1157906073 18:51571371-51571393 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1157911616 18:51622363-51622385 CAGACAGCGTGGCAGAGGGAGGG - Intergenic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1158579520 18:58669701-58669723 CAGTTTGGGTAGAGGATGGAGGG + Intergenic
1158916834 18:62141037-62141059 CACAGTGGGCAGAAGAGTGATGG - Intronic
1159164808 18:64686007-64686029 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1159835361 18:73329016-73329038 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1160175621 18:76591879-76591901 CAGAGTGGTTAGAAGAGAAACGG - Intergenic
1160698160 19:494481-494503 CAGCCTGGGCAGGAGGGGGATGG + Intronic
1160921533 19:1523186-1523208 CAGGCTGGGTGGAAGGGTGAGGG + Intergenic
1161580580 19:5078512-5078534 AAGACGGGGGAGAAGAGGAAAGG - Intronic
1162204212 19:9043682-9043704 CAGAATGAGTGGAAGAGGGGAGG - Intergenic
1163175337 19:15560887-15560909 AGGTCTGGGGAGAAGAGGGAGGG - Intergenic
1163487611 19:17597803-17597825 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1163899761 19:20091023-20091045 CAGACTGTATAGAGGTGGGAAGG + Intronic
1163907492 19:20159912-20159934 CAGACTGTATAGAGGCGGGAAGG - Intergenic
1164153366 19:22573174-22573196 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1164220487 19:23188723-23188745 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1164242237 19:23399721-23399743 AACACAGGGTAGAAGAGGGGAGG + Intergenic
1164788065 19:30952403-30952425 CAGCCTGGGCAAAAGAGGGAGGG - Intergenic
1165324097 19:35104206-35104228 CAGAGTGGGCAGATGAGTGAAGG + Intergenic
1165496685 19:36156755-36156777 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1165835683 19:38754027-38754049 CAGACTGTATAGAGGTGGGAAGG - Intronic
1166498617 19:43324843-43324865 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1167046290 19:47051159-47051181 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1167099788 19:47397412-47397434 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1167115612 19:47487602-47487624 CAGAGTGGGTAGCAGAGGTGAGG + Intergenic
1167329917 19:48848926-48848948 CAGCCTGGGTGACAGAGGGAGGG - Intronic
1167902468 19:52632149-52632171 CAGACTGTATAGAGGTGGGAAGG - Intronic
1168051958 19:53835977-53835999 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1168211717 19:54895608-54895630 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1168227663 19:55008090-55008112 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1168248657 19:55127953-55127975 CAGACTGTATAGAGGTGGGAAGG - Intergenic
925415447 2:3667139-3667161 CAGGCTGGGTGGTATAGGGAAGG - Intronic
925545499 2:5011402-5011424 CAAAGTGAGTAGAAGAAGGAGGG - Intergenic
925645354 2:6030056-6030078 CAGTCATGGTGGAAGAGGGAGGG - Intergenic
925994357 2:9279764-9279786 AAGACTGGGTAAAAGAGAAACGG - Intronic
926111282 2:10185770-10185792 GAGACTGGGGAGAACAGAGAGGG - Intronic
926250582 2:11153467-11153489 CAGAAGGGGAAGAGGAGGGAGGG + Intergenic
926408079 2:12574143-12574165 CAGACTGTATAGAGGTGGGAAGG - Intergenic
926463737 2:13165105-13165127 CAGACTGTATAGAGGTGGGAAGG + Intergenic
926815230 2:16793273-16793295 CAGACTGTATAGAGGTGGGAAGG + Intergenic
927095430 2:19744642-19744664 CAGCCTGGGGAAAACAGGGAGGG + Intergenic
927515786 2:23670874-23670896 CAGAGTGGGCAGAGAAGGGAGGG + Intronic
927842240 2:26453151-26453173 AAGAGTGGGAAGAAGGGGGATGG - Intronic
928277844 2:29919420-29919442 CAGACTGGGTGGGGGTGGGAGGG + Intronic
928389258 2:30896800-30896822 GAGACAGAGGAGAAGAGGGAGGG - Intergenic
928494094 2:31813816-31813838 AATACTGGGTAGAAGAAGGTGGG - Intergenic
928779390 2:34802302-34802324 CAGACTGTATAGAGGTGGGAAGG + Intergenic
928928889 2:36603412-36603434 CAGACTGTATAGAGGTGGGAAGG - Intronic
929004507 2:37382298-37382320 CAGACTGTATAGAGGTGGGAAGG + Intergenic
929076352 2:38082100-38082122 CAGACTGTATAGAGGTGGGAAGG + Intronic
929573511 2:43038481-43038503 CAGAGTGGGGAGAGGAGGGGCGG - Intergenic
930955410 2:57197328-57197350 CAGACTGTATAGAGGTGGGAAGG - Intergenic
931026073 2:58114756-58114778 CAGACTGTATAGAGGTGGGAAGG + Intronic
931042936 2:58318074-58318096 CAGACTGTATAGAGGTGGGAAGG - Intergenic
931608624 2:64076516-64076538 CAGACTGTATAGAGGTGGGAAGG + Intergenic
931850733 2:66248302-66248324 CAGACTGTATAGAGGTGGGAAGG - Intergenic
931948601 2:67336192-67336214 CAGACTGTATAGAGGTGGGAAGG - Intergenic
932366906 2:71159105-71159127 CAGACTGTATAGAGGTGGGAAGG + Intergenic
932466404 2:71927060-71927082 CAGACAGGGTGGAGGAGGGTGGG - Intergenic
932922591 2:75934175-75934197 CAGAGTGGGGAGACAAGGGAAGG - Intergenic
933179402 2:79212632-79212654 CGGACTGCGTAGAGGTGGGAAGG + Intronic
933250696 2:80025302-80025324 AATGCTGGGTAGAAGAGGGTGGG - Intronic
933427109 2:82126905-82126927 AATACTGGGTAGAAGAGGGTGGG - Intergenic
934525562 2:95049550-95049572 CAGACGGGGTGTCAGAGGGATGG - Intronic
935209948 2:100930928-100930950 CATATTGGGGAGAAGAGGAAAGG + Intronic
935413372 2:102788739-102788761 CACACTGGGCAGAAGGGGGAGGG - Intronic
935830902 2:106999874-106999896 CAGACTTTGGAGAAGAGAGACGG + Intergenic
940107709 2:150117193-150117215 CAGACTGTATAGAGGTGGGAAGG - Intergenic
940530512 2:154871691-154871713 CAGACTGTATAGATGTGGGAAGG - Intergenic
940675501 2:156721394-156721416 CAGACTGTATAGAGGTGGGAAGG + Intergenic
941330637 2:164174298-164174320 CAGGCTGGGAAGAGGAGGCAGGG + Intergenic
941340710 2:164300218-164300240 CAGACTGTATAGAGGTGGGAAGG - Intergenic
941455747 2:165710898-165710920 CAGACTGTATAGAGGTGGGAAGG + Intergenic
941935536 2:170978758-170978780 CAGACTGTATAGAGGTGGGAAGG + Intergenic
942729942 2:179052884-179052906 CGGACTGCGTAGAGGTGGGAAGG + Intergenic
942914726 2:181291389-181291411 CAAAGTGGAGAGAAGAGGGACGG - Intergenic
942964682 2:181877126-181877148 CAGACTGCTTGGAAGAGAGAAGG - Intergenic
943135293 2:183903135-183903157 CAGCCTGGCAAGAAAAGGGAGGG - Intergenic
943421262 2:187671822-187671844 CAGACTGTATAGAGGTGGGAAGG + Intergenic
943806953 2:192134804-192134826 CAGACTGTATAGAGGTGGGAAGG - Intronic
943950955 2:194132007-194132029 CAGACTGTATAGAGGTGGGAAGG + Intergenic
944875796 2:203963251-203963273 CAGACTGTATAGAGGTGGGAAGG + Intergenic
945026882 2:205628122-205628144 GTGACTGGGTGGTAGAGGGAGGG + Intergenic
945301102 2:208217191-208217213 CAGACTGTATAGAGGTGGGAAGG + Intergenic
945376488 2:209083006-209083028 CAGACTGTATAGAGGTGGGAAGG - Intergenic
945938639 2:215926756-215926778 CAGACTGTATAGAGGTGGGAAGG - Intergenic
946041769 2:216788849-216788871 CAGCCTGGGCAGCAGAGGGAGGG + Intergenic
946100383 2:217315500-217315522 AAGACTGGGAGGAAGAGGGCGGG + Intronic
946154915 2:217801013-217801035 GAGACTGGCCAGGAGAGGGATGG - Exonic
946167544 2:217874150-217874172 GAGAGTGGCTAGAAAAGGGATGG + Intronic
946214718 2:218175349-218175371 CAGACTGTATAGAGGTGGGAAGG + Intergenic
946780548 2:223190020-223190042 CAGACTGTATAGAGGTGGGAAGG + Intronic
946886822 2:224229666-224229688 CAGACTGTATAGAGGTGGGAAGG - Intergenic
946893593 2:224301046-224301068 CAGACTGTATAGAGGTGGGAAGG - Intergenic
948391011 2:237611326-237611348 CAGACTGTATAGAGGTGGGAAGG - Intergenic
948647007 2:239411660-239411682 AGGACAGGGCAGAAGAGGGAGGG + Intergenic
948664772 2:239528095-239528117 CAGGATGGGGAGAACAGGGATGG - Intergenic
1168942887 20:1728538-1728560 CAGACTGTTTAGAGGTGGGAAGG + Intergenic
1169852782 20:10070678-10070700 CAGAGTAGGAAGAAGAGAGAGGG + Intergenic
1170106553 20:12758256-12758278 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1170157105 20:13278998-13279020 CAGAATGGGTAGGAGTGGAATGG - Intronic
1170325140 20:15148947-15148969 CAGACTGTATAGAGGTGGGAAGG + Intronic
1170472106 20:16678237-16678259 CAGAATTGGTAGATGAGAGAAGG + Intergenic
1170561164 20:17559814-17559836 CAGACGGGGTGGCAGGGGGATGG - Intronic
1170970986 20:21116407-21116429 CAGAATGGGAACAAGAGAGAGGG + Intergenic
1172698050 20:36835723-36835745 CAGCGTGGGGAGAGGAGGGAGGG + Intronic
1173102219 20:40097720-40097742 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1173466060 20:43282323-43282345 AAGACTGGGATGAGGAGGGAAGG + Intergenic
1173652498 20:44675679-44675701 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1175400193 20:58695930-58695952 CAGTCTGGGGAGCAGCGGGAGGG - Intronic
1176108829 20:63401923-63401945 CAGACGTGGTATGAGAGGGATGG - Intergenic
1177124621 21:17181204-17181226 AATTCTGGGTAGAAGAGGGCAGG + Intergenic
1177422406 21:20877240-20877262 CACAATGGGTGGAGGAGGGAGGG - Intergenic
1177647583 21:23918931-23918953 CAGACTGCCAATAAGAGGGAAGG + Intergenic
1177833942 21:26170203-26170225 CAGACAGGGGGGAAGGGGGAAGG - Intronic
1178223628 21:30689397-30689419 CATTCTGGGCAGAAGAGGGCAGG + Intergenic
1178636894 21:34311901-34311923 CACACTGGGATGAAGATGGAGGG - Intergenic
1179387879 21:40959328-40959350 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1180156091 21:45977950-45977972 AGGACAGGGGAGAAGAGGGAGGG + Intergenic
1181108706 22:20589401-20589423 CAGACAGGATACAGGAGGGATGG - Intergenic
1181535308 22:23539199-23539221 CAGATTGTGAAGAAGAGGCAGGG + Intergenic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1182151985 22:28034344-28034366 CAGACTGGGAAGAAGACAGGCGG - Intronic
1182732598 22:32507148-32507170 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1182853453 22:33496450-33496472 CTTACTTGGTAGAAGAGGCAGGG - Intronic
1183064280 22:35352805-35352827 CAGGCTGGCCAGCAGAGGGAAGG + Intergenic
1183342047 22:37286864-37286886 CAGAATGGGTAGAAGAGGCAGGG + Intronic
1183635205 22:39057878-39057900 CAGACTGTATAGAGGTGGGAAGG + Intronic
1183808964 22:40237928-40237950 AAGACTGGGCAAAAGAAGGATGG - Intronic
1184324772 22:43774774-43774796 CAGCCTGGGCAAAAGGGGGATGG + Intronic
1185062644 22:48615126-48615148 CAGCCTGGGTTCAGGAGGGACGG - Intronic
949161769 3:892000-892022 CAGACTGTATAGAGGTGGGAAGG + Intergenic
949328983 3:2900335-2900357 CAGCCTGGTTAAAAGTGGGAGGG + Intronic
949671482 3:6402057-6402079 CAGACTGTATAGAGGTGGGAAGG - Intergenic
949802058 3:7914950-7914972 AATACTGGGTAGAAGAGGGTGGG + Intergenic
949827760 3:8181387-8181409 CAGACTGTATAGAGGTGGGAAGG - Intergenic
950507747 3:13406224-13406246 CAGACTCTGTACCAGAGGGAAGG - Intronic
950575782 3:13831351-13831373 CAGACTGGGGAGACAAGGGGTGG + Intronic
950824553 3:15803671-15803693 TAGACTGGCTACAAGAGTGATGG + Intronic
950926813 3:16748693-16748715 CAGACTGTATAGAGGTGGGAAGG - Intergenic
951134083 3:19083447-19083469 AATACTGGGTAGAAAAGGGAAGG + Intergenic
951298495 3:20968844-20968866 CAGACTGTATAGAGGTGGGAAGG + Intergenic
951632577 3:24737626-24737648 CAGAATGGGGTGAAGCGGGACGG + Intergenic
951762365 3:26160962-26160984 CAGACTGTATAGAGGTGGGAAGG + Intergenic
952109716 3:30108773-30108795 AATACTGGGTAGAAGAGGGCGGG + Intergenic
952297325 3:32072887-32072909 CAGACTGTATAGAGGTGGGAAGG - Intronic
952388396 3:32859781-32859803 CACACTGGTGGGAAGAGGGATGG + Intronic
952654956 3:35774493-35774515 AAAAGGGGGTAGAAGAGGGAGGG - Intronic
952663147 3:35875661-35875683 CAGACTGTATAGAGGTGGGAAGG + Intergenic
953177512 3:40565350-40565372 CAGACTGTATAGAGGTGGGAAGG - Intronic
953765459 3:45737247-45737269 AAGACTGGGGGTAAGAGGGAGGG + Intronic
953825393 3:46247627-46247649 CAGACTGTATAGAGGTGGGAAGG + Intronic
953886942 3:46719399-46719421 CACATTTGGAAGAAGAGGGAGGG + Intronic
954144703 3:48628817-48628839 CAGCCTGGGGAGCAGAGGGCTGG - Intronic
954678663 3:52329492-52329514 CAGACTAGGTTGAGGAAGGAAGG - Intronic
956084735 3:65597507-65597529 CAGGCTGGGAGGAAGGGGGAGGG - Intronic
956474698 3:69607876-69607898 CACTCTGGGGAGGAGAGGGAGGG + Intergenic
956548639 3:70435982-70436004 CAGACTGCATAGAGGTGGGAAGG + Intergenic
957719639 3:83977546-83977568 GAGACTGGGTAGGAGAGGAGTGG - Intergenic
958183187 3:90085441-90085463 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
958945153 3:100354177-100354199 GCGACTGGGTAGAAGTGGCATGG - Intronic
959288037 3:104441252-104441274 CAGACTGTATAGAGGTGGGAAGG + Intergenic
959821781 3:110743724-110743746 CTGACTGGCTGGAAGAAGGATGG - Intergenic
960050774 3:113237408-113237430 GAGGCTGGGTAGAAGAAGGCAGG - Intronic
960136789 3:114113704-114113726 AAGACTGGGCAGAAGAGGAGTGG - Intergenic
960309808 3:116106651-116106673 CAGACTGTATAGAGGTGGGAAGG + Intronic
961164440 3:124753896-124753918 CAGACTGTATAGAGGTGGGAAGG + Intergenic
961262883 3:125616690-125616712 CAGACTGGGTAAGAGAAGGCAGG - Intergenic
961269058 3:125673953-125673975 GAGACTGGGTAAAAGTGGAAAGG + Intergenic
961478614 3:127164752-127164774 CAGACTGGGTTGTGGAGGGCAGG - Intergenic
961638006 3:128345374-128345396 CAGTTTTGGTTGAAGAGGGAGGG + Intronic
961711311 3:128830533-128830555 CAGACTGTATAGAGGTGGGAAGG + Intergenic
961712323 3:128837120-128837142 CAGACTGTATAGAGGTGGGAAGG + Intergenic
961730903 3:128964064-128964086 CAGACTGTATAGAGGTGGGAAGG - Intronic
961881367 3:130063644-130063666 CAGACTGTATAGAGGTGGGAAGG - Intergenic
961892232 3:130140001-130140023 CAGACTGTATAGAGGTGGGAAGG + Intergenic
962261776 3:133914962-133914984 CAGACTGGGGAGTAGGGAGACGG + Intergenic
962623876 3:137205477-137205499 CAGCCTGGGGAGCAGAGGCAAGG - Intergenic
963472283 3:145755250-145755272 CAGACTGGATAGAAAAAGGTTGG - Intergenic
963521974 3:146366645-146366667 CAGACTGTATAGAGGTGGGAAGG - Intergenic
963628323 3:147701785-147701807 CAGAATGGATGGAACAGGGATGG + Intergenic
963663670 3:148156027-148156049 CAGACTGTATAGAGGTGGGAAGG - Intergenic
964202249 3:154130962-154130984 AATACAGGTTAGAAGAGGGAAGG - Intronic
964213277 3:154251615-154251637 CAGACTGGGATGGAGATGGAAGG + Intronic
964254746 3:154763526-154763548 TAGAGGTGGTAGAAGAGGGAAGG - Intergenic
964299844 3:155275745-155275767 CAGACTGTATAGAGGTGGGAAGG + Intergenic
964940531 3:162154711-162154733 CAGACTGTATAGAGGTGGGAAGG + Intergenic
965104924 3:164343465-164343487 CAGACTGTATAGAGGTGGGAAGG + Intergenic
965286418 3:166825431-166825453 CAGACTGTATAGAGGTGGGAAGG + Intergenic
965335548 3:167427899-167427921 CAGACTGTATAGAGGTGGGAAGG - Intergenic
965624516 3:170673488-170673510 CAGACTGTATAGAGGTGGGAAGG + Intronic
965626003 3:170684665-170684687 CAGACTGTATAGAGGTGGGAAGG + Intronic
965639660 3:170818916-170818938 CAGACTGTATAGAGGTGGGAAGG + Intronic
965672306 3:171159196-171159218 CAGAGCGGGTGGAGGAGGGAAGG + Intronic
965713731 3:171580797-171580819 CAGACTGTATAGAGGTGGGAAGG - Intergenic
965854066 3:173066471-173066493 CTGACTGGGGGAAAGAGGGAAGG + Intronic
965971177 3:174558338-174558360 CAGACTGGGTACGGGGGGGATGG + Intronic
966104783 3:176322971-176322993 CAGACTGTATAGAGGTGGGAAGG + Intergenic
966232536 3:177667185-177667207 CAGACTGTATAGAGGTGGGAAGG + Intergenic
966397973 3:179521205-179521227 CAGACTGTATAGAGGTGGGAAGG - Intergenic
966519718 3:180859982-180860004 CAGAACGGAAAGAAGAGGGAGGG + Intronic
966793568 3:183694392-183694414 GAGACTGGGGAGAGAAGGGAAGG - Intergenic
967329370 3:188275386-188275408 CAGGCTGGGCAACAGAGGGAGGG - Intronic
967657790 3:192072421-192072443 CAGACTGTATAGAGGTGGGAAGG + Intergenic
967740783 3:193000063-193000085 CAGACTGTATAGAGGTGGGAAGG - Intergenic
968089681 3:195892429-195892451 CAGTCTGGCCAGGAGAGGGAAGG + Intronic
968487189 4:868279-868301 CAGACTGGGATGAAGAGCGAGGG + Intronic
968594822 4:1476944-1476966 CAGCCTGGGCAGGGGAGGGAGGG - Intergenic
968810211 4:2796355-2796377 GAGCCTGGGGAGAAGAGAGAAGG - Intronic
968993692 4:3931749-3931771 CAGACTGTATAGAGGTGGGAAGG - Intergenic
969392610 4:6901445-6901467 CAGACGGGGTGGGAGAGTGAAGG + Intergenic
969728813 4:8941189-8941211 AAGACGGGAAAGAAGAGGGAGGG - Intergenic
970274079 4:14378714-14378736 CAGAGTGAGTAGAACATGGAAGG + Intergenic
970912457 4:21293119-21293141 CAGACAGAGTAGATGAGGCAAGG - Intronic
971553293 4:27980246-27980268 CAGACTGTATAGAGGTGGGAAGG - Intergenic
972687935 4:41369183-41369205 TAGACTGGGAAGATGGGGGAGGG - Intronic
972852691 4:43070666-43070688 AATACTGGGTAGAAGAGGGTGGG + Intergenic
973038067 4:45432728-45432750 TAGAATGGCTAGAAGTGGGATGG + Intergenic
973639902 4:52892322-52892344 CAGACTGGCTTGGGGAGGGAAGG - Intronic
974336120 4:60547014-60547036 GGGAGTGGGTAGAGGAGGGAAGG - Intergenic
975151972 4:71032846-71032868 CAGCCTGGGTAGAAGGGGAGAGG - Intergenic
975152028 4:71033160-71033182 CAGCCTGGGTAGAAGGGGAGAGG - Intergenic
975560693 4:75705620-75705642 CAGGCTGGGAAGGAGAGTGAGGG + Intronic
975804030 4:78093975-78093997 AAGACTTGGTGGAAGTGGGAAGG - Intronic
975933570 4:79555309-79555331 CAGACTGTATAGAGGTGGGAAGG + Intergenic
976827518 4:89277358-89277380 CAGACTGGGCATGACAGGGAAGG + Intronic
976884246 4:89966094-89966116 CAGACTGTATAGAGGTGGGAAGG + Intergenic
977062189 4:92272838-92272860 CAGACTGTATAGAGGTGGGAAGG + Intergenic
977216845 4:94294585-94294607 CAGACTGTATAGAGGTGGGAAGG + Intergenic
977224954 4:94384246-94384268 CAGACTGTATAGAGGTGGGAAGG + Intergenic
977721552 4:100245018-100245040 AATACAGGGTAGAAGAGGGTGGG - Intergenic
978000804 4:103555100-103555122 CAGACTGTATAGAGGTGGGAAGG + Intergenic
978349170 4:107803335-107803357 CAGACTGGATAGCAGATTGAAGG - Intergenic
978438939 4:108713528-108713550 CAGACTGTATAGAGGTGGGAAGG - Intergenic
979054302 4:115977000-115977022 CAGACTGTATAGAGGTGGGAAGG + Intergenic
979146926 4:117256466-117256488 CAGACTGTATAGAGGTGGGAAGG - Intergenic
979894854 4:126146468-126146490 CAGACTGTGTAGAGGTGGGAAGG + Intergenic
980097364 4:128504988-128505010 AATAGTGGGTAGAAGAGGGTGGG - Intergenic
980111597 4:128642198-128642220 CAGACTGTATAGAGGTGGGAAGG + Intergenic
980349496 4:131667812-131667834 CAGACTGTATAGAGGAGGGAAGG - Intergenic
980575318 4:134679245-134679267 CAGACTGTATAGAGGTGGGAAGG + Intergenic
980611470 4:135168623-135168645 CAGACTGTATAGAGGTGGGAAGG + Intergenic
980713383 4:136599986-136600008 AAGAATGTGTAGAAAAGGGAAGG + Intergenic
980714850 4:136615576-136615598 CGGACTGTATAGAAGTGGGAAGG - Intergenic
980904258 4:138932242-138932264 CAGACTGTATAGAGGTGGGAAGG - Intergenic
981040565 4:140217872-140217894 CAGACTGTATAGAGGTGGGAAGG - Intergenic
981597720 4:146446088-146446110 AATACTGGGTAGAAGAGGGTGGG - Intronic
982078875 4:151767136-151767158 CAGAATTGCTATAAGAGGGATGG - Intergenic
982157481 4:152536154-152536176 CAGAGCGGAAAGAAGAGGGAGGG - Intergenic
982180162 4:152742669-152742691 CAGACTGTATAGAGGTGGGAAGG + Intronic
982196274 4:152918630-152918652 CAGTTTGGGAAGAAGAGGGATGG - Intergenic
982413851 4:155109620-155109642 CAGACTGTATAGAGGTGGGAAGG + Intergenic
983024196 4:162713475-162713497 CAGACTGTGTAGAGGTGGGTAGG - Intergenic
983345914 4:166525112-166525134 CAAACTGCGTAGAGGTGGGAAGG - Intergenic
983448376 4:167880704-167880726 CAGACTGTATAGAGGTGGGAAGG - Intergenic
983452656 4:167927269-167927291 CAGACTGTATAGAGGTGGGAAGG - Intergenic
983659891 4:170120826-170120848 CAGACTGTATAGAGGTGGGAAGG - Intergenic
984098692 4:175462519-175462541 CAGACTGTATAGAGGTGGGAAGG + Intergenic
984129602 4:175857009-175857031 AATACTGGGTAGAAGAGGGCAGG - Intronic
984437684 4:179725571-179725593 CGGACTGCGTAGAGGTGGGAAGG - Intergenic
984678349 4:182577011-182577033 CAGACTGGCTAGAACACAGAGGG - Intronic
985085582 4:186309212-186309234 CTGACTGGGTAGATTTGGGATGG + Intergenic
985582664 5:707166-707188 CAGACTGTATAGAGGTGGGAAGG - Intergenic
986149336 5:5112671-5112693 GAGACTGGGAAGGAGAGTGAAGG - Intergenic
986163242 5:5250209-5250231 AATACTGGGTAGAAGATGGCAGG - Intronic
986186868 5:5450656-5450678 CAGACTGAATATTAGAGGGATGG + Intronic
986193839 5:5519917-5519939 CAGACTGTATAGAGGTGGGAAGG - Intergenic
986368533 5:7058716-7058738 CAGACTGTATAGAGGCGGGAAGG + Intergenic
986389190 5:7267962-7267984 CAGACTGTATAGAGGTGGGAAGG - Intergenic
986457197 5:7931435-7931457 AATACTGGATAGAAGAGGGTGGG + Intergenic
987251090 5:16102322-16102344 AATACTGGGTAGAAGAGGGTGGG + Intronic
987268222 5:16278357-16278379 AATACTGGGTAGAAGAGGGCCGG + Intergenic
987487144 5:18538050-18538072 CAGACTGTATAGAGGTGGGAAGG - Intergenic
987926762 5:24351431-24351453 AATACTGGGTAGAAAAGGGCGGG - Intergenic
988239785 5:28594777-28594799 TAAACTGGGAAGAACAGGGATGG - Intergenic
988513810 5:31888219-31888241 CAGCCTGGGTGACAGAGGGAGGG - Intronic
988635345 5:32977798-32977820 AATACTGGGTAGAAGAGGGCAGG + Intergenic
990463083 5:56047620-56047642 AATACTGGGTAGAAGAGGGCAGG + Intergenic
990551272 5:56882155-56882177 CAGATGGGGTAGAAGAAGAAGGG - Exonic
990988560 5:61662860-61662882 CAGACTGGGTGGAGGTGGCATGG - Intronic
991333519 5:65520215-65520237 CAGAGTGGGAGCAAGAGGGAGGG - Intronic
993187123 5:84635404-84635426 CAGACTGGGCCGAGGAGGCAGGG + Intergenic
993340206 5:86716253-86716275 AAAACTGGGAAGAAGAGAGAGGG + Intergenic
993837001 5:92828337-92828359 CAGACTGTATAGAGGTGGGAAGG - Intergenic
994125705 5:96167661-96167683 CAGACTGTATAGAGGTGGGAAGG + Intergenic
994368470 5:98943438-98943460 CAGACTGAGTGGAAGAGACATGG + Intergenic
994375380 5:99012147-99012169 CAGACTGTATAGAGGTGGGAAGG + Intergenic
994532242 5:100985579-100985601 CAGACTGTATAGAGGTGGGAAGG + Intergenic
994557231 5:101319283-101319305 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
994778572 5:104064976-104064998 CAGACTGTATAGAGGTGGGAAGG + Intergenic
995352339 5:111193845-111193867 CAGAGTATGTAGAAGAGGGCAGG + Intergenic
995550193 5:113273886-113273908 CAGACTTGGGAGATGAAGGAAGG - Intronic
995679538 5:114701505-114701527 CTAATGGGGTAGAAGAGGGAAGG - Intergenic
995899055 5:117047708-117047730 CAGACTGTATAGAGGTGGGAAGG + Intergenic
996075843 5:119192842-119192864 AAGACTGGGTATGAGAGGGAAGG - Intronic
996242010 5:121215596-121215618 AATACTGGGTAGAAGAGGGCAGG + Intergenic
996358302 5:122620215-122620237 CAGACTGTATAGAGGTGGGAAGG + Intergenic
996574641 5:124967685-124967707 CAGACTGTATAGAGGTGGGAAGG + Intergenic
997042864 5:130278148-130278170 CAGACGGGGCTGAAGAGGCAGGG + Intergenic
997304282 5:132826525-132826547 CAGCCTGGGTGGAACAGGGTTGG - Exonic
997746714 5:136305687-136305709 CAGACTGTATAGAGGTGGGAAGG - Intronic
998238379 5:140420022-140420044 CAGCCTGGGCAACAGAGGGAGGG - Intronic
998633412 5:143926108-143926130 CAGACTGTATAGAGGTGGGAAGG + Intergenic
998644040 5:144042525-144042547 AATTCTGGGCAGAAGAGGGAGGG - Intergenic
998693376 5:144612649-144612671 CAGACTGTATAGAGGTGGGAAGG + Intergenic
999424111 5:151471990-151472012 CAGACTGTGTGGAAGGGGCAGGG - Intronic
1000234504 5:159344889-159344911 AATACTGGGTAGAAGAGGGCAGG - Intergenic
1000438938 5:161244890-161244912 CGGACTGCGTAGAGGTGGGAAGG - Intergenic
1000519083 5:162276737-162276759 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1000857065 5:166412130-166412152 TAGACCGGGTGGAGGAGGGATGG + Intergenic
1000935325 5:167299257-167299279 CAGACTGTATAGAGGTGGGAAGG + Intronic
1001331134 5:170763338-170763360 CAGACTGTATAGAGGTGGGAAGG + Intronic
1001385521 5:171335566-171335588 CAGATTTGGGAGAGGAGGGATGG + Intergenic
1002400554 5:178989409-178989431 CAGACAGGGAAGAAGGGGGAGGG + Intronic
1002568570 5:180127699-180127721 AAGAGTGGGTAAAAGAGGGAAGG + Intronic
1003100454 6:3172533-3172555 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1003380675 6:5621892-5621914 CAGACTGGCCAGCAGAAGGAAGG - Intronic
1003429859 6:6029129-6029151 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1003841673 6:10126952-10126974 CAGTAAGGGTAGAAGAAGGAGGG - Intronic
1004106578 6:12671735-12671757 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1004127159 6:12885061-12885083 CTGAGTGGGTTGAAGAGGGATGG - Intronic
1004507681 6:16260326-16260348 CAGACTGTATAGAGGTGGGAAGG + Intronic
1004575545 6:16890322-16890344 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1004768257 6:18755433-18755455 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1004777287 6:18862008-18862030 CAAACTAGGAAGAAGAGGGGTGG - Intergenic
1004837358 6:19543493-19543515 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1006489975 6:34378939-34378961 CAGACTGGGCAGAAGAGGCCAGG - Intronic
1006719605 6:36141809-36141831 CAGACTGGCGTGAAGAGGGAAGG - Intronic
1007849773 6:44791947-44791969 CAGAGTGGGTAGAGCAGGGAGGG - Intergenic
1007931985 6:45700019-45700041 AATACTGGGCAGAAGAGGGCAGG + Intergenic
1008089475 6:47279006-47279028 CAGACTGTGAAGAAAAGTGAGGG - Intronic
1009343645 6:62588438-62588460 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1009359679 6:62796124-62796146 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1010586303 6:77661329-77661351 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1010621843 6:78086021-78086043 AAAACTGGGTAGAAAAGGGCGGG - Intergenic
1010662540 6:78587139-78587161 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1010826633 6:80484083-80484105 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1010829326 6:80511091-80511113 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1010894231 6:81346483-81346505 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1011770630 6:90671549-90671571 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1012066226 6:94555277-94555299 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1012316127 6:97783957-97783979 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1012675476 6:102106884-102106906 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1013401118 6:109797111-109797133 TCCACTGGGTAGAAGTGGGATGG + Intronic
1013407573 6:109857085-109857107 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1013488281 6:110618822-110618844 CAGACAGCATAGCAGAGGGAGGG - Intronic
1013644906 6:112127503-112127525 CAGTATGGGGAGAAGAGTGAGGG + Intronic
1013687383 6:112601222-112601244 CATCCTGGGTAGGAGAGGGGTGG - Intergenic
1014047781 6:116913092-116913114 CAGCCTGGGCAACAGAGGGAGGG - Intronic
1014220390 6:118793431-118793453 CAGATGGGGGAGAAGAGGTAGGG - Intergenic
1014719209 6:124896413-124896435 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1014891855 6:126853117-126853139 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1015271687 6:131343245-131343267 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1015278467 6:131407190-131407212 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1015630001 6:135222755-135222777 GGGACTGGGTAGAAACGGGATGG - Intergenic
1016113829 6:140258785-140258807 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1016519119 6:144927548-144927570 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1016853590 6:148644177-148644199 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1016945641 6:149530207-149530229 AAGACTGGGGGAAAGAGGGAGGG + Intronic
1017389822 6:153925868-153925890 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1017779025 6:157701989-157702011 CAGACTGTGTAGAGGTGGGAAGG + Intronic
1018077991 6:160233303-160233325 CAGACTGTATAGAGGTGGGAAGG - Intronic
1018084179 6:160287911-160287933 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1018438811 6:163789152-163789174 TTGACTGGGGAGAAGAGGGCAGG - Intergenic
1018495080 6:164340074-164340096 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1018752074 6:166815617-166815639 CATACTGGGGAGAAGAGAGGAGG - Intronic
1018918291 6:168152103-168152125 CAGACTGGGAAGTGGAGGCAGGG + Intergenic
1019034112 6:169040592-169040614 CAGAGAGGGGAGAAGAGAGAGGG + Intergenic
1019691105 7:2413209-2413231 GGGACTGGGAGGAAGAGGGAAGG - Intronic
1020133814 7:5574873-5574895 CAGGCTGGGAAGGACAGGGAGGG + Intergenic
1020322440 7:6949493-6949515 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1020540707 7:9459051-9459073 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1021430225 7:20550373-20550395 CGGACTGCGTAGAGGTGGGAAGG - Intergenic
1021637702 7:22707995-22708017 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1021739739 7:23674285-23674307 GAGGCTGGGAAGAAGAGGGTCGG - Intergenic
1021785865 7:24152079-24152101 CAGACTGGGGAGAAGGAGAAGGG - Intergenic
1021977590 7:26025534-26025556 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1022008994 7:26292418-26292440 CAGGCCGGGTAGAAGGGGGTGGG + Intronic
1022572440 7:31468155-31468177 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1022709420 7:32836952-32836974 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1022854434 7:34301465-34301487 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1023308853 7:38861434-38861456 TCCAGTGGGTAGAAGAGGGAAGG + Intronic
1023525257 7:41095846-41095868 CAGGCTGGGGAGAAGACAGAGGG + Intergenic
1025235634 7:57232794-57232816 CAGCCTGGGTGACAGAGGGAGGG + Intergenic
1025831445 7:65054685-65054707 CAGCTTGGGTAGAAGAGGCCAGG - Intergenic
1025995229 7:66523530-66523552 CAGTCTGGGTTCAGGAGGGAGGG + Intergenic
1026986874 7:74560218-74560240 CAGTCTGGGTTCAGGAGGGAGGG + Intronic
1027649433 7:80847154-80847176 CAAACTGGGTAGAAAATTGAAGG - Intronic
1028019132 7:85749408-85749430 CAGTTTGGGTAGAAGTGGGATGG - Intergenic
1028424708 7:90673425-90673447 CAGCCTGGGCAACAGAGGGAGGG - Intronic
1028670821 7:93398307-93398329 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1028690484 7:93644231-93644253 CAGACTGTATAGAGGTGGGAAGG - Intronic
1029877830 7:103772567-103772589 CAGCCTGAGGGGAAGAGGGAGGG + Intronic
1030253911 7:107484900-107484922 CAGACTGTGTAGAAAGAGGAGGG + Intronic
1030441341 7:109593161-109593183 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1031364451 7:120886967-120886989 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1031686160 7:124733404-124733426 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1031704238 7:124961677-124961699 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1031704249 7:124961758-124961780 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1031777765 7:125922780-125922802 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1032463854 7:132131257-132131279 CAGACTCAGGAGATGAGGGATGG + Intronic
1033211944 7:139466351-139466373 CAGACTGTATAGAGGTGGGAAGG - Intronic
1033422823 7:141218281-141218303 CAGCCTGGCTGGCAGAGGGAGGG + Intronic
1033458842 7:141527271-141527293 AAGATGGGGTTGAAGAGGGATGG - Intergenic
1033590191 7:142802342-142802364 CAGACTGGGGAGAAAATGCAGGG + Intergenic
1033675632 7:143538562-143538584 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1033696202 7:143790882-143790904 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1033857231 7:145578182-145578204 AATACTGGGTAGAAAAGGGCAGG - Intergenic
1033909154 7:146244718-146244740 CAGACTGTATAGAGGTGGGAAGG + Intronic
1033939902 7:146639865-146639887 CAGAGTCCGAAGAAGAGGGAAGG + Intronic
1034387863 7:150755509-150755531 GAGACTGCCTAGGAGAGGGAGGG - Intergenic
1034416874 7:150969965-150969987 CAGGGTCAGTAGAAGAGGGAGGG - Intronic
1034471055 7:151254549-151254571 CAGGCAGGGTGGAAGAGGCAGGG - Intronic
1034509319 7:151520813-151520835 CAGCCTGGGCAGAATAGGGGCGG - Intergenic
1034840518 7:154391329-154391351 CAGACTGGGAAGACTGGGGATGG - Intronic
1035783082 8:2244257-2244279 CAGTCCGGGTAGGAGAGGGGTGG + Intergenic
1035809043 8:2475329-2475351 CAGTCCGGGTAGGAGAGGGGTGG - Intergenic
1036070572 8:5437764-5437786 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1036611465 8:10353649-10353671 CAGACTGGGCTGCAGACGGAGGG + Intronic
1037209454 8:16368234-16368256 CAGACTGGGTAAACAAGGAAGGG + Intronic
1037299062 8:17432267-17432289 CAGACTGGGAAGACGAGGACAGG - Intergenic
1037319521 8:17630118-17630140 CAGGCAGGGTAGACGAGAGATGG - Intronic
1038213887 8:25543982-25544004 CAGACTGGGGACAGGAGGTAGGG + Intergenic
1039039633 8:33395143-33395165 AATACTGGGTAGAAGAGGGTGGG + Intronic
1039151474 8:34511725-34511747 CAGGCTGGTTGGAAGAGTGAGGG + Intergenic
1039290500 8:36089218-36089240 AATACTGGGTAGAAGAGAGTGGG - Intergenic
1040435854 8:47390964-47390986 CAGAGAGGGTGGAAGAGAGAGGG - Intronic
1041774052 8:61504940-61504962 CACACTGGGTGGAGGTGGGAGGG - Intronic
1042216445 8:66433037-66433059 CAGACTGGGTGTAGAAGGGAAGG + Intronic
1042453875 8:68977520-68977542 CAGACTGTGTACAGGTGGGAAGG - Intergenic
1042510984 8:69610601-69610623 CAGCATGGGTTGAAGAGGGAAGG - Intronic
1042707688 8:71679290-71679312 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1043353353 8:79387441-79387463 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1043810546 8:84733654-84733676 CAGACTGGCAGGAACAGGGAGGG - Intronic
1044148206 8:88743550-88743572 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1044548045 8:93481443-93481465 CAGACTGGGTAAAAGTGTGCAGG + Intergenic
1044922307 8:97179450-97179472 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1044937831 8:97309953-97309975 CAGAGAGGGAACAAGAGGGAGGG - Intergenic
1045197845 8:99948245-99948267 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1045295823 8:100870999-100871021 CAGACTCAGTAGATGATGGAGGG + Intergenic
1045482225 8:102601469-102601491 CAGCCTGGGATGAGGAGGGAGGG - Intergenic
1045645101 8:104290310-104290332 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1046419717 8:113964376-113964398 GAGGCTGGGTAGGAGAAGGAGGG - Intergenic
1047648778 8:126897682-126897704 GAGACTGGGGAAAGGAGGGATGG - Intergenic
1047794032 8:128235692-128235714 CAGACTGAGTAGAAGAGAGAGGG + Intergenic
1047961285 8:130013871-130013893 CAGAATGGGCAGAAGAATGATGG - Intronic
1048135801 8:131745305-131745327 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1048144119 8:131823775-131823797 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1048585117 8:135768473-135768495 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1048763883 8:137825942-137825964 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1048800351 8:138188928-138188950 AATTCTGGGCAGAAGAGGGAAGG + Intronic
1049201280 8:141341754-141341776 CAGAATGGGCAGGTGAGGGAAGG + Intergenic
1049226855 8:141457446-141457468 CACACTGGGTGGAAGTGGGAAGG + Intergenic
1049464975 8:142746946-142746968 GAGACTGGACAGAAGACGGATGG + Intergenic
1049868453 8:144955220-144955242 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1050122426 9:2321164-2321186 GAGAAGGGGTAGAAGAGGGAGGG + Intergenic
1050707901 9:8424677-8424699 GGGACTGGGAAGAAAAGGGAAGG + Intronic
1051126158 9:13808072-13808094 CAAACTGGACAGAAGAGGGATGG + Intergenic
1051189118 9:14492559-14492581 CAGAGCAGGAAGAAGAGGGAGGG + Intergenic
1052163492 9:25292823-25292845 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1052588851 9:30465554-30465576 AGGAATGGGTAGAGGAGGGAGGG + Intergenic
1052653735 9:31331325-31331347 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1052720294 9:32165674-32165696 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1052762306 9:32605200-32605222 CAGGCTGGGAAGGAGAGGGAAGG - Intergenic
1053783275 9:41632260-41632282 CAGACTGTATAGAGGAGGGAAGG + Intergenic
1054171228 9:61842402-61842424 CAGACTGTATAGAGGAGGGAAGG + Intergenic
1054666304 9:67738410-67738432 CAGACTGTATAGAGGAGGGAAGG - Intergenic
1054715471 9:68553440-68553462 AAAAATGGGTAGAAGAAGGAAGG + Intergenic
1054944624 9:70783012-70783034 CAGGCTGGGTACAAGAGGGATGG + Intronic
1055676715 9:78670405-78670427 GAGACTGGGTATAATAGTGATGG + Intergenic
1055763879 9:79640158-79640180 CAGATGGGGCAGAAGAGAGAAGG + Intronic
1055763904 9:79640514-79640536 CAGATGGGGCAGAAGAGAGAAGG - Intronic
1055882116 9:81013950-81013972 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1055893283 9:81145892-81145914 GAGAGAGGGGAGAAGAGGGAGGG + Intergenic
1056114770 9:83431209-83431231 GAGACTAGTTAGATGAGGGAAGG - Intronic
1056324278 9:85463581-85463603 CAGACTGCATAGAGGTGGGAAGG - Intergenic
1056363298 9:85880226-85880248 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1057558750 9:96110792-96110814 CAGACTAGGTGGAAAAGGAAGGG - Intronic
1057783817 9:98072022-98072044 CTGCCTGGGGAGCAGAGGGAAGG - Intronic
1057817409 9:98305786-98305808 CAGCCTGGGTGGCAGAGTGAGGG + Intronic
1057828826 9:98391896-98391918 CAGAATGGATTGAGGAGGGAAGG + Intronic
1057982404 9:99674530-99674552 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1058025811 9:100141483-100141505 CAGACTGTATAGAGGTGGGAAGG + Intronic
1058577591 9:106420566-106420588 CAGAGGGGGTTGGAGAGGGAAGG + Intergenic
1058675872 9:107399490-107399512 CAGCCTTGGAAGGAGAGGGATGG + Intergenic
1058694216 9:107545754-107545776 CAGACTGGGCACATGAGGGTTGG + Intergenic
1058907177 9:109491165-109491187 CAGCCTGGGTGGCAGAGTGAGGG + Intronic
1059545855 9:115175958-115175980 CGGACTGTGTAGAAGTGGGAAGG + Intronic
1059574928 9:115477720-115477742 CAGACTGCATAGAGGTGGGAAGG - Intergenic
1059671652 9:116497714-116497736 CAGGCTGGGGAGAAGGGGGAGGG + Intronic
1059889245 9:118783016-118783038 CAGAGTGGATAGCAGAGAGAGGG + Intergenic
1060135322 9:121147921-121147943 CAGACTGAGAAGGAGAAGGAGGG + Intronic
1060273149 9:122161750-122161772 CAGACAAGGTAAAAGACGGAAGG + Intronic
1060318108 9:122531786-122531808 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1060583300 9:124770839-124770861 GAGACCGGGGAGGAGAGGGAGGG + Intronic
1060632915 9:125175987-125176009 CAGACACACTAGAAGAGGGATGG + Intronic
1060737518 9:126075746-126075768 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1061232329 9:129322011-129322033 CAGAGTGGGCAGAAGAGGACGGG - Intergenic
1061481270 9:130898782-130898804 GTGGGTGGGTAGAAGAGGGAGGG - Intergenic
1062143937 9:134978701-134978723 CAGCCTGGGTAACAGAGTGAGGG + Intergenic
1185663005 X:1741956-1741978 CAGCCTGGAAAGAAAAGGGAGGG + Intergenic
1185837636 X:3360217-3360239 CAGGGTCCGTAGAAGAGGGAAGG - Intergenic
1185960376 X:4541825-4541847 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1186112537 X:6273521-6273543 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1186159302 X:6759985-6760007 CACACAGGGAAGAAGTGGGAAGG - Intergenic
1186417588 X:9397356-9397378 CAGCCTGGGCAGCAGAAGGAGGG - Intergenic
1186784398 X:12944207-12944229 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1187086205 X:16046025-16046047 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1187524185 X:20039074-20039096 CAGAATGGGTAGTAGAAGAAGGG + Intronic
1188200503 X:27289544-27289566 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1188328070 X:28831585-28831607 CAGACTTGGGGAAAGAGGGATGG + Intronic
1188419861 X:29979918-29979940 CAGACTGGATAGAGGTGGGAAGG - Intergenic
1188431387 X:30107930-30107952 CAGACTGGATAGAGGTGGGAAGG - Intergenic
1188438052 X:30185379-30185401 AATACTGGGTAGAAAAGGGCAGG + Intergenic
1188463037 X:30450240-30450262 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1188856579 X:35203648-35203670 GAGACTGTGGAGAACAGGGAAGG + Intergenic
1190049390 X:47138380-47138402 CACATTGGGATGAAGAGGGAGGG - Intergenic
1190100368 X:47518180-47518202 CTGACTGGGGAGGAGAGTGAGGG - Intergenic
1190100752 X:47521184-47521206 CTAACTGGGGAGAAGAGTGAGGG - Intergenic
1190441883 X:50482921-50482943 GAGAGTGGGGAGAAGAGAGAGGG + Intergenic
1190713128 X:53083438-53083460 TAGACTGGGTGGAAGAGGGATGG + Intronic
1191009447 X:55745544-55745566 CAGCCTGTGTAGAAGAAAGATGG - Intronic
1191761733 X:64654272-64654294 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1192274038 X:69611869-69611891 CAGGATGTGTAGGAGAGGGAAGG - Intergenic
1192589995 X:72351686-72351708 CAAACTGGGTGGAACAAGGAGGG + Intronic
1192623749 X:72706569-72706591 TAGAATGGGAAGCAGAGGGAGGG + Intronic
1192706555 X:73532677-73532699 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1192731116 X:73803533-73803555 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1192798538 X:74444392-74444414 CAGCCAGGATTGAAGAGGGAGGG - Intronic
1193047054 X:77064616-77064638 CAGATTGAGTAGATGGGGGAGGG - Intergenic
1193886242 X:86986179-86986201 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
1194802209 X:98287883-98287905 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1195016678 X:100788050-100788072 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1195320272 X:103716155-103716177 CAGACTGGGATGATTAGGGAAGG - Intronic
1196220662 X:113110052-113110074 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1196504259 X:116422694-116422716 ATGGCTGGGTAGCAGAGGGAAGG - Intergenic
1197651879 X:129073994-129074016 GAGATTGGGAAGAAGAGGGGAGG + Intergenic
1198073535 X:133172717-133172739 CAGTATGGCTAGAACAGGGATGG + Intergenic
1198225281 X:134639505-134639527 CAAACTGGGTAGTTGTGGGAAGG - Intronic
1198487448 X:137102437-137102459 CAGACTGGGAAGACAAGGGAAGG - Intergenic
1198598764 X:138263180-138263202 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1198599083 X:138265655-138265677 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1198962433 X:142196209-142196231 CTGTCTGGACAGAAGAGGGAGGG - Intergenic
1200532541 Y:4356743-4356765 CAGACTGTATAGAGGTGGGAAGG + Intergenic
1200675630 Y:6143564-6143586 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1201238189 Y:11931518-11931540 CAGGGTCCGTAGAAGAGGGAAGG + Intergenic
1201307155 Y:12560868-12560890 CAGACTGTTTAGAGGTGGGAAGG + Intergenic
1201473227 Y:14355712-14355734 CAGACTGTGTAGAGGTTGGAAGG + Intergenic
1201547674 Y:15183933-15183955 AATACTGGGTAGAAAAGGGTGGG + Intergenic
1201581680 Y:15516753-15516775 CAGACTGTATAGAGGTGGGAAGG - Intergenic
1201639109 Y:16159966-16159988 AATTCTGGGTAGAAGAGGGTGGG + Intergenic
1201663704 Y:16425361-16425383 AATTCTGGGTAGAAGAGGGTGGG - Intergenic
1202270966 Y:23073652-23073674 CAGAAAGGGAAGAAGGGGGATGG + Intergenic
1202295060 Y:23347030-23347052 CAGAAAGGGAAGAAGGGGGATGG - Intergenic
1202423961 Y:24707396-24707418 CAGAAAGGGAAGAAGGGGGATGG + Intergenic
1202446828 Y:24962689-24962711 CAGAAAGGGAAGAAGGGGGATGG - Intergenic