ID: 1125451637

View in Genome Browser
Species Human (GRCh38)
Location 15:39814191-39814213
Sequence GAGAATGAAGAGAAAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1984
Summary {0: 1, 1: 0, 2: 21, 3: 191, 4: 1771}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125451637 Original CRISPR GAGAATGAAGAGAAAGAGGC AGG (reversed) Intronic
900418813 1:2546837-2546859 GTGAATGAAGAGCAACGGGCCGG + Intergenic
900686962 1:3954734-3954756 AAGAATGCAGGGAAAGAGACAGG - Intergenic
900735551 1:4297487-4297509 GAGAATGGACTGGAAGAGGCAGG + Intergenic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
900865633 1:5266865-5266887 GAGAATGAACAGAAAGCGCAGGG + Intergenic
901230791 1:7640806-7640828 GAGCATGTAGAGGAAGAAGCAGG + Intronic
901435295 1:9243848-9243870 GAGAGAGATGAGGAAGAGGCGGG + Intronic
901560836 1:10068980-10069002 AAGAGTTAAGAGACAGAGGCAGG - Intronic
901567847 1:10133612-10133634 AATAAAGAGGAGAAAGAGGCCGG + Intronic
901661985 1:10804365-10804387 GGGAGGGAAGAGAAAGGGGCAGG - Intergenic
901720775 1:11195465-11195487 GAGAAAGGAGTGAAGGAGGCAGG + Exonic
901860868 1:12073500-12073522 AAGAAAGAAGAGAAGGAGGGAGG - Intronic
902317621 1:15634925-15634947 TAGTAAGAAGAGTAAGAGGCAGG - Intronic
902516273 1:16991383-16991405 GAGCAGGAAGAGAAAGATTCTGG - Intronic
902680366 1:18039692-18039714 GAGAAAGCAGAGAAGGGGGCTGG + Intergenic
902837808 1:19058165-19058187 GAGGGGGAAGAGAAAGAGGCTGG + Intergenic
902982367 1:20134190-20134212 GAGAAAGAAGAGAGAGAAGGAGG - Intergenic
903036071 1:20493390-20493412 GAGAAGGCAGAGAGAGAAGCCGG + Intergenic
903126497 1:21251760-21251782 GAGAAAGAACGGAAAAAGGCTGG - Intronic
903165597 1:21518204-21518226 AAGAGTGACGAGAAAGAGGCTGG + Intronic
903406330 1:23099899-23099921 GAGGATGTAGATGAAGAGGCTGG - Intronic
903670250 1:25031182-25031204 GAGGATGAAGGGATGGAGGCTGG + Intergenic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
904233371 1:29096332-29096354 GAGACAGAAGAGAAGGAGGAGGG + Intronic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
904676895 1:32204284-32204306 GACGATGAAGAGGAAGAGGATGG + Exonic
905042431 1:34971144-34971166 GAGAAGCAAGAGAGAGAAGCAGG - Intergenic
905069914 1:35216579-35216601 AAGAGAAAAGAGAAAGAGGCGGG - Intergenic
905205533 1:36340967-36340989 GAGACGGGAGAGAAAGAGCCAGG + Exonic
905319057 1:37102875-37102897 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
905478241 1:38243913-38243935 GAGAATGCAGTGAAAGTGTCTGG - Intergenic
905489787 1:38334378-38334400 GAGAATCAAGAGAATTAGGCGGG - Intergenic
905975449 1:42170865-42170887 GAGCATCAAGGGAAAGAGCCGGG - Intergenic
906002456 1:42438558-42438580 GAGTAGGAGGAGAAAAAGGCTGG - Intronic
906013791 1:42554708-42554730 GAGAATGAACACAAATATGCTGG - Intronic
906075379 1:43048365-43048387 GAAGAGGAAGAGAAAGAGACAGG - Intergenic
906281436 1:44556853-44556875 AAAAATGAACAGGAAGAGGCCGG - Intronic
906324560 1:44836838-44836860 GATACTACAGAGAAAGAGGCAGG + Intronic
906566213 1:46803044-46803066 CAGAATGGAGAGGATGAGGCTGG + Intronic
906862478 1:49376402-49376424 GAGCAGGAAAAGAAAGAGGTAGG + Intronic
906903373 1:49862437-49862459 GAGGAAGTAGAGAAAGAAGCGGG + Intronic
906940761 1:50253153-50253175 GAAAATGAAGAGCAAGGGGAAGG - Intergenic
907234463 1:53032596-53032618 GAAGAGGAAGAGAAAGTGGCTGG + Intronic
907288500 1:53397366-53397388 GAGAAACAGGAGAAAGGGGCAGG - Intergenic
907356567 1:53879874-53879896 GAGAATGAAGAAAAGCAGGGTGG + Intronic
907532169 1:55110687-55110709 GAGTAAGAAGAGAAAGAGACAGG + Intronic
907671385 1:56477638-56477660 GAAAATGAAGTCAAAGCGGCCGG + Intergenic
907692150 1:56679830-56679852 GAGGAGGAAGAGGAAGAGGAGGG - Intronic
907703229 1:56810042-56810064 GAGAAGGAAGAGAAAGAGGAGGG + Intronic
907773903 1:57493721-57493743 AAGAAAGAAGAAAAAGAGGGAGG + Intronic
907809249 1:57852071-57852093 GAGAAAGAAGAGGAAGGGACAGG - Intronic
907811091 1:57870647-57870669 GAGCATGATGAGGCAGAGGCTGG + Intronic
907858495 1:58327318-58327340 GAGAAGGAAGAGGAGGAGGCAGG + Intronic
908090740 1:60683182-60683204 GAGAATGAAGGAGAAGAGGAAGG + Intergenic
908256673 1:62308916-62308938 GAGATGGAGGAAAAAGAGGCAGG - Intronic
908290996 1:62667150-62667172 AAGAATGACTAGAGAGAGGCAGG - Intronic
908880661 1:68728796-68728818 GAAAATAAAAAGAAAGATGCTGG - Intergenic
909104985 1:71396139-71396161 GTAAAAGAAGAGAAAGAGGAAGG - Exonic
909263125 1:73520745-73520767 GAAAATGAACAGAAAGATACAGG + Intergenic
909406893 1:75301073-75301095 GAAAATGAAGAAGAAGAGGGTGG - Intronic
909410222 1:75341480-75341502 GAGAAAGAAAAGAAAGAGAAAGG + Intronic
909419230 1:75444933-75444955 GAGATTGAGGAGAAAGAAGAAGG + Intronic
909566480 1:77058482-77058504 GAGGAAGAAGAGAAAGGGGGAGG - Intronic
909694443 1:78450207-78450229 GAGAAGGAAAGGAGAGAGGCTGG - Intronic
909714288 1:78689155-78689177 TAGAATGAAAAGAAAGAAGAAGG - Intergenic
909885281 1:80934399-80934421 GAGAAAGAGGAGGAAGAGGAGGG + Intergenic
909964227 1:81887952-81887974 GAGAATTCAGGGAAAGAGTCTGG + Intronic
909990312 1:82215578-82215600 GAGAATGATGAGAAAAAACCTGG - Intergenic
910008765 1:82434173-82434195 GAAAATCAGGAGAAAGAGGAGGG + Intergenic
910030512 1:82716199-82716221 GAGAATGAGGGGCAAGAGACAGG - Intergenic
910265088 1:85330140-85330162 GAACATGCAGAGAAAGATGCAGG + Intronic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
910459626 1:87435135-87435157 GAAAATAAATGGAAAGAGGCTGG + Intergenic
910693991 1:89993552-89993574 CAAAAGGAAGAGGAAGAGGCTGG + Intergenic
910817533 1:91307831-91307853 GAGAAAGAAGAGAAAGAAAGAGG - Intronic
911172926 1:94789187-94789209 GAGGATGTAGAGAAAGGGGAAGG + Intergenic
911224506 1:95290533-95290555 GGGATAGAAGAGAAAGAGGAAGG - Intergenic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911742823 1:101405914-101405936 GAGGCTCAAGAGAGAGAGGCAGG - Intergenic
911745393 1:101436387-101436409 GAGAAGGAAGTGAAACAGGATGG + Intergenic
911790567 1:102010820-102010842 GAGAATGAAAGGCAAGAGACAGG + Intergenic
911855034 1:102865753-102865775 GGTAATGAAGATAAAGAGGAAGG + Intergenic
911890237 1:103359643-103359665 GAAAATGAGAAGAAAAAGGCTGG + Intergenic
911961089 1:104303000-104303022 GAGAAGGTAGAGAAAGAGATGGG + Intergenic
912069567 1:105792792-105792814 GAGAAGGAGGAGAAAGAAGAGGG - Intergenic
912152932 1:106881562-106881584 GATGATGTAGAGAAAGAGACAGG + Intergenic
912556087 1:110517160-110517182 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
912661907 1:111539242-111539264 GAGAGGGGAGAGAAGGAGGCAGG - Intronic
912663771 1:111560836-111560858 GAGGATGGAGAGAAATTGGCTGG - Intronic
912853596 1:113148004-113148026 GAGAATGAAGGGCGAGAGACAGG - Intergenic
913210263 1:116576409-116576431 GAGAAGGAAGGGAGAAAGGCTGG - Exonic
913373794 1:118129647-118129669 AAGAAGGAAGAGAAGGAGGATGG - Intronic
913582741 1:120243060-120243082 GAGGAGCAGGAGAAAGAGGCAGG - Intergenic
913625432 1:120655300-120655322 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
914384844 1:147158663-147158685 GAGAAAGAAAAGACAGAAGCAGG + Exonic
914564671 1:148854554-148854576 GAGGAGCAGGAGAAAGAGGCAGG - Intronic
914608155 1:149275688-149275710 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
914929890 1:151921619-151921641 CAGAAGAAAGATAAAGAGGCAGG + Intergenic
915148410 1:153809458-153809480 AAGAATGAGGGGAAAGAGCCTGG - Exonic
915480455 1:156181021-156181043 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
915488204 1:156236497-156236519 GAGAAGGAAGAGGAAGAGGCAGG - Intronic
915962523 1:160279079-160279101 GAGAATGGGGAGAAACAGCCTGG - Exonic
916058143 1:161082031-161082053 TAGAATGAGGAGGAACAGGCTGG + Intronic
916163869 1:161946846-161946868 GAGAATGAAGGGTAACAGCCAGG - Intronic
916228306 1:162512802-162512824 GAGAATGAAGAGGAATATGAAGG + Exonic
916231852 1:162548615-162548637 GAGAAAGAAGGGAAGGAGGGAGG - Intergenic
916282265 1:163064710-163064732 AAGAAAGAGGAGTAAGAGGCAGG + Intergenic
916319913 1:163492422-163492444 GAGACTGAAAATAAAGGGGCAGG - Intergenic
916437280 1:164788759-164788781 AAGAATGAAAAGAAAAGGGCGGG - Intronic
916483436 1:165235860-165235882 GAAAATGCAGATAAAGAGCCCGG - Intronic
916490970 1:165302139-165302161 GTGAAAGAAGAGAATGAGGCTGG + Intronic
916533788 1:165683470-165683492 GAGAATGGAGAGAAAATGGATGG + Intronic
916693527 1:167214179-167214201 GAGGAAGAATAAAAAGAGGCAGG + Intergenic
916779502 1:168009292-168009314 GAGAAAGAAAAGAAAATGGCAGG - Intronic
916821057 1:168399270-168399292 GAAAGAGAAGAGAAAGAGGAAGG - Intergenic
917061538 1:171047262-171047284 GAGGATGCAGAGAAAGAGACAGG - Intronic
917485230 1:175449437-175449459 GAGGAAGAAGAAAAAGAGGAAGG - Intronic
917547103 1:175982416-175982438 GAGAAGGAGGAGAAAGAAGTGGG - Intronic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918094170 1:181321061-181321083 GAGAAGCAAGAGAGAGAGGAGGG + Intergenic
918318908 1:183346316-183346338 GAAATCGAAGAGCAAGAGGCTGG - Intronic
918329011 1:183438265-183438287 GAAAAGGAAAAGAAAGAGGAAGG + Intergenic
918563866 1:185902626-185902648 ATGAATGAGGAGAAAGAGTCAGG + Intronic
918581201 1:186132136-186132158 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
918878234 1:190079202-190079224 GAGAAAGAAGAGAAACAAGAGGG + Intergenic
918993221 1:191725600-191725622 GAGAAAAAAGAGAAAGAGAGAGG + Intergenic
919191986 1:194232191-194232213 GAGAAGGAGGAGAATGAGGAAGG + Intergenic
919588227 1:199465547-199465569 GAGAATGAAGGAAGAGAGACAGG + Intergenic
919688318 1:200505445-200505467 GAGAAAGAAGAGAGAAAGGAAGG + Intergenic
919719509 1:200817653-200817675 GAGAAAGAAGGGAAAAAGGAAGG + Intronic
920008429 1:202850446-202850468 CAGAAGGAAGGGAAAGAGGTTGG - Intergenic
920449759 1:206051087-206051109 AAGAAGGAAGAGAAAGAGCAGGG - Intronic
920711680 1:208301406-208301428 GGGAAGGAAGAAAAGGAGGCGGG + Intergenic
920776563 1:208943786-208943808 GAGAAAGAGGAGAAAGAGGGTGG + Intergenic
920983073 1:210856528-210856550 GAGAATGAGGAAGAAGAGGCTGG - Intronic
921009787 1:211130137-211130159 GAATATAAAGAGAAACAGGCTGG + Intronic
921101145 1:211930552-211930574 GAAAACAAAGACAAAGAGGCTGG - Intergenic
921145079 1:212347280-212347302 GAAAACTAAGAGAAACAGGCAGG - Intronic
921249140 1:213280150-213280172 GATAATGAAGACAAGGAGGAAGG + Intergenic
921283435 1:213588593-213588615 TAGTATTAAGAGACAGAGGCCGG - Intergenic
921818377 1:219589426-219589448 GAGAATGATGAGGAAGAGTAAGG + Intergenic
921838118 1:219799130-219799152 GAGAAAGGAGAGAGAGAGGGAGG + Intronic
921994174 1:221398690-221398712 GAGAAGGTAGAGAAAGAGATAGG + Intergenic
922001372 1:221481869-221481891 GAGGAGGAAGAGGAAGAGGAAGG - Intergenic
922684923 1:227631712-227631734 GAGAATGAGGAGAAAAAGATGGG + Intronic
922710777 1:227829265-227829287 GAGGATGAAGAGAAAAGGGAAGG - Intronic
923193808 1:231645001-231645023 CACAGTGAACAGAAAGAGGCTGG - Intronic
923247538 1:232147106-232147128 GAGAATGAAGCGATAAAGTCAGG + Intergenic
923362184 1:233222563-233222585 GAGAATGAATGGATAGAAGCAGG + Intronic
923754407 1:236777558-236777580 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
923769687 1:236927603-236927625 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
923893063 1:238237051-238237073 GAGAAGGAGGAGGAAGAGGAGGG + Intergenic
924155186 1:241168177-241168199 AGGAATGATGAGAAAGAGGATGG + Intronic
924183902 1:241466680-241466702 CAGAAGGAAGAGAGAGAGGGAGG + Intergenic
924196481 1:241612863-241612885 GACCATGAGGAGAAAGAGGATGG - Intronic
924270742 1:242329956-242329978 GAGAATGGAGAGTTAGTGGCAGG - Intronic
924315520 1:242791446-242791468 TAGACTGAAGAGAAAGAGATGGG + Intergenic
924403879 1:243721028-243721050 GAGAATGAGGGGCAAGAGACAGG - Intronic
924435847 1:244041353-244041375 GAGAAGGAAAAGAAAGGGGAAGG - Intergenic
924461465 1:244263356-244263378 GAGAAGGAAGAGAGGGAGGAGGG + Intergenic
924563160 1:245173756-245173778 GAGAAAGGAGAGAAAAAGGTGGG - Intronic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
1063605365 10:7518740-7518762 GAAAAAGAAGAGAAAGAGAGAGG + Intergenic
1063711419 10:8482728-8482750 GAGAGAGAAGAGAGAGAGGAGGG - Intergenic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064018037 10:11787864-11787886 AAGACTGCAGAGAAAGAGGCTGG + Intergenic
1064272673 10:13879675-13879697 GAAAAGGAAGAGAAAGAAGAAGG - Intronic
1064382722 10:14860950-14860972 GAGAAGGAAGAGAACCAGGAAGG + Intronic
1064511104 10:16092566-16092588 GATAATGAAGCCAAATAGGCTGG + Intergenic
1064631819 10:17322261-17322283 GAGAAAGAAAAGAAGGAGGGAGG + Intronic
1064865700 10:19877184-19877206 TAGAATGAGGAGAGAGAGGGAGG + Intronic
1064891663 10:20181932-20181954 TAGAATGAAAAGGAAGAGGCTGG + Intronic
1064899278 10:20276053-20276075 GTGAGGGAATAGAAAGAGGCTGG - Intronic
1065176923 10:23086540-23086562 CAGAAGGAAGAGAGAGAGGTGGG + Intergenic
1065196363 10:23270223-23270245 GAGAATGAAGAAAAGCAGGGTGG + Intronic
1065324241 10:24536704-24536726 GAGAATGGAGGGAAACAGGCAGG - Intronic
1065381347 10:25094620-25094642 GAGAATGTATAGAAAGAGATAGG - Intergenic
1065416890 10:25498044-25498066 GAGCAGAAAGAGAAAGAGGAAGG + Intronic
1065531623 10:26675881-26675903 GAGAAAGAAGGGAAGGAGGGAGG + Intergenic
1065628782 10:27656894-27656916 GAGAGAGAAGAGAGAGAGACGGG + Intergenic
1065738536 10:28775730-28775752 CAGGAGGAAGAGAGAGAGGCAGG + Intergenic
1065765643 10:29026966-29026988 GGGAGGGAAGAGAAAGAGGGAGG + Intergenic
1065819785 10:29515056-29515078 GAGAAGGAAGAGATTGAGGAAGG - Intronic
1065953131 10:30669833-30669855 GAGAAGGAAGAGATTGAGGAAGG + Intergenic
1066011574 10:31199145-31199167 GAGAAGGAGGAGAAAGAGGAAGG - Intergenic
1066714202 10:38268904-38268926 GAGAATGGAGAGTTAGTGGCAGG + Intergenic
1066991318 10:42516832-42516854 GGGAATCAAAAGAAAGAGGAAGG + Intergenic
1067021158 10:42799400-42799422 GAGAATAGAGAGAAAGGGGCTGG - Intronic
1067230431 10:44403867-44403889 GACAATGAAGAAAAAGAGGGAGG - Intergenic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067552131 10:47243627-47243649 GGGACTGAAGAGGGAGAGGCAGG - Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1067711501 10:48654837-48654859 GAGAAAGAAAAGAGAGAGGAAGG - Intronic
1067998145 10:51299500-51299522 AAGAATGAGCAAAAAGAGGCGGG - Intronic
1068262457 10:54600249-54600271 GAGAAAGAGGAGAAAGTGGGAGG + Intronic
1068460895 10:57327000-57327022 GAGAAGGAAGAGAGAGAAGCAGG - Intergenic
1069074458 10:64023859-64023881 GAGAAGGAGGAGGAAGAGGAGGG + Intergenic
1069200383 10:65607772-65607794 AAGAAAGAAGAGAGAGAGGGAGG - Intergenic
1069374944 10:67784247-67784269 GAGAAAGAAGAAAAGGAGGCAGG + Intergenic
1069759589 10:70799414-70799436 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1069774179 10:70917291-70917313 GAGACTGAGGAGGAAGAGGAGGG - Intergenic
1069876320 10:71565386-71565408 GAGCAGGAAGAGAAAGAGTTTGG - Intronic
1069989968 10:72309218-72309240 GTGAATGGAGAGTAAGCGGCAGG + Intergenic
1070320215 10:75348977-75348999 GAGAAAAAAGAGAAACAGGAAGG - Intergenic
1070478357 10:76852749-76852771 GAGGAGGTAGAGAAAGAGGTAGG + Intergenic
1070506721 10:77119742-77119764 GATAATGAACAGTAAAAGGCAGG + Intronic
1070590129 10:77795293-77795315 GCGAATGAAGAGCCAGAGTCTGG + Intronic
1070637092 10:78137709-78137731 GAGAAAGAGGAGAAAGAGGAAGG - Intergenic
1070719892 10:78749071-78749093 GAAGATCAAGACAAAGAGGCGGG + Intergenic
1070737196 10:78871322-78871344 TAGAATGAAGAGAATGAGCAGGG - Intergenic
1071033712 10:81216500-81216522 GAGAAAGAAGGGAAGGAGACAGG + Intergenic
1071201738 10:83227182-83227204 TAGGTTGTAGAGAAAGAGGCAGG - Intergenic
1071220466 10:83459287-83459309 GAGTATGCAGACAAACAGGCAGG - Intergenic
1072167001 10:92823441-92823463 GAAGATAAAGAAAAAGAGGCCGG + Intergenic
1072193194 10:93092881-93092903 AGGAAAGAAGAGAAAGAAGCAGG - Intergenic
1072461675 10:95624629-95624651 GAAAAAGAGGAGAAAGAGTCAGG + Intronic
1072767257 10:98105597-98105619 GAGAATAAAGCCATAGAGGCAGG - Intergenic
1072797192 10:98365106-98365128 GGGGATGAAGAGAAAAAGGAGGG + Intergenic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1074047497 10:109852039-109852061 GACACTGAAGACAAAAAGGCTGG + Intergenic
1074238500 10:111610833-111610855 GAGGAGGAAGAGGAGGAGGCTGG + Intergenic
1074487398 10:113899120-113899142 GAGAAGAGAGAGAAAGAGGAAGG - Intronic
1074592497 10:114826336-114826358 TAGAAGGAAGGGACAGAGGCAGG - Intronic
1074648696 10:115493257-115493279 GAGGATGGAGAGTAAGAGGAGGG - Intronic
1075066500 10:119292249-119292271 GAGGAGGAAGAGGAAGAGGAGGG - Intronic
1075268080 10:121023079-121023101 CAGAATGTAGAGCAAAAGGCAGG - Intergenic
1075349514 10:121711058-121711080 GAGAAGGAAGATAAAGAAGTGGG - Intergenic
1075549611 10:123382536-123382558 GAGGAGGAAGAGAGAGAGGGAGG + Intergenic
1075553542 10:123412139-123412161 CAGAAGGAAGAGAGAGAAGCAGG - Intergenic
1076172014 10:128327206-128327228 GAGAATGAGGAGGAAGGGCCAGG - Intergenic
1076239053 10:128888783-128888805 AAGAAGGATGAGAATGAGGCAGG + Intergenic
1076748023 10:132524128-132524150 GAGAAGCAAGAGAAAGAGACGGG - Intergenic
1077272198 11:1686671-1686693 GAGAAGGAAGGGAGGGAGGCAGG - Intergenic
1077272289 11:1686946-1686968 GAGAAGGAAGGGAGGGAGGCAGG - Intergenic
1077483555 11:2827829-2827851 CGGAATGAAGAGGAAGGGGCGGG + Intronic
1078131794 11:8619688-8619710 GAGAAAGAAGACAAAGAGCAAGG + Intronic
1078167305 11:8899260-8899282 GAAAAAGAAGAGAAAGAGAAAGG + Intronic
1078168222 11:8909404-8909426 GAGGAAGAAGAGGAAGAGGAAGG + Intronic
1078308012 11:10210377-10210399 GAGGAGGAAGAGAAGGAGGAAGG + Intronic
1078453043 11:11454452-11454474 GAGAAGGAAGATAAGGAGGGAGG + Intronic
1078534608 11:12163022-12163044 CAGGAGGAAGAGAAAGAGACAGG - Intronic
1078777007 11:14403044-14403066 GAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1078873900 11:15375180-15375202 AAGAAGGAAGAGAGAGAGGGAGG - Intergenic
1078937599 11:15965332-15965354 GAGAATGAAAAGAAACAGCAGGG - Intergenic
1079102689 11:17551677-17551699 GAGAGGGAAGAAAAGGAGGCTGG + Intronic
1079432374 11:20405105-20405127 AAGAAGGAAGAAAAGGAGGCTGG - Intronic
1079491162 11:20990524-20990546 GAGCATGGAGAGAAAAATGCTGG - Intronic
1079601472 11:22316537-22316559 GGGAAGGGAGAGAGAGAGGCGGG - Intergenic
1079601479 11:22316559-22316581 GGGAAGGGAGAGAGAGAGGCGGG - Intergenic
1079601486 11:22316581-22316603 GGGAAGGGAGAGAGAGAGGCGGG - Intergenic
1079608959 11:22406600-22406622 GACATAGAAGAGAAAGAGGGAGG - Intergenic
1079697081 11:23495355-23495377 AAGAAAGAAGAGAAGGAGGAAGG + Intergenic
1079723132 11:23844994-23845016 GAGAAGGTAGAAAAAGAGACTGG - Intergenic
1080005055 11:27397904-27397926 GAGAATGGAGAGAAAGAGAAAGG + Intronic
1080032862 11:27680277-27680299 GAGAATGAAAAGAGGGAGGAAGG + Intronic
1080057682 11:27924514-27924536 GAGGAGGAAGAGAGAGAGGGAGG + Intergenic
1080106109 11:28512961-28512983 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1080187619 11:29509099-29509121 AATACTGAAGAGAAAGAGGATGG + Intergenic
1080912444 11:36616419-36616441 AAGTATGAAGAGAAAAAGGGAGG - Intronic
1081297813 11:41413116-41413138 CAGAATGTAGAGAATGAGGATGG + Intronic
1081346155 11:41988959-41988981 AAGAAAGAAAAGAAAAAGGCAGG + Intergenic
1081393586 11:42558924-42558946 GAAAGTGAAGAGGAAGGGGCTGG - Intergenic
1081459070 11:43254265-43254287 GCGATTGTAGAGAAAGAGGAGGG - Intergenic
1081529041 11:43945335-43945357 GAGAGAGAAGAGAATGAGGCTGG - Intergenic
1081557047 11:44173861-44173883 TAGAAAGAAGAAAAAAAGGCCGG - Intronic
1082131769 11:48498633-48498655 GAAAAAGAAAAGAAAGATGCTGG + Intergenic
1082176283 11:49063802-49063824 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1082280433 11:50265954-50265976 AAGAAAGAAGAGACAGAGCCAGG + Intergenic
1082970370 11:59014005-59014027 GAGAAGGTAGGGAAAGAGACAGG + Intronic
1083010663 11:59395269-59395291 GAGGAGGAAGAGTAAGAGGAGGG - Intergenic
1083067400 11:59939206-59939228 GGGAAAGAAAAGAAAGAGGGAGG - Intergenic
1083067459 11:59939640-59939662 GAGAAAGAAGAGGAAGAGAAAGG - Intergenic
1083067472 11:59939760-59939782 GAGAAAGATGAGAAAGAGAAGGG - Intergenic
1083106679 11:60365057-60365079 GGGCATGAAGACCAAGAGGCAGG + Intronic
1083106702 11:60365243-60365265 GACCTTGAAGAGAATGAGGCTGG + Intronic
1083645318 11:64168876-64168898 GAGGATGATGAGGTAGAGGCAGG + Intergenic
1083767420 11:64848477-64848499 GAGAAGGAAAGGAAAGAGGGTGG - Intergenic
1083788412 11:64968110-64968132 GAGAATGAAGAGAGAGAGGAGGG + Intronic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084299091 11:68234208-68234230 GAAAGAGAAGAGAAAGAAGCAGG - Intergenic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1084470456 11:69356331-69356353 GAGAAAGGAGGGAAAGAGGGAGG + Intronic
1084712713 11:70853815-70853837 GAGAATGGAGTGGAAGAGGCAGG - Intronic
1084941330 11:72614957-72614979 GGGGAGGAAGAGAAAGAGGGAGG - Intronic
1085152355 11:74262395-74262417 GAGAAAGAAGGGAAAGAGGCAGG + Intronic
1085178636 11:74512673-74512695 GAGAAGGTAGAGAAAGAGATGGG + Intronic
1085327724 11:75620171-75620193 GAAAATAGAGAAAAAGAGGCTGG + Intronic
1085728687 11:78977716-78977738 GAGGATGTGGAGAAAGAGGAAGG + Intronic
1086031117 11:82356777-82356799 GGGGATGAAGAGCAGGAGGCAGG + Intergenic
1086246856 11:84763292-84763314 GTCAAGGAATAGAAAGAGGCAGG - Intronic
1086344898 11:85886346-85886368 GAGAATGCAGAGAAAATGTCAGG + Exonic
1086429524 11:86721781-86721803 GAGAAAGAAGAGTGGGAGGCAGG + Intergenic
1086499122 11:87434177-87434199 GAGGATGAAGAGAAGAGGGCTGG + Intergenic
1086689435 11:89772064-89772086 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
1086716422 11:90067890-90067912 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1086788173 11:90998880-90998902 CAGAAGGAAGAGAAAAATGCAGG + Intergenic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1086886456 11:92211552-92211574 GAGGATGAGGGGAGAGAGGCTGG + Intergenic
1087058144 11:93953264-93953286 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1087087138 11:94231278-94231300 CCGAATGAAGAGAAAAAGGAAGG + Intergenic
1087204244 11:95377399-95377421 GAGAAGGAGTAGAAAGGGGCAGG - Intergenic
1087492223 11:98843395-98843417 GAGAAGGTAGAGAAAGAGATAGG - Intergenic
1088236799 11:107733493-107733515 GAGAGGGATGAGAAAGAGACAGG - Intergenic
1088302339 11:108372786-108372808 GAGAATTACAAGAAAGATGCCGG + Intronic
1088570116 11:111214621-111214643 GAGAATGTAGAGAAAGACATAGG + Intergenic
1088720271 11:112586034-112586056 GTGAGTGAAGAGAAACAGGCTGG + Intergenic
1088994003 11:114980197-114980219 GAGTAAGAACAAAAAGAGGCCGG + Intergenic
1089061034 11:115626275-115626297 GATAGTGAATAGAAAGAGGAGGG - Intergenic
1089105755 11:116002554-116002576 GAAACTGAAGTGAAAGTGGCAGG + Intergenic
1089239965 11:117069118-117069140 GAGAAAGAAGATAAAGGGGTAGG + Intronic
1089433261 11:118438884-118438906 GAGATAGAGCAGAAAGAGGCAGG - Intronic
1089639663 11:119839362-119839384 GAGAAAGAAGAGAAAGAAGGTGG - Intergenic
1089779675 11:120864669-120864691 GAGAATGAGGAAATAGAGCCTGG - Intronic
1089813591 11:121152498-121152520 GTGAATGAAGACCTAGAGGCAGG + Intronic
1090360588 11:126169848-126169870 GAGAATGATGGGAATGAGCCTGG - Intergenic
1090701940 11:129304328-129304350 AAGAATGAGAAGGAAGAGGCCGG + Intergenic
1090949954 11:131464542-131464564 GAGAGTGAAAAGGAAGAGGAGGG - Intronic
1091042307 11:132293192-132293214 GTGATGGAAGAGGAAGAGGCAGG + Intronic
1091237472 11:134031689-134031711 GTGAATGGACAGAAAGAGTCTGG - Intergenic
1091241186 11:134053544-134053566 AAGAATAAACAGCAAGAGGCAGG + Intergenic
1091294090 11:134460357-134460379 GAGAGTGATGAGAATGAGCCGGG - Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091385439 12:91791-91813 AAGAAAGAAAAGAAAGAAGCAGG + Intronic
1091642466 12:2247807-2247829 GAGAATAAAGAGAAAGGAGCAGG - Intronic
1091687355 12:2572826-2572848 GAGGAGGAAGAGAAGGAGGAGGG - Intronic
1091737663 12:2936452-2936474 AAGACTCAAGAGTAAGAGGCCGG + Intronic
1091865411 12:3830991-3831013 TAGAAAGGAGACAAAGAGGCTGG + Intronic
1092140120 12:6178083-6178105 GGGCAGGAAGAGAAAGAGACAGG - Intergenic
1092234779 12:6799883-6799905 CAGAAGCAAGAGAAAGAGGCAGG - Intronic
1092732236 12:11545723-11545745 ATGAATGAAGAGAAGAAGGCAGG - Intergenic
1092961454 12:13600212-13600234 GAGTATGAGGGGAAAGAGGAAGG - Intronic
1092964621 12:13629633-13629655 GAGAAGGAGGAGCAAGAGGAGGG - Intronic
1093128130 12:15355058-15355080 GAGGATGAAGAGAGAGAGAAAGG + Intronic
1093151432 12:15626288-15626310 GAGAATGAAGAGAAATGGGTAGG - Intronic
1093210049 12:16297410-16297432 GATAATGAAGGGATAGAGACAGG - Intergenic
1093375708 12:18424988-18425010 GAGATGGAAGAGAAAGATGAGGG + Intronic
1093534765 12:20210136-20210158 GGGAAGGGAGAGAAAGAGGAGGG - Intergenic
1093534771 12:20210157-20210179 GGGAAGGGAGAGAAAGAGGAGGG - Intergenic
1093534777 12:20210178-20210200 GGGAAGGGAGAGAAAGAGGAGGG - Intergenic
1093553510 12:20443973-20443995 GAGAAGGAAAAGAAGGAGGGAGG + Intronic
1093755940 12:22851829-22851851 GAGAAAGAAGAGAAAAAGATGGG - Intergenic
1094526572 12:31234986-31235008 GGGAAGGAAGAGAAAAAGGTAGG + Intergenic
1094575080 12:31677723-31677745 GAGAATGAAGGGTAAGAGATAGG - Intronic
1094584704 12:31767428-31767450 GGGGAGGGAGAGAAAGAGGCTGG + Intergenic
1094787206 12:33862527-33862549 GAGAAGGCAGAGAAAGAGAAAGG - Intergenic
1095099381 12:38164578-38164600 GAAGATGTAGAGAAAGAGACAGG - Intergenic
1095133823 12:38573486-38573508 GAGAAGGTAGAGAAAGAGATAGG + Intergenic
1095443372 12:42260190-42260212 AAGAAAGAAGAGAGAGAGGAAGG + Intronic
1095516183 12:43007926-43007948 CAGCATGAAGAGGAAAAGGCAGG + Intergenic
1095525690 12:43122387-43122409 GTGAATGATGAGAAAGATGGGGG + Intergenic
1095824746 12:46519461-46519483 GAGAAGAAAGAAAAAGAGGCAGG - Intergenic
1096050736 12:48605408-48605430 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
1096051013 12:48607436-48607458 CAGAAGGAAGAGAGAGAGGGAGG + Intergenic
1096066488 12:48744762-48744784 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
1096117241 12:49061781-49061803 GAAGATGTGGAGAAAGAGGCAGG + Intergenic
1096572923 12:52534002-52534024 GGGTAGGAAGAGAAAGGGGCAGG + Intergenic
1096703827 12:53405721-53405743 GGGAAGGAAGAGAGAGAGGGAGG + Intronic
1096720258 12:53516090-53516112 GGGAATGAAGAGAGAGAAGCAGG + Exonic
1096765991 12:53890219-53890241 TAGAATGAAGCTACAGAGGCTGG - Intergenic
1096774586 12:53956199-53956221 GAGAAGGGAGAGAAAGGGCCTGG + Intronic
1096828411 12:54296554-54296576 GAGTATGAAGATACAGGGGCAGG - Intronic
1096831522 12:54318167-54318189 AAGAAGTAACAGAAAGAGGCTGG - Intronic
1097004194 12:55903235-55903257 GAGAAAGGAGAGAAAGAGTCTGG - Intronic
1097175004 12:57137547-57137569 GAGAATGGAGAGGACAAGGCAGG + Intronic
1097223007 12:57461488-57461510 GAGAAAGCAGAGAAAGTGACTGG - Intronic
1097320480 12:58220440-58220462 AGGAATGAAGAGGAAGAGGTAGG - Intergenic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1097622516 12:61957827-61957849 AAGAAATAAGGGAAAGAGGCAGG - Intronic
1097910722 12:64966253-64966275 GAGAATGAAGAAAAGTAGGGAGG - Intergenic
1098083170 12:66811644-66811666 GAGAAAGAAGGGAAGGAGGGAGG - Intergenic
1098119716 12:67223069-67223091 AGGAATGAGGGGAAAGAGGCGGG + Intergenic
1098207735 12:68131203-68131225 GAGGAAGTAGAGAAAGAGGTAGG - Intergenic
1098266002 12:68719970-68719992 GAGAATGAAAAACAAGAGGAAGG + Intronic
1098471314 12:70847579-70847601 GAGAATGGAGAGGAAGAGTATGG - Intronic
1098742346 12:74189711-74189733 GAGACAGAAGAGAAAGAGAGGGG - Intergenic
1098864439 12:75745915-75745937 GAGAATTAAGAGAATGCTGCAGG + Intergenic
1098950887 12:76639531-76639553 GAGAAAGAAGAGGCTGAGGCAGG - Intergenic
1098951094 12:76641229-76641251 AAGAAAGAAGAGAGAGAGGGAGG - Intergenic
1098959206 12:76720654-76720676 GAGGAGGTAGAGAAAGAGACTGG + Intergenic
1098991189 12:77065874-77065896 GAGAAGGAAGAGGAGGAGGAGGG + Intergenic
1098994993 12:77108999-77109021 TAGAATGAAGTGATATAGGCTGG + Intergenic
1099862986 12:88243150-88243172 GAGAAAGAAAAGAAAGAGGAAGG - Intergenic
1100110590 12:91237285-91237307 GAGGCGGAAGAGAGAGAGGCAGG + Intergenic
1100744625 12:97632277-97632299 GAGAAAGAAGAAATGGAGGCAGG - Intergenic
1100773233 12:97947109-97947131 GGGAAGAAAGAAAAAGAGGCTGG + Intergenic
1100787003 12:98089324-98089346 TAGAATAAAGTGAATGAGGCAGG - Intergenic
1101009326 12:100432488-100432510 GAGAAGGAGGAGGAAGAGGAGGG - Intergenic
1101143298 12:101818048-101818070 GGGAATGAAGCCGAAGAGGCAGG - Intronic
1101285630 12:103309263-103309285 GAGGAGGAAGAGGAAGAGGAGGG - Intronic
1101580477 12:106037671-106037693 GAAAAGGAAGAGAAAGAGAGGGG - Intergenic
1101580504 12:106037764-106037786 GAGAAGGAAGAGAAGGAGAGGGG - Intergenic
1101623473 12:106415003-106415025 GTGAAGGAACAGAAAGAGTCTGG - Intronic
1101683831 12:106996600-106996622 GAGGATGCAGAGAAAAAGGAAGG - Intronic
1101738773 12:107483518-107483540 GGGACTGAAGGGAAAAAGGCTGG - Intronic
1101867352 12:108530156-108530178 GAGGATGATGAGAAAGAGTGGGG - Exonic
1101941748 12:109104443-109104465 GTGAGTGAAGGGAAAGAGGGAGG - Intronic
1102103523 12:110300154-110300176 GAGAAAGAAGGAAAAGAGGGAGG - Intronic
1102155880 12:110727364-110727386 AAGAGAGAATAGAAAGAGGCAGG - Intronic
1102230386 12:111257689-111257711 GAGAATGAGGAGGAAGGGGAAGG - Intronic
1102233846 12:111281895-111281917 GAGAAAGAAGGGAAGGAGGAGGG + Intronic
1102244649 12:111347777-111347799 GAGGATGCTGAGGAAGAGGCAGG + Exonic
1102775108 12:115511829-115511851 AAGAAAGAAGAGAGAGAGGAAGG + Intergenic
1102826252 12:115950106-115950128 GAGATTGGATTGAAAGAGGCAGG + Intergenic
1102857293 12:116305437-116305459 GAGAAAGAAGATAAAGAAGCTGG + Intergenic
1102934637 12:116886031-116886053 GAGGAAGAAGAGGAACAGGCAGG - Intergenic
1102983908 12:117263818-117263840 GAGAACCCAGAGAAGGAGGCTGG - Intronic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1103175933 12:118863083-118863105 AACAAGGAAGAGAACGAGGCTGG - Intergenic
1103317610 12:120069138-120069160 AAAAATCAAGAGAGAGAGGCTGG + Intronic
1103360079 12:120348157-120348179 GAGATGGCAGACAAAGAGGCTGG - Intronic
1103795387 12:123499649-123499671 GAGAGTGGAGAGGATGAGGCTGG - Intronic
1103835631 12:123818241-123818263 AAAAATAAAGAGATAGAGGCTGG - Intronic
1103896643 12:124277771-124277793 GAGAAGGAGGAGGAAGAGGAAGG - Intronic
1104325708 12:127795118-127795140 AAGAGTGAAGAGAAAAAAGCAGG - Intergenic
1104437477 12:128767362-128767384 GAGAAAGGAGGGAGAGAGGCAGG + Intergenic
1104506747 12:129339315-129339337 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
1105299841 13:19123302-19123324 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
1105705050 13:22963363-22963385 GAGAAAGAAGGGAGAGAGGAAGG + Intergenic
1105717860 13:23085053-23085075 GAGAATGAGGAGCCAGAGACAGG - Intergenic
1106239716 13:27901446-27901468 GGGAAAGAAGAGAGAGAAGCAGG - Intergenic
1106243061 13:27925387-27925409 GAGGAGGAGGAGAAAGAGGAGGG - Exonic
1106243086 13:27925474-27925496 GAGGAGGAAGAGGAAGAGGAGGG - Exonic
1106353946 13:28961174-28961196 GAAAATGAGGAGAAAGAGGATGG + Intronic
1106358477 13:29007614-29007636 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1106698751 13:32206496-32206518 AAGAATGTAGAAAGAGAGGCTGG + Intronic
1106868885 13:33997216-33997238 GAGAAGGAAGAGGCAGGGGCTGG - Intergenic
1106947057 13:34840265-34840287 GAGAAAGAAGGGAGGGAGGCCGG + Intergenic
1107040622 13:35943873-35943895 TAGAATGATGAAACAGAGGCAGG - Intronic
1107287632 13:38813791-38813813 GAGAAGGTAGAGAAAGAGATAGG - Intronic
1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG + Intergenic
1107672652 13:42761776-42761798 CAGAAAGTAGACAAAGAGGCTGG - Intergenic
1107777604 13:43862965-43862987 AAGGATGAAGAGGAAGAGGGAGG - Intronic
1107992843 13:45833549-45833571 TAAAAGGAAGAGAAAGAGGGTGG + Intronic
1108020685 13:46124983-46125005 GAGAAAGAAGAGGAGGAGACAGG - Intergenic
1108190123 13:47929714-47929736 GAGTATGAAGAACATGAGGCTGG + Intergenic
1108191906 13:47950394-47950416 GAGAGGCCAGAGAAAGAGGCTGG - Intronic
1108579571 13:51817213-51817235 GAGAAAGAGGAGAGAGAGGAAGG + Intergenic
1108632094 13:52294800-52294822 AAAAATAAAGAGATAGAGGCCGG + Intergenic
1108654606 13:52517794-52517816 AAAAATAAAGAGATAGAGGCCGG - Intergenic
1108744972 13:53384111-53384133 GAGGAGGAGGAGAAAGATGCAGG - Intergenic
1109839190 13:67900952-67900974 GAGAATGTGGAGAAATAGGAAGG + Intergenic
1109877514 13:68425758-68425780 GAGTATCAAGAAAAAGAAGCAGG - Intergenic
1110268729 13:73569221-73569243 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
1110394636 13:75015019-75015041 GAAAAGGAAAAGAAATAGGCTGG - Intergenic
1110505481 13:76280936-76280958 GGAAATGAAGAGAAAGAGGCAGG - Intergenic
1110509482 13:76332635-76332657 GTGAAGGAAGAGAGAGAGGGAGG - Intergenic
1110542799 13:76724779-76724801 GAGAAGGAAGGAAAAGAGGAAGG + Intergenic
1110863301 13:80367467-80367489 GAGAATGAGGGGCAAGAGACAGG + Intergenic
1110911154 13:80965898-80965920 GAGAATGATAAGAAATAGGATGG + Intergenic
1111005185 13:82238593-82238615 GAGGAAGATGAGAAAGAGGTAGG - Intergenic
1111093443 13:83477404-83477426 GAGAAGGGAGAGAGGGAGGCAGG + Intergenic
1111391467 13:87601017-87601039 GAGAAGGAGGAGAAAGATGATGG + Intergenic
1111404775 13:87789673-87789695 GTATATGAAGAAAAAGAGGCAGG + Intergenic
1111641543 13:90976844-90976866 GAGAATGAAGAAAAGCAGGGTGG + Intergenic
1111665377 13:91261221-91261243 GAGACTGAAGAGTGAGAGGAAGG + Intergenic
1111675627 13:91384799-91384821 GGGAAGGAAGAGAGAGAGGAAGG + Intergenic
1111757195 13:92413715-92413737 GAGAACTCAGATAAAGAGGCTGG + Intronic
1112064890 13:95782432-95782454 GAGGATGTAGAGAAATAGGAAGG - Intronic
1112105746 13:96237347-96237369 GAGAAGGAAGAGGAAGAGGAGGG - Intronic
1112246583 13:97740650-97740672 GAGAAAGAAGGGAAGGAGGGAGG + Intergenic
1112441368 13:99426971-99426993 GAGAATGAAGGGGAGGAGGGAGG + Intergenic
1112499854 13:99934457-99934479 GAGGAAGGAGAGAAAGAGGATGG + Intergenic
1112642634 13:101293741-101293763 GACAAGGGAGAAAAAGAGGCTGG + Intronic
1112671440 13:101643899-101643921 CAGAAAGAAGAGAAAGAGCTTGG - Intronic
1112735093 13:102407380-102407402 AAGAAGGGAGAGAAAGAGGGAGG - Intergenic
1112753829 13:102608789-102608811 GAGGAGGCAGAGAAAGAGGAAGG - Intronic
1112776749 13:102852068-102852090 GAGGATGAAGAGAAAAATCCCGG + Intronic
1113005835 13:105700822-105700844 GAGAACGGAAAGAGAGAGGCAGG - Intergenic
1113115070 13:106866717-106866739 AAGAATGAGAAGAAAGTGGCCGG + Intergenic
1113202967 13:107887364-107887386 GAGAAAGAAGACAGAGAGGTGGG + Intergenic
1113273195 13:108698017-108698039 GAGAAAGAAGAGAGCGAGGTCGG - Intronic
1113673992 13:112195857-112195879 AAGAAGGAAGGGAAAGAGGGAGG - Intergenic
1113674103 13:112196303-112196325 AGGAATGAAGAGAGAGAGGAAGG - Intergenic
1113680984 13:112244961-112244983 AAGCATGGAGGGAAAGAGGCAGG - Intergenic
1113733507 13:112658939-112658961 GGGAGTGAAGAGAGAGAGACAGG - Intronic
1114281317 14:21194837-21194859 GAGAAAGAAGAGAAGAAGGAAGG - Intergenic
1114322202 14:21556345-21556367 GAAAGTGAAGAGAAAGAGTGGGG + Intergenic
1114446918 14:22795767-22795789 GAGAATTAAGAAAACAAGGCCGG - Intronic
1114562187 14:23601367-23601389 TAGAGTGAAGAGAGGGAGGCTGG - Intergenic
1114830767 14:26138872-26138894 GAGACAGAAGAGAAAGAGCAGGG + Intergenic
1115107069 14:29774402-29774424 GAGAAAGAAGAGGAAAAGGAAGG + Intronic
1115145241 14:30218739-30218761 GAGAATGAGGTGAGAGAGGTAGG - Intergenic
1115286145 14:31714534-31714556 CAGAAGGAAGAGAGACAGGCGGG + Intronic
1115401558 14:32967141-32967163 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
1115505696 14:34092405-34092427 GAGGAAGAAGAGAAAGTGTCAGG + Intronic
1115530330 14:34321189-34321211 GAGTATGAATATAAGGAGGCGGG + Intronic
1115767660 14:36640199-36640221 GAGAATGGAGATAAAGATGGAGG - Intergenic
1115815567 14:37160957-37160979 GAGGAGGAGGAGAAAGAGGAAGG + Intronic
1116023795 14:39491937-39491959 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1116183181 14:41561672-41561694 GAGACTAAAGTGAAAGAGGATGG - Intergenic
1116319971 14:43448990-43449012 GAGAAGGAAAAGAGAGAGGATGG + Intergenic
1116364921 14:44048016-44048038 GAGGATGTAGAGAAATAGGAAGG + Intergenic
1116374169 14:44176324-44176346 GAGGATGAAAAGGAAGAGGAGGG - Intergenic
1116377251 14:44218607-44218629 GAGAGTGGAGAGTGAGAGGCGGG + Intergenic
1116762799 14:49035604-49035626 AAAAGTGAAGAGAGAGAGGCAGG + Intergenic
1116872972 14:50085076-50085098 GAGCATGAATGGCAAGAGGCGGG + Intronic
1116978277 14:51140367-51140389 GAGGGAGAAGAAAAAGAGGCTGG + Intergenic
1117045201 14:51806481-51806503 GTGAATGGAGAGAAAGGGGGAGG - Intergenic
1117434413 14:55702444-55702466 AGGAATGAAGAGGAAGAGGTAGG + Intergenic
1117480283 14:56136784-56136806 GAGAAGGGAGAGGAAGAGGAGGG - Intronic
1117503211 14:56374663-56374685 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1117503478 14:56377162-56377184 AAGAAGGAAGAGATAGAGGGAGG - Intergenic
1118063147 14:62162568-62162590 GAAAAAGAAGAGAAAGAGGAGGG - Intergenic
1118107172 14:62673027-62673049 GAGCATAAAAAGCAAGAGGCTGG + Intergenic
1118123542 14:62873176-62873198 GAGAAGGAAGAGAAAGAAAATGG + Intronic
1118332710 14:64826180-64826202 GAGAATCAGGTGTAAGAGGCAGG + Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118583170 14:67325242-67325264 GAGGGTGAAGAGGAAGAGGAAGG - Intronic
1118677839 14:68207662-68207684 GAGAGTGAAGTCAAAGAAGCAGG + Intronic
1118832258 14:69445294-69445316 GAGGATGAGGAGGAAGAGGAGGG - Intronic
1118833028 14:69452779-69452801 TAGAATGAAGATAAAGTTGCAGG + Intronic
1118833139 14:69453762-69453784 TAGAATGAAGATAAAGTTGCAGG + Intronic
1119185261 14:72636850-72636872 GACAAAGAAGAGAAAGAGAATGG + Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119556956 14:75560630-75560652 GAAAATGAAGAGGAAGAGAATGG + Intergenic
1119706381 14:76785102-76785124 GAGAATGAAGAGCAGGTGGATGG + Intergenic
1119976403 14:79029094-79029116 GAGAATGAAAAGAAGGGGGTTGG + Intronic
1119982878 14:79101952-79101974 GTGAAGGCAGAGACAGAGGCTGG + Intronic
1119996840 14:79262480-79262502 GAGAAGGAGGAGAATGAGGAAGG + Intronic
1120047471 14:79824196-79824218 GAGACAGAAGAGGAAGAGGGAGG - Intronic
1120075568 14:80153828-80153850 AGGAATGAAGTGAAAGAAGCAGG - Intergenic
1120262834 14:82209261-82209283 GAGGAGGAGGAGAAAGAGGTGGG + Intergenic
1120424433 14:84329293-84329315 GAGAATGAGTTGAAAGAAGCTGG + Intergenic
1120447096 14:84612744-84612766 GAGAAAGGAGAGAGAGAGGGAGG - Intergenic
1120463905 14:84831531-84831553 GAGAACACAGAAAAAGAGGCTGG - Intergenic
1120571561 14:86124138-86124160 GAGACTGAAGAGACAGAGGCTGG + Intergenic
1120583803 14:86287011-86287033 GAGAATTAAGAAAAAGGGGAGGG + Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120701712 14:87705564-87705586 AAGCATGATGAGAAAGAGGGTGG + Intergenic
1120703821 14:87726991-87727013 GAGGAAGAAGAGGAAGAGGAGGG + Intergenic
1120984346 14:90320643-90320665 GAGAAAGAAGGAAAAGAGGAAGG + Intronic
1121033702 14:90681707-90681729 GAGAATGAGGAGCAAGATTCGGG + Intronic
1121181931 14:91935506-91935528 GAAAATGCAGAGATAGAGGTGGG - Intronic
1121448635 14:93994046-93994068 GAGGAAGAAGAGGAAGAGCCAGG + Intergenic
1121488159 14:94336347-94336369 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1121553676 14:94820562-94820584 AAGAATGAAGGGACTGAGGCTGG + Intergenic
1121865242 14:97356694-97356716 GAGAAGGGAGAGGTAGAGGCAGG - Intergenic
1121930464 14:97967243-97967265 GAGGAAGAAGAGAAAGATGTGGG - Intronic
1121962537 14:98274660-98274682 GGGAAAGAAAAGAGAGAGGCTGG + Intergenic
1122359470 14:101150968-101150990 GAGAAAGAAGGGACAGAGGGAGG - Intergenic
1122406375 14:101503513-101503535 GAGAGAAAAGAGCAAGAGGCCGG - Intergenic
1122669194 14:103357096-103357118 GAGAGAGAAGAGAGAGAGACAGG - Intergenic
1123736381 15:23188208-23188230 GAGAGGGAAGAGAAAAAGGAAGG - Intergenic
1124221995 15:27857743-27857765 GAAGATGGAGAGAAAGAGACAGG + Intronic
1124287087 15:28411185-28411207 GAGAGGGAAGAGAAAAAGGAAGG - Intergenic
1124295614 15:28500444-28500466 GAGAGGGAAGAGAAAAAGGAAGG + Intergenic
1124393472 15:29280483-29280505 GGGAAGGAAGAGGAAGAGGCAGG + Intronic
1124464308 15:29922141-29922163 AAGAATGAAAAGAAAAAGTCCGG - Intronic
1124476526 15:30039657-30039679 GAGGAAGAAGAGAAAGAAGAAGG - Intergenic
1124713467 15:32034002-32034024 GAGAATTAACAGAAAGATGAGGG + Intronic
1124895152 15:33769651-33769673 GAGACTGAAAAGAGAGACGCAGG + Intronic
1125036765 15:35134317-35134339 AGGAAGGAAGAGAAAGAGGAAGG - Intergenic
1125176637 15:36830133-36830155 GAGAATGTAGTGAAAGAAGTTGG + Intergenic
1125298506 15:38228987-38229009 GAGAAAGAAGAGAAAGAGGAAGG + Intergenic
1125451637 15:39814191-39814213 GAGAATGAAGAGAAAGAGGCAGG - Intronic
1126351592 15:47750225-47750247 GATATTGAGGAGAAAGAGCCTGG + Intronic
1126487637 15:49199849-49199871 GAGCAACAAGAGAATGAGGCAGG + Intronic
1126623766 15:50666505-50666527 GAGGAAAAAGAAAAAGAGGCCGG + Intronic
1126933399 15:53679531-53679553 GAGGATGGAGAGAGAGAGGGAGG + Intronic
1126951448 15:53886023-53886045 GATAACGAAGAGGAAGAGGCTGG + Intergenic
1127234910 15:57038451-57038473 GAGAAGGAAGAGAGGGAGGGAGG + Intronic
1127400647 15:58582127-58582149 GAGAAGGAAGAGGAAAAGGAAGG + Intergenic
1127412133 15:58719956-58719978 GAGAAGGAAGAAAAGGAGGAAGG - Intronic
1127479607 15:59366278-59366300 GAGAAAAAAAAGAAAGAGACAGG - Intronic
1127579776 15:60327850-60327872 TAGAAAGAAAACAAAGAGGCTGG + Intergenic
1127703415 15:61524414-61524436 GAGGAGGAAGAGGAAGGGGCAGG - Intergenic
1127818231 15:62631721-62631743 GAGAAAGAAGAAAAAGCGGGAGG - Intronic
1128095741 15:64953630-64953652 GAGAAGGAAGAGGAAGAAGAAGG - Intronic
1128196393 15:65760590-65760612 TAGAAAGAAGGGTAAGAGGCCGG + Intronic
1128337641 15:66797637-66797659 GAGAAATAAGAGACAGAGTCAGG + Intergenic
1128374060 15:67063331-67063353 GGGGAAGAAGAGAAAGAGCCGGG + Intergenic
1128478368 15:68016550-68016572 CAGGAGGAAGAGAGAGAGGCAGG - Intergenic
1128543520 15:68552679-68552701 GAGAAGGCAGGGAAAGAGGGAGG - Intergenic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1129055473 15:72816944-72816966 GAGAATGAGGGGCAAGAGACAGG + Intergenic
1129314438 15:74732688-74732710 GAGGAGGAAGAGAATGAGGCAGG - Intergenic
1129624742 15:77185082-77185104 GGGAAGGCAGAGAAAGATGCAGG + Intronic
1130033353 15:80335461-80335483 GACCATGAAGGGAAAGAGGCAGG + Intergenic
1130042544 15:80417531-80417553 GAGAAGGAAGAGAAGGAGGAGGG - Intronic
1130136858 15:81188747-81188769 GAGAAAGAAGAAAAAAAGGCCGG - Intronic
1130324681 15:82870372-82870394 GAGAGGGAGGAGGAAGAGGCTGG - Intronic
1130384732 15:83401155-83401177 GAAAAGGAAGTGAATGAGGCAGG - Intergenic
1130398587 15:83528395-83528417 GAAAATGAAGAGAAAGACAAAGG - Intronic
1130433216 15:83869999-83870021 AAGAAAGAAAAGAAAGAGGGAGG + Intronic
1130693839 15:86110507-86110529 GAGAAGGAGAAGGAAGAGGCGGG + Intergenic
1130779141 15:87016684-87016706 GAGAATGAAGAAAAGCAGGATGG + Intronic
1130882878 15:88070306-88070328 GAGCTTGAAGGGAAAGAGGAGGG - Intronic
1130892288 15:88143257-88143279 GAGATTAAAGACAAAGAGACAGG + Intronic
1130894957 15:88162830-88162852 GAGAATGAGGAGGGAAAGGCTGG - Intronic
1131316055 15:91338673-91338695 GAGAGTGAGGAGAGAGAGGGAGG + Intergenic
1131392241 15:92058905-92058927 GAGAAAGGAGAGAAAGACACAGG - Intronic
1131410037 15:92199989-92200011 GAGAATGAGGGGAAAGGGGAGGG + Intergenic
1131551249 15:93358974-93358996 GAGAAAGGAGAGAAAGAAGTGGG + Intergenic
1131734541 15:95318098-95318120 GAAAATGAAGTGAAAGATGAGGG + Intergenic
1131811787 15:96180588-96180610 GAGGAGGGAGAGAGAGAGGCAGG + Intergenic
1131873266 15:96781341-96781363 GAGAATGAAGAGAGAAATACAGG - Intergenic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1132491538 16:234579-234601 GAGAAGGAGGGGAAAGAGGACGG + Exonic
1132800932 16:1752770-1752792 GAGAAGGAAAAGAAAAAGTCAGG + Intronic
1132920525 16:2387887-2387909 AAGAAAGAAAAGAAAGAGCCAGG + Intergenic
1133258918 16:4536012-4536034 GAGGATGGAGAGAGAGAGCCAGG - Intronic
1133263494 16:4568587-4568609 AAAAAAGAAGAGCAAGAGGCTGG - Intronic
1133497341 16:6331428-6331450 CAGAATGAAGAAAAAAAGTCTGG + Intronic
1133517451 16:6523260-6523282 AAGAAGGAAGAGACAGAGGGAGG + Intronic
1134040379 16:11063911-11063933 GGGAAGGAAGAGAGAGAGGAAGG + Intronic
1134097645 16:11429266-11429288 CAGGATTAAGAGAAAGAGGGGGG - Intronic
1134205354 16:12233068-12233090 GAAGATGAAGACAAAGAGGAAGG - Intronic
1134318202 16:13139265-13139287 AAGAAGGAAGAGATAGAGGAAGG - Intronic
1134324442 16:13194070-13194092 GAGAAGGAAAAGAAAGAGAGAGG - Intronic
1134405687 16:13956627-13956649 GAGGATGAAGAAAACGAGGATGG + Intergenic
1134492059 16:14702975-14702997 GAGTATGAAGAGGAAGAAGCTGG - Intergenic
1134497440 16:14742097-14742119 GAGTATGAAGAGGAAGAAGCTGG - Intronic
1134649564 16:15898059-15898081 GAGAAGGAAGAGAGAGAGTTTGG - Intergenic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135001967 16:18784246-18784268 GAGAAAAAAGAGAGAGAGACAGG - Intronic
1135079646 16:19423096-19423118 GAGAAGGAAGAGAAAGGAGAAGG - Intronic
1135179439 16:20260097-20260119 AAGAATGATGAGAAGAAGGCCGG + Intergenic
1135405899 16:22197567-22197589 GAAAAGAAAAAGAAAGAGGCAGG + Intergenic
1135640251 16:24113556-24113578 AAGAATGAAAAGAGAGAGGAAGG - Intronic
1136065167 16:27753797-27753819 GAGAAGGAAGGGAGAGAGGAAGG - Intronic
1136178094 16:28532370-28532392 GAGACAGAAGAGGAAGAGTCTGG + Intergenic
1136268015 16:29132140-29132162 GAGAAAGAAGGGAGAGAGGGAGG + Intergenic
1136361273 16:29781333-29781355 AGGAAGAAAGAGAAAGAGGCTGG + Exonic
1136615178 16:31394151-31394173 GAAAAAAAAGAAAAAGAGGCTGG + Intronic
1137800999 16:51262087-51262109 GAGAAGGAAGAGAAGGAGGGAGG - Intergenic
1137972933 16:53003494-53003516 GAGAAAGAATAGAAAGAGGAGGG + Intergenic
1138166294 16:54804794-54804816 GAGAATGAAGGTGAAGAGACTGG + Intergenic
1138248952 16:55487862-55487884 AAGAATGAAGAGGAGGAGGGAGG - Intronic
1138293872 16:55870396-55870418 AAGAAGGAAGAGAAAGAGGAAGG + Intronic
1138370362 16:56521729-56521751 GAGACAGGATAGAAAGAGGCTGG - Intergenic
1138486729 16:57349938-57349960 GAGAAGGAAGAGAGGGAGGAAGG - Intergenic
1138624377 16:58237414-58237436 GAAAAGGAAGAGAAAGAAGAGGG - Intronic
1138692089 16:58777581-58777603 CAAAAGGAAGAGAGAGAGGCTGG - Intergenic
1139084633 16:63569726-63569748 GGGAATAAAGAAAAGGAGGCAGG + Intergenic
1139264306 16:65624693-65624715 GAGACAGAGGAGAAAGAGGGTGG - Intergenic
1139808130 16:69587370-69587392 GAAATTGAAGAAAAATAGGCCGG - Intronic
1140022530 16:71252125-71252147 AAGAATAAATAGCAAGAGGCAGG + Intergenic
1140032804 16:71351811-71351833 GAGGACGAAGAGAAAGGTGCAGG - Intergenic
1140097783 16:71890328-71890350 GAGAAAGAAGGGAAAGATGATGG - Intronic
1140119123 16:72068163-72068185 GAGGATATAGAGAAAGAAGCTGG + Intronic
1140205092 16:72927292-72927314 GAGAAGGAAGACAAGGAGGAAGG - Intronic
1140251973 16:73302242-73302264 GAGAGAGAAGAGAAAGAGAAGGG - Intergenic
1140468815 16:75203611-75203633 GAAAATGCAGAGAGGGAGGCGGG + Intergenic
1140514161 16:75530241-75530263 GATGATGAAGAGCAGGAGGCAGG + Exonic
1140724446 16:77799368-77799390 GAGAAAGAGGAGAGAGAGGGAGG - Intronic
1140837790 16:78811488-78811510 AAGAAAGAAAAGAAAGAGGGAGG - Intronic
1141007136 16:80363136-80363158 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1141046941 16:80723860-80723882 GAGAAAGAGGAGGAAGAGGAAGG + Intronic
1141046998 16:80724209-80724231 GAGAAGAAAGAGGAAGAGGAGGG + Intronic
1141057538 16:80832482-80832504 GAGACTGAAGAGAAAGGGTTAGG + Intergenic
1141090272 16:81125453-81125475 GAAAAAGAAGAAAAGGAGGCTGG + Intergenic
1141864266 16:86739358-86739380 AAGAAAGAAGAGAGAGAGGAAGG - Intergenic
1142071320 16:88092478-88092500 GAGAAAGAAGGGAGAGAGGAAGG + Intronic
1142250722 16:88990616-88990638 GGGAAGGAAGAGAAAGAGCCAGG + Intergenic
1142868392 17:2805176-2805198 AAGGAAGGAGAGAAAGAGGCAGG + Intronic
1142913950 17:3118355-3118377 ATGAATAAAGAGACAGAGGCTGG + Intergenic
1143000691 17:3793345-3793367 CAAAATGAAGAAAAAAAGGCCGG - Intronic
1143015949 17:3891371-3891393 AAGGATCAAGAGAAAGGGGCTGG + Intronic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143036294 17:4001156-4001178 GAGGAAGAGGAGGAAGAGGCAGG + Intergenic
1143069157 17:4275993-4276015 CAGAAGGAAGAGACAGAGACTGG - Intronic
1143154431 17:4827267-4827289 GGGAATGAAGGGCAAGAGCCAGG - Intergenic
1143249428 17:5511815-5511837 AGGAATGAAGAAAAAGAGGAAGG - Intronic
1143327661 17:6110026-6110048 GAGGATGAACAGAGAGGGGCAGG + Intronic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1143374015 17:6456909-6456931 GACATTGAAGAGAAAGTGGAGGG - Intronic
1143391438 17:6561333-6561355 GAGAAGGAAGAGGAGGAGGAGGG - Intergenic
1143702571 17:8672203-8672225 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
1143857920 17:9866133-9866155 CAGAAAGAAGTGAAAGAGGCAGG + Intronic
1144152879 17:12467513-12467535 GAGAATGATGAGAATGAGAAGGG + Intergenic
1144279151 17:13707125-13707147 GAGAAGGAGGAGGAAGAGGAGGG + Intergenic
1144348914 17:14375559-14375581 GAGAATGGAGGGAGAGAGGAAGG - Intergenic
1144391699 17:14799430-14799452 AAGAATGAAGAGCCAGAGACAGG + Intergenic
1144420177 17:15089910-15089932 GACAATGAAGAAAAAGAGTGAGG + Intergenic
1144523822 17:15972859-15972881 GAGAATGAAGTGGGAGAGTCAGG - Intronic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1144941223 17:18942672-18942694 GAGAATGAAAAGACACAGACTGG + Intergenic
1145038035 17:19555021-19555043 GAGAAGGAAGAGAAAGGGGTGGG + Intronic
1145058046 17:19716001-19716023 GATCATGAAGAGGAATAGGCTGG - Intronic
1145179253 17:20731049-20731071 CAGAATGAAGAAAAAAATGCAGG - Intergenic
1145722661 17:27088352-27088374 GAGAAGGAAGAGAGGGAGGTAGG - Intergenic
1145945656 17:28772426-28772448 TAGAAAGAACAGAGAGAGGCCGG + Intronic
1145988125 17:29061206-29061228 GGCAACGAAGAGAAAGAGGCTGG + Intergenic
1146278945 17:31532667-31532689 GAGAATGAAGACAGGGAGCCAGG - Exonic
1146458570 17:33025796-33025818 GAGGATGAGAAGAAAGGGGCTGG - Intronic
1146724112 17:35143620-35143642 GAGAATGGGTAGAAAGAGGCAGG - Intergenic
1146890546 17:36503831-36503853 GGAAATGAAGAGAAAGAGGCTGG - Intronic
1147122197 17:38342269-38342291 GAGAAGGGAGTGCAAGAGGCAGG - Intronic
1147341863 17:39757104-39757126 GAGAAAGTAGAGAGAGAGTCTGG - Intergenic
1147366085 17:39960219-39960241 GAAAAGAAAGAAAAAGAGGCAGG + Intergenic
1147420824 17:40321429-40321451 GAGGAGGAGGAGGAAGAGGCAGG + Intronic
1147490113 17:40858424-40858446 GGGAATGAAGACCAGGAGGCAGG + Intergenic
1147575120 17:41594564-41594586 GAGGATGGAGAGTAAGAGGAGGG + Intergenic
1148179636 17:45594989-45595011 GAGGAAGAAGAGGAAGAGGAAGG + Intergenic
1148193795 17:45698895-45698917 AAGAATGAGGAGGAAGAGGAAGG + Intergenic
1148202384 17:45757896-45757918 AAGAGTAAAGAGAAAGAGCCAGG + Intergenic
1148269267 17:46250909-46250931 GAGGAAGAAGAGGAAGAGGAAGG - Intergenic
1148284557 17:46375760-46375782 GAGAATGAGTGGAAAGAAGCAGG - Intergenic
1148306778 17:46593681-46593703 GAGAATGAGTGGAAAGAAGCAGG - Intronic
1148476456 17:47931901-47931923 GAAGCTGAAGAGAAAGAGGGGGG - Intergenic
1148574475 17:48699824-48699846 GAAAAAGAAGAAAAGGAGGCTGG + Intergenic
1148606379 17:48932386-48932408 GAGGATGAGTAGAATGAGGCAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148794394 17:50190129-50190151 GTGAATGGAGGGAAGGAGGCAGG + Intronic
1148851673 17:50558682-50558704 GAAAATGAGGACAGAGAGGCTGG - Intergenic
1148864043 17:50619361-50619383 GAGATGGAAGAGAATCAGGCAGG - Intronic
1148947981 17:51282458-51282480 GAAAATGAAGAGAAAGAGGAAGG + Intronic
1150090631 17:62321977-62321999 GAGAAGTAAGATAAAAAGGCAGG + Intergenic
1150153587 17:62831291-62831313 GAGAAGGAAGAGGAAGAAGAGGG - Intergenic
1150323916 17:64240402-64240424 GACACTGAAGAGGAAGAGGGTGG + Intronic
1150465198 17:65386688-65386710 GAAAAGAAAGAGAAAGAGGAAGG - Intergenic
1150495797 17:65607050-65607072 GAGAGTGATGAGGAAGAGTCTGG + Intronic
1150543623 17:66130010-66130032 GAAAAAGAAGAGAAAGAAGTGGG + Intronic
1150822214 17:68444862-68444884 GAGAAGGAAGAGAGGGAGGGAGG - Intronic
1151145565 17:72037338-72037360 GAGGAGGAAGAGGAAGAGGAGGG - Intergenic
1151326501 17:73383183-73383205 GAGGATGGAGAGCCAGAGGCAGG - Intronic
1151383907 17:73743723-73743745 GAGAAAGAAGAGGAGGAGGAGGG - Intergenic
1151395844 17:73822391-73822413 TAGAATGAAGAAAGTGAGGCAGG + Intergenic
1151420634 17:73994860-73994882 AAAAATCAAGAGAAAGAGACTGG + Intergenic
1151542948 17:74774348-74774370 GAGAATGAAAGGGAAGAGGATGG + Intronic
1151765340 17:76130811-76130833 GAGAGGGAAGAGGAAGAGGATGG - Intergenic
1151938771 17:77280388-77280410 GAGTGTGGAGAGACAGAGGCAGG - Intergenic
1152241890 17:79165252-79165274 GGGAGAGAAGAGAAAGAGGGAGG + Intronic
1152985254 18:315176-315198 GAGAATGAAGAGAATGAGTCTGG + Intergenic
1153597557 18:6743107-6743129 GAGAAGGAAGAGAGAGAAGAGGG + Intronic
1153945044 18:10010565-10010587 GAGAATGAGCAGAATGATGCTGG - Intergenic
1153951701 18:10062985-10063007 GAGAAGGAAGGGAGAGAGGGAGG - Intergenic
1153970006 18:10217468-10217490 GAGACAGAAGAGGAAGAGGGTGG - Intergenic
1154503592 18:15009947-15009969 GGGGAGGAAGAGAAGGAGGCAGG + Intergenic
1155222513 18:23698180-23698202 GAAGAAGAAGAGAAACAGGCTGG - Intronic
1155843900 18:30681725-30681747 AAGGAAGAAGAGAAAGAAGCTGG - Intergenic
1155858956 18:30872091-30872113 GAGAGAGAAGAGACAGAGGGAGG - Intergenic
1155935837 18:31752793-31752815 GAGAAGGAGGAGGAAGAGGAGGG + Intergenic
1156453065 18:37277456-37277478 GAGAAGGAAGAGAGAGAGGGAGG + Intronic
1156545546 18:37960601-37960623 GAGAAAGAAGAGAAAGTTGCAGG + Intergenic
1156717276 18:40026424-40026446 GAAAAGGAAGAGACAGAGGAGGG - Intergenic
1157049076 18:44139157-44139179 GAGAGGGAAGAAAAAGAGGAGGG + Intergenic
1157120722 18:44908350-44908372 GAGAAAGAAGAAAAGGAGGAGGG - Intronic
1157382022 18:47227170-47227192 GAGAAGGAGGAGGAAGAGGCAGG - Intronic
1157398775 18:47368230-47368252 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
1158046229 18:53158692-53158714 TAAAATGAAAGGAAAGAGGCTGG + Intronic
1158275636 18:55764357-55764379 GGGAATGAAAAGCAATAGGCAGG - Intergenic
1158276071 18:55768930-55768952 GAGAATGAAAAGAAAGATGGTGG - Intergenic
1158401922 18:57128697-57128719 GAGAAGGGAGACAAAGAGGAAGG - Intergenic
1158784091 18:60687938-60687960 GGAAAGGAAGAGAAAAAGGCTGG + Intergenic
1158882640 18:61795852-61795874 AAGAAAGAAGGAAAAGAGGCAGG + Intergenic
1158912102 18:62074803-62074825 GAGAACAATGAGAAAAAGGCTGG + Exonic
1158967632 18:62636582-62636604 AAAAAAGAAAAGAAAGAGGCTGG - Intergenic
1159197470 18:65136476-65136498 GACAAAGAAGAGAGAGAGACAGG + Intergenic
1159553949 18:69925704-69925726 GAGACTGGAGTGAAGGAGGCTGG - Intronic
1159599088 18:70411556-70411578 AAGAAGAAAGAGAAAGATGCTGG - Intergenic
1159728551 18:71995054-71995076 CAGAAGGAAGAGAAAGATGGGGG + Intergenic
1159826018 18:73211360-73211382 AAGAATGGAAAGCAAGAGGCTGG + Intronic
1159938268 18:74385901-74385923 GAGAATCATGGGAAAGAGGCGGG - Intergenic
1159975348 18:74704401-74704423 GAAAATGAAGGGAAAAAGGCCGG + Intronic
1160041259 18:75347746-75347768 AAGAATGAAGAGAGGGAGGGAGG + Intergenic
1160379833 18:78445708-78445730 GAGACTGAAGAGATAAAGTCAGG + Intergenic
1160660605 19:296655-296677 GAGAAGGAATAGTAAGAGGGAGG - Intergenic
1160705048 19:525767-525789 GAGAAGGAAGAGAAGGAGAGAGG + Intergenic
1160850438 19:1188981-1189003 GAAAAAGAAAAAAAAGAGGCTGG - Intronic
1161047390 19:2143058-2143080 GAAAAAAAAGAAAAAGAGGCTGG - Intronic
1161112870 19:2479469-2479491 GAGAATGGAGGCGAAGAGGCGGG + Intergenic
1161256844 19:3314505-3314527 AAGAGAGAAGAGAGAGAGGCAGG - Intergenic
1161427406 19:4211127-4211149 GCAAATGGAGATAAAGAGGCCGG - Intronic
1161662794 19:5557640-5557662 GAGAACAGAGAGATAGAGGCAGG + Intergenic
1161742497 19:6031724-6031746 AAGAGAGGAGAGAAAGAGGCTGG - Intronic
1162024157 19:7884395-7884417 GAGAAGGAGGGGAAAGAGGGAGG + Intergenic
1162334093 19:10049571-10049593 AAGAAAGAAGAGAAAGAAGGGGG + Intergenic
1162428989 19:10615610-10615632 GAGGAGGAAGAGGAAGAGGAAGG + Intronic
1162553141 19:11369543-11369565 GAGACAGAAGAAAAGGAGGCTGG + Intergenic
1162735199 19:12743169-12743191 GAGGAGGAAGATAAAGAGGGAGG + Intronic
1162911623 19:13850767-13850789 AAGAGTCAAGAGTAAGAGGCAGG - Intergenic
1163575922 19:18110633-18110655 CAGACTGCAAAGAAAGAGGCCGG - Intronic
1163593942 19:18210001-18210023 GAGAAGGAAAGGAAAGAGACGGG - Exonic
1163730461 19:18946441-18946463 GGGAATGAAGAGAAGGAAGAGGG - Intergenic
1163831059 19:19547371-19547393 GAGATTGAAGAGGAAGTGGGTGG - Intergenic
1163998570 19:21076136-21076158 AAGAAAAAAGAAAAAGAGGCCGG - Intergenic
1164142507 19:22485559-22485581 GAGAATCAAGAGAAAAAGTTTGG + Intronic
1164250197 19:23469100-23469122 GAGAAGGAGGAGAAAGAGAAGGG - Intergenic
1164250299 19:23469747-23469769 GAGAATGAGGAAAAAGAAGGAGG - Intergenic
1164441259 19:28282346-28282368 GAGAATGGGGAGAAAATGGCAGG - Intergenic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1164704804 19:30312372-30312394 GAGAAGGAAGTGGAGGAGGCAGG - Intronic
1164794293 19:31014015-31014037 GAGAAACAGGAGAAAGAGGAGGG + Intergenic
1164868632 19:31625610-31625632 GAGGAGGAAGAGGAGGAGGCTGG - Intergenic
1164921892 19:32094470-32094492 GAAGAGGAAGAGAAAGAGGAAGG + Intergenic
1164957812 19:32402231-32402253 AAGAAAGAAGAGAAAGAGAAGGG + Intergenic
1165278992 19:34780858-34780880 GAGAAAGAAAAGGAAGGGGCCGG + Intergenic
1165298746 19:34952866-34952888 GAAGAAGAAGAGAAAGAGGAAGG + Intergenic
1165356199 19:35305656-35305678 GAGAACTAAGAGAATTAGGCTGG + Intronic
1165906183 19:39196295-39196317 GAGAAGGAAGTGGCAGAGGCAGG + Intergenic
1165916393 19:39263733-39263755 GAGAAAGCAGAGAAAGATGAAGG + Intergenic
1165935546 19:39386490-39386512 GAGACAGAAGAGAAAGAAGCTGG - Exonic
1166034130 19:40154998-40155020 GAGAATGAAGTGAACCCGGCAGG + Intergenic
1166929517 19:46293542-46293564 AAAAATTAAGAGATAGAGGCCGG + Intergenic
1167124662 19:47540899-47540921 GTGAAGGAAGAGAATGTGGCAGG - Exonic
1167309896 19:48731004-48731026 GAGACTCAAAAAAAAGAGGCCGG + Intronic
1167389506 19:49185012-49185034 AAGAATACAGAGATAGAGGCAGG - Intronic
1167448866 19:49555837-49555859 GAGAAGGACGAGGTAGAGGCCGG + Intronic
1167511259 19:49896404-49896426 GGAAAAGAAGAGAAAGAGACAGG - Intronic
1167522679 19:49965301-49965323 GACAAAGAAAAAAAAGAGGCCGG + Intergenic
1167554200 19:50183067-50183089 GAGAAAGAAGGGAAGGAGGGAGG - Intergenic
1167621341 19:50562697-50562719 GAGGAGGAAGAGAGTGAGGCAGG - Intronic
1167749428 19:51370935-51370957 GAAAATGAAGAGGGAGAGGCAGG - Intergenic
1167750313 19:51375375-51375397 AAGAATGAAAAGACAGTGGCTGG - Intergenic
1168053459 19:53847288-53847310 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
1168158298 19:54491000-54491022 GAGAAGGAAGAGAGAGAGAAAGG - Intergenic
1168510131 19:56967270-56967292 GAGAAAGAGGAGGAAGAGGAGGG - Intergenic
1168666290 19:58207551-58207573 GAGAATGCATAGAAAAATGCTGG + Intronic
925205143 2:1999430-1999452 GAGAAAGAATAGACAGAAGCTGG + Intronic
925462550 2:4075838-4075860 GAGAAGGAAAAGAGGGAGGCAGG - Intergenic
925840260 2:7985377-7985399 GGGAATGAAGAGAAAGAGAAAGG - Intergenic
925876275 2:8313546-8313568 GAGTATGCAGAGGCAGAGGCAGG - Intergenic
925931495 2:8711851-8711873 TGGAATGAAGAGGGAGAGGCTGG + Intergenic
925959365 2:9001657-9001679 GAGAATCAAGGGAAAGTGACAGG - Intronic
926189232 2:10715394-10715416 GAGAAAGAAGAGAAGGAGTGTGG - Intergenic
926221070 2:10935712-10935734 GTGAATGAACAGCAGGAGGCCGG - Intergenic
926439755 2:12875459-12875481 GAGAATGAGGAGGTGGAGGCTGG + Intergenic
926550781 2:14298645-14298667 CACAAGGAAGAGACAGAGGCTGG - Intergenic
926626116 2:15091361-15091383 GAGAAGGAGGAAAAAGAGGAGGG - Intergenic
926763280 2:16298779-16298801 GAGCTTGTAGAGAAAAAGGCAGG + Intergenic
926933189 2:18061203-18061225 GAAAAAGAAAAAAAAGAGGCTGG + Intronic
926977477 2:18529720-18529742 GAGTATGAATACCAAGAGGCTGG - Intergenic
926987330 2:18639198-18639220 CACAAAGATGAGAAAGAGGCCGG - Intergenic
926987618 2:18640732-18640754 GAAAATGAAGAAAAACAGGGTGG - Intergenic
927078907 2:19608642-19608664 GAGAAGGAGGAGAAAGTGGGAGG - Intergenic
927207803 2:20621079-20621101 GAGAATGAACAGGAAGAACCAGG + Intronic
927311755 2:21639451-21639473 CAGAAGCAAGAGAGAGAGGCGGG + Intergenic
927329371 2:21843851-21843873 AGGAATTAAGAGAAAGAGGGTGG - Intergenic
927557602 2:24047171-24047193 GAGGATGAGGAGAATGGGGCGGG - Intronic
927723901 2:25406024-25406046 GAGAGGGAAGAGCAGGAGGCTGG + Intronic
928112682 2:28523505-28523527 GAGTGTGAAGGGAAAGTGGCTGG + Intronic
928269307 2:29842046-29842068 GAGGATGGAGAAAAAGAGGGAGG - Intronic
928315080 2:30238614-30238636 GGGAATGAAGGGGAAGATGCAGG - Intronic
928704467 2:33933255-33933277 GAGAAAGAAGGGAAGAAGGCAGG - Intergenic
928831146 2:35485332-35485354 GAGAAGGAAGAGGAAGAGGAGGG + Intergenic
928914248 2:36454909-36454931 CAGAAGGAGGATAAAGAGGCAGG + Intronic
929026406 2:37607585-37607607 GAGAAAGAGGTGGAAGAGGCAGG + Intergenic
929038182 2:37716932-37716954 AAGAATGAAGAACAATAGGCAGG - Intronic
929381830 2:41363022-41363044 GAAAATGAAGAAAAAGAGAATGG + Intergenic
929712344 2:44277991-44278013 GAGGATGAAAACAAAGTGGCTGG - Intronic
930296048 2:49555299-49555321 CAGAATAAAGAGTAAGTGGCAGG - Intergenic
930405844 2:50954628-50954650 AAGAAAGAAGAGAAGCAGGCAGG + Intronic
930547024 2:52781216-52781238 GAGAAAATAGAGAAAGGGGCAGG - Intergenic
931007204 2:57865278-57865300 GAGAAAGAAGGAAAGGAGGCAGG + Intergenic
931093522 2:58913596-58913618 GAGAGGGGAGAGAAAGAGGGGGG - Intergenic
931161734 2:59700244-59700266 GAGGAGGCAGAGAAAGAGGAGGG - Intergenic
931279802 2:60780156-60780178 GAGAAGGAAGTGAAAGATTCAGG + Intronic
931693242 2:64852955-64852977 GAGGAGGAAGAAAAAGAGGAAGG + Intergenic
931697928 2:64885719-64885741 GAGAGGCCAGAGAAAGAGGCTGG + Intergenic
931739299 2:65227835-65227857 GAGGAAGAAGAGAAAACGGCCGG + Exonic
931829753 2:66038532-66038554 GAGGATGAAGAGCAGCAGGCTGG - Intergenic
932015899 2:68025998-68026020 TAAAAAGAAGAGAAAGAGGATGG - Intergenic
932024310 2:68118270-68118292 AAAAAAGAAAAGAAAGAGGCCGG + Intergenic
932380757 2:71279882-71279904 GAGAATGAAAGAAAAGAGGATGG + Intronic
932490900 2:72119633-72119655 GAGAATGAAGAGAAGGGGCATGG - Intergenic
932855876 2:75233470-75233492 GTGAATGATGAGAAAGAAGAAGG - Intergenic
932921847 2:75924956-75924978 GAGGAAGAGGAGAAAGAGGAAGG + Intergenic
933098045 2:78212315-78212337 GAGAAGGTAGAGAGAGAGACAGG + Intergenic
933306775 2:80610242-80610264 GAGCATGAAGAAAAAGATGGAGG - Intronic
933331343 2:80896555-80896577 GGGAAGGAAGAGAGTGAGGCAGG - Intergenic
933682019 2:85110379-85110401 GTAATTGAAAAGAAAGAGGCCGG - Intergenic
933716695 2:85366723-85366745 AATAAGGAAGAGAAAGCGGCTGG - Intronic
933781355 2:85804063-85804085 GAGAATGAAGAGAATGATGCAGG - Intergenic
933842453 2:86298392-86298414 AAGAATGAAGAGACAGATCCAGG - Intronic
934016200 2:87886327-87886349 GAAAAGGAAGATAAAGGGGCAGG - Intergenic
934586167 2:95498051-95498073 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
935277181 2:101485094-101485116 GAGAATGAAGAGGAAGATGGGGG - Intergenic
935396059 2:102610538-102610560 GAGAATGAAGAAAGAGACACTGG - Intergenic
935532764 2:104254709-104254731 AAGGATGTAGAGAAAGAGACAGG + Intergenic
935848989 2:107198310-107198332 GAGGAGGAAGAAAAAGAGGGAGG + Intergenic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936395558 2:112125623-112125645 GAGAAGGAGGAGGAAGAGGAAGG + Intergenic
936555786 2:113497946-113497968 AAGAATGAAGAGCCAGAGCCAGG + Intergenic
936705699 2:115071225-115071247 GAGAATGACAAGAAATAGGCAGG - Intronic
936825236 2:116574526-116574548 GAGAAGGTAGAGAAAGAGACGGG - Intergenic
936949127 2:117959532-117959554 GAGAATGAGGAGAAATTGGATGG + Intronic
937136998 2:119562428-119562450 GAGAATGAAGCGCAAGATGGTGG - Intronic
937264196 2:120605864-120605886 GAGAAGGAAGGGAAGGAGACAGG + Intergenic
937485239 2:122308704-122308726 GAGAATACAGAGAGAAAGGCAGG + Intergenic
937532949 2:122852363-122852385 GGGAAGGAAGAGAGAGAGGGAGG - Intergenic
937689434 2:124738235-124738257 CAGAGTGAAAAGAAAGAGGGAGG - Intronic
937769752 2:125706565-125706587 GAGGCTGAAGAGAAATAGGCTGG + Intergenic
937777745 2:125800211-125800233 GAGAAGGAAGAGGGAGAGGAGGG - Intergenic
938065838 2:128281578-128281600 TAGAGCGAAGAGAAAGAGCCTGG + Intronic
938113539 2:128587875-128587897 AAGAAGGAAGAGAAAGAGGTGGG + Intergenic
938287984 2:130134574-130134596 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
938290692 2:130148377-130148399 GAAAATGCAGACAAAGAGGCAGG - Intergenic
938295994 2:130179947-130179969 GAGAAAAAAGAAAAAGCGGCCGG - Intronic
938412454 2:131076130-131076152 GAGAATGAGAAAAAAGAGGCTGG - Intronic
938427604 2:131204303-131204325 CAGAGAGAAGAGAAAGAGGAAGG + Intronic
938465852 2:131524576-131524598 GAAAATGCAGACAAAGAGGCAGG + Intergenic
938468541 2:131538325-131538347 CAGAGAGAAGAGAAAGAGGAAGG + Intergenic
938502766 2:131840078-131840100 GGGGAGGAAGAGAAGGAGGCAGG + Intergenic
938622854 2:133074887-133074909 GAAAATGAAAAGAAAGAGATTGG + Intronic
938842792 2:135179259-135179281 AAGAAAGAACAGAATGAGGCTGG + Intronic
939053481 2:137333706-137333728 GGGAGTGAAGAGAAAGTGCCTGG - Intronic
939075412 2:137596718-137596740 GAGAAAGAAGAGGAAGAGGAGGG - Intronic
939139355 2:138335240-138335262 GAGAGTGAAGGGGAAGAGCCAGG - Intergenic
939186331 2:138865218-138865240 GATAATTAATAGAATGAGGCAGG + Intergenic
939198203 2:138999746-138999768 GAAAGAGAAGAGAAAGAGGGTGG + Intergenic
939201230 2:139037686-139037708 GACAGTGAGGATAAAGAGGCAGG - Intergenic
939403324 2:141723549-141723571 GAGAATGAAGAGAAAAGGCAGGG + Intronic
939408571 2:141793823-141793845 GAAAATGAAGAGAAAAAAGAAGG - Intronic
939719909 2:145635373-145635395 GAGAAGGAAGAGGAAGAGAAGGG - Intergenic
939864564 2:147458271-147458293 GAGACAGAAGACAAAGAGGTTGG + Intergenic
939987010 2:148839421-148839443 GAGAAGAAAGAGAAAGGAGCAGG - Intergenic
940017975 2:149126570-149126592 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
940230602 2:151447237-151447259 GAGGAGGGAAAGAAAGAGGCCGG - Intronic
940492218 2:154377391-154377413 AAGAAAGAAAAGAAAGAGGATGG + Intronic
940529651 2:154864923-154864945 TAGAATAAAGACAAAGAGGGAGG - Intergenic
940679666 2:156770158-156770180 GAAAGTGAGGAGAAAGAGACAGG + Intergenic
940736786 2:157462641-157462663 GAGAAAGAAGAAAAAGTAGCAGG + Intronic
940769275 2:157823441-157823463 GATAATGAAGAAAAAAAAGCCGG + Intronic
940947933 2:159638801-159638823 GAGGAGGTAGAGAAAGAGACAGG + Intergenic
941231967 2:162921466-162921488 AAGAAAGAGGAGAAAGAGGAAGG + Intergenic
941247367 2:163116198-163116220 CAGAAGGAAGAGAGAGAGGGTGG - Intergenic
941390674 2:164910122-164910144 CAGAATGAAGAGTAAGAGAAGGG + Intronic
941533586 2:166696699-166696721 GAATATCAAGAGAAAGAGGATGG + Intergenic
941569160 2:167148083-167148105 AAGAAAGAAGGAAAAGAGGCTGG + Intronic
941590892 2:167418831-167418853 GAGAAGAAAGCGGAAGAGGCTGG - Intergenic
941672403 2:168309229-168309251 GAGGAGGTAGAGAAAGAGGAAGG - Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941779466 2:169428370-169428392 GAGAAACAAAAGAAAGAGGTTGG + Intergenic
941898308 2:170653071-170653093 GAGGATGAAGAAAAAAAGGAAGG - Exonic
942009323 2:171743290-171743312 GAGGAGGAAAAGAAAGAGGAAGG + Intronic
942375274 2:175330255-175330277 GAGAAAGATGAGAGAAAGGCTGG + Intergenic
942533396 2:176936820-176936842 GAGAATGAAAAGACAGGAGCGGG + Intergenic
942570896 2:177313281-177313303 GAGAAAGAAGAGAAAGAAAAGGG - Intronic
942953792 2:181750946-181750968 GAGTAGCAAGAGAAACAGGCTGG - Intergenic
943054350 2:182957467-182957489 GAGCATGAGGAAAAACAGGCTGG - Exonic
943158308 2:184213695-184213717 GAGAAAGGAGAGAGAGAGGGGGG + Intergenic
943212410 2:184984688-184984710 GAAAATGAAGAAACAGAAGCTGG - Intergenic
943332805 2:186580078-186580100 AAGAATGAAGAGGCTGAGGCAGG - Intergenic
943390928 2:187267085-187267107 GAGAATCAGGAGCAAGATGCAGG + Intergenic
943575884 2:189630625-189630647 CAGAATGAACAGAAAAAGGTTGG + Intergenic
943621673 2:190155204-190155226 GAGAATGAAGGGCAAGGGTCTGG - Intronic
944015211 2:195027653-195027675 CAGAATGAAGAGAAAGTTGGTGG + Intergenic
944313184 2:198258199-198258221 GAGAATCAAGAGACAGAAGCTGG + Intronic
944414981 2:199471333-199471355 GAGAATGGTGGGAAAGATGCTGG - Intergenic
944489018 2:200238323-200238345 GAGAAGGAAGAGAGAGAAGCTGG + Intergenic
944945047 2:204674317-204674339 GAGAATGCAGAGAAGAAAGCAGG - Intronic
945012755 2:205482468-205482490 GAGAAGGAAAAGAGAGAGACAGG + Intronic
945241119 2:207678023-207678045 AAAAATGAAGAAAAAAAGGCCGG + Intergenic
945584809 2:211647344-211647366 GAGAGAGAAGAGAGAGAGACTGG - Intronic
945893855 2:215459991-215460013 GAGACAGAAGAGAAGGAGGGAGG - Intergenic
946094180 2:217258257-217258279 TAGAATAAAGATAAAGGGGCTGG + Intergenic
946168777 2:217881310-217881332 GACACAGAAGAAAAAGAGGCAGG - Intronic
946183911 2:217966010-217966032 GAGAATGGAGAGAGAGAGAGAGG - Intronic
946217075 2:218192638-218192660 GAGAATAAAGGGAAAGGGGGAGG + Intergenic
946273075 2:218610208-218610230 GAAAATGAGATGAAAGAGGCTGG + Intronic
946483462 2:220078454-220078476 GAGGAAGAAGAGAAGGAGCCTGG + Intergenic
946535175 2:220619962-220619984 GAGAAGCAAGAGAAAGAGAGAGG - Intergenic
946676736 2:222168339-222168361 GAAAATTAAAAAAAAGAGGCTGG - Intergenic
946724108 2:222644378-222644400 GAGAATGAAGAGGAGGAGGAAGG + Intronic
946724293 2:222647050-222647072 AAGAAGCAAGAGGAAGAGGCAGG - Intronic
946724684 2:222650667-222650689 GAGCATGAATACAAGGAGGCAGG - Intronic
946786248 2:223246884-223246906 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
946805190 2:223464320-223464342 CAGAAGGAAGAGAGAGAGGGTGG - Intergenic
947038186 2:225884259-225884281 GAGGAGGAAGAGGAAGAGGAGGG - Intergenic
948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG + Intronic
948050933 2:234978808-234978830 GAAACTGAAGGGCAAGAGGCTGG + Exonic
948091819 2:235301831-235301853 GAGGATGAAGAGAAAGGAGGAGG - Intergenic
948361862 2:237427489-237427511 AGGAAGGAAGAGAAAGAGGGAGG + Intergenic
948734851 2:239995521-239995543 GAGAAGGCAGAAAAAGAGGCAGG + Intronic
948856915 2:240734544-240734566 GAGAATAAAAAGAAAGAAGACGG + Intronic
949003001 2:241628129-241628151 CAGAATGGAGAGAAGGGGGCTGG - Intronic
949077292 2:242069024-242069046 GAGAATGAAGTGAAAGAGGAGGG - Intergenic
1168814141 20:725179-725201 CAGACAGAAGAGAGAGAGGCTGG - Intergenic
1168910652 20:1444150-1444172 GAGAACGAGGGGAAAGAGGGTGG - Intronic
1169229802 20:3880424-3880446 GGGAATGGATAGAAACAGGCAGG + Intergenic
1169245053 20:4018523-4018545 GAGAATGAACGGAAGGAGGAGGG + Intergenic
1169296438 20:4403952-4403974 GGAAATCAAGAAAAAGAGGCTGG + Intergenic
1169389350 20:5176959-5176981 GAAAGTTAAGAGAAAAAGGCAGG + Intronic
1169505718 20:6209166-6209188 GAGAAAGGAAAGAAAGAGGGAGG - Intergenic
1169731340 20:8788654-8788676 GAAAATGGATAAAAAGAGGCAGG + Exonic
1169784217 20:9341567-9341589 GAGGAAGAAGAGGAAGAGGTTGG + Intronic
1170091762 20:12596859-12596881 AAGAGTGAAGAGATAGAGACAGG - Intergenic
1170317653 20:15060368-15060390 TAGAAAGAAGAGCAAGACGCAGG - Intronic
1170329519 20:15193127-15193149 GAGAGAGAAGAGAAAGAAGATGG - Intronic
1170425223 20:16228749-16228771 GAGAAGGGAGAGAATAAGGCGGG + Intergenic
1170483931 20:16795750-16795772 GACAAGGAGGAGAAAGAGGAGGG + Intergenic
1171251821 20:23654629-23654651 GGGAATAAAGAGGTAGAGGCAGG + Intergenic
1171292111 20:23988340-23988362 GAAAAAGAAAAAAAAGAGGCCGG - Intronic
1171369806 20:24654608-24654630 GAGAAGGAAGAGAGGGAGGGAGG + Intronic
1171779569 20:29407166-29407188 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
1171820728 20:29835737-29835759 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
1171823017 20:29872890-29872912 GAAGATATAGAGAAAGAGGCAGG + Intergenic
1171823024 20:29872968-29872990 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
1171897082 20:30817344-30817366 GAAGATGTAGAGAAAGGGGCAGG - Intergenic
1171897091 20:30817422-30817444 GAAGATGTAGAGAAAGAGGCAGG - Intergenic
1172011113 20:31846468-31846490 GAGAGAGAGGAGAGAGAGGCAGG + Intergenic
1172017816 20:31889193-31889215 AAGAGTGAAGAAAAAGAGTCTGG + Intronic
1172925051 20:38526360-38526382 CGGGAGGAAGAGAAAGAGGCAGG - Intronic
1172953341 20:38736767-38736789 GAGAATGATGTGAAAGTGGGAGG + Intergenic
1173114719 20:40230295-40230317 GAGAGCAAAGAGAAAGGGGCAGG + Intergenic
1173843079 20:46171614-46171636 AAGAAAGAAGAGAGAGAGGGAGG + Intergenic
1174048227 20:47748699-47748721 GAGAAAGAAGAGAGTGAGGTTGG + Intronic
1174173451 20:48630801-48630823 GAGAAAGATGGGAATGAGGCGGG + Intronic
1174185252 20:48701914-48701936 AAAAATTAAGATAAAGAGGCTGG + Intronic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174301553 20:49585906-49585928 CAGAATCCAGAGAAAGAGGAAGG + Intergenic
1174310318 20:49648256-49648278 AAGAAAGAAGAGAAAGAGGCTGG + Intronic
1174753213 20:53132639-53132661 GAGAATGGAGAGAAAGAGAGGGG - Intronic
1174763531 20:53229972-53229994 GAGAAAGAAAAGAAAGAGGAAGG + Intronic
1174863490 20:54114248-54114270 GTGAAGGAAAAGAAAGAGGCTGG + Intergenic
1175017886 20:55811240-55811262 GAGATTGAAAAGAGAGTGGCAGG - Intergenic
1175050402 20:56150397-56150419 AAGAAGGGAAAGAAAGAGGCAGG + Intergenic
1175848846 20:62076079-62076101 AAGAATGAAGGTAAATAGGCCGG + Intergenic
1175990418 20:62785826-62785848 GAGAATTAAGGGAACGCGGCGGG + Intergenic
1176272716 20:64244799-64244821 GGGAATGAGAAGAAAGGGGCTGG - Intergenic
1176522830 21:7837870-7837892 GAGAATGAAGAAAAGCAGGCTGG + Intergenic
1177021127 21:15859489-15859511 GAAAAACAAGAGAAAGCGGCCGG - Intronic
1177299252 21:19219561-19219583 GAGAAGGAAGAGAAAGCAGAAGG + Intergenic
1177552039 21:22635597-22635619 TAGAAAGAAGAGAGGGAGGCCGG - Intergenic
1177759834 21:25390938-25390960 TAGAATGAAGAGGAGGAGACTGG - Intergenic
1177767611 21:25476056-25476078 TAGAAGGAAGAGAGAGAGGTGGG - Intergenic
1177776062 21:25567621-25567643 GAGAAGGAAGGCAAAGAGGACGG + Intergenic
1177806056 21:25875777-25875799 CAGAATGAACAGGAAGAGGAAGG + Intergenic
1177808222 21:25896856-25896878 GGGAATGAAAAGAAAGAGCTGGG + Intronic
1177836388 21:26190128-26190150 GAGTAGGAAGAGAAAGAGGGTGG + Intergenic
1178041617 21:28646197-28646219 GACTATGAAGAGAAAGAGGGAGG + Intergenic
1178184957 21:30208617-30208639 AAGAAAGAAAAGAAGGAGGCAGG + Intergenic
1178255550 21:31049028-31049050 TAGAATGAAGAGGCAGAGGAAGG - Intergenic
1178261340 21:31102603-31102625 GAGAAGGAGGAGGAAGAGGAGGG + Intergenic
1178505256 21:33157401-33157423 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178505261 21:33157420-33157442 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178656850 21:34467882-34467904 GAGAATGAAGAAAAGCAGGCTGG + Intergenic
1178675786 21:34630843-34630865 GAGAAAGAAGAAATAGAGGAAGG + Intergenic
1178698672 21:34815832-34815854 GAAGATGAAAAGAAAGAAGCTGG + Intronic
1178708342 21:34891446-34891468 TAAAATGAATGGAAAGAGGCAGG + Intronic
1179163434 21:38916693-38916715 GAAAAGGAAGAGAAAAAGGAAGG + Intergenic
1180324767 22:11360682-11360704 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
1180620923 22:17161260-17161282 AAGAAAGAAGAAAAAAAGGCCGG + Intronic
1180823175 22:18846096-18846118 GAAAAAGAAAAAAAAGAGGCCGG - Intergenic
1180899354 22:19359429-19359451 GAGAATGAAGTGACAGTGGTGGG - Exonic
1181112594 22:20610720-20610742 GAGAGTGAACAGAGAGAAGCCGG + Intergenic
1181189569 22:21128450-21128472 GAAAAAGAAAAAAAAGAGGCCGG + Intergenic
1181209631 22:21282045-21282067 GAAAAAGAAAAAAAAGAGGCCGG - Intergenic
1181590840 22:23883983-23884005 GAGGATGAAGGCAAAGATGCAGG - Exonic
1181624809 22:24116052-24116074 GAGAATTAAAGGAAGGAGGCTGG - Intronic
1181649529 22:24251169-24251191 GAAAAAGAAAAAAAAGAGGCCGG - Intergenic
1181707842 22:24659577-24659599 GAAAAAGAAAAAAAAGAGGCCGG + Intergenic
1181710804 22:24686847-24686869 GAGGAAGAAGAGAAAACGGCCGG + Intergenic
1181712412 22:24698764-24698786 GAGAAAGGAGGGAAAGAGGGAGG - Intergenic
1182050668 22:27310495-27310517 GAGAGAGAAGAGAAGGAGGGAGG + Intergenic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182231139 22:28838329-28838351 GAAAAAGAAAAGAAAGAGGAAGG + Intergenic
1182259985 22:29066956-29066978 GTGAAGGAAGAGAAAGACTCTGG - Intergenic
1182506686 22:30788239-30788261 GAGTAGGAAGAGGAAGAGGACGG + Intronic
1182510414 22:30815767-30815789 GAGCATGAAAAGATAGAGGATGG - Intronic
1182593913 22:31403370-31403392 GAAAATGCAGAGAAAGGGCCGGG + Intronic
1182809208 22:33102023-33102045 GGAAATGGAGAGAAAGAGGCAGG - Intergenic
1182838039 22:33360491-33360513 GAGCAGCAAGAGAAAGAGGGAGG + Intronic
1182935517 22:34218309-34218331 AAGAATGAGGAGTCAGAGGCAGG - Intergenic
1182962169 22:34485487-34485509 CAGAAGGAAGAGAGAGAAGCGGG + Intergenic
1182985872 22:34715760-34715782 GAGGAGGAAGAGAAAGAGGAGGG - Intergenic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1183296882 22:37035060-37035082 GAGGATTCAGAGAAGGAGGCAGG - Intergenic
1183504353 22:38201071-38201093 GTGAAAGATGAGAAAGAGTCAGG + Intronic
1183703529 22:39463188-39463210 GAGAATGCATAGAAAGTGGTTGG - Intronic
1184003823 22:41694505-41694527 AAGAAGGACAAGAAAGAGGCTGG + Exonic
1184050187 22:41998609-41998631 GAGAAAGGGGAGAAAGAGGCGGG - Intergenic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1184991158 22:48170868-48170890 AAGAATGAAGAGAAGGAGAGAGG - Intergenic
1185025127 22:48404592-48404614 GTCAATGAAGGGAAAGATGCAGG + Intergenic
1185037056 22:48484875-48484897 GAGAAGGAAGAGAAGGAGGGAGG - Intergenic
1203217316 22_KI270731v1_random:13388-13410 GAAAAAGAAAAAAAAGAGGCCGG + Intergenic
1203273313 22_KI270734v1_random:72002-72024 GAAAAAGAAAAAAAAGAGGCCGG - Intergenic
1203290081 22_KI270735v1_random:28137-28159 GAGAAAGAAGGGAAGGAGGAAGG - Intergenic
949690128 3:6627260-6627282 GAGAATGAGAGGCAAGAGGCAGG - Intergenic
949871743 3:8595141-8595163 GAGAAAGAAGGAAAAGAGGAAGG + Intergenic
949914880 3:8952319-8952341 GATAATTAAGAGAATGAGTCTGG - Intronic
949977549 3:9474848-9474870 AAGGATGAAGAGAAAGAAGACGG + Intronic
950173963 3:10858965-10858987 GTATATGAAGAGAAACAGGCTGG + Intronic
950403923 3:12792763-12792785 AAGAAAAAAGAAAAAGAGGCTGG - Intergenic
950419779 3:12892084-12892106 GAGAAGGAAGAGAAAGGGAAAGG - Intergenic
950627180 3:14255985-14256007 GAGAATGGAGAAATTGAGGCTGG - Intergenic
950650460 3:14403711-14403733 CAGAAGGAAGAGAAATAGTCTGG - Intronic
950665503 3:14492612-14492634 GAGGAAGAGGAGAAAGAGGGAGG - Exonic
950845546 3:16012086-16012108 AAGAAGGAAAAGAAAGAGGGAGG + Intergenic
950958124 3:17077008-17077030 AAGAGTGGAGAGGAAGAGGCTGG - Intronic
951141238 3:19163748-19163770 GAGGAAGAAGAGGAAGAGGAGGG - Intronic
951168394 3:19508905-19508927 GAGATATAAGAGAAAGATGCTGG - Intronic
951416621 3:22431796-22431818 GAGCATGATGAGAAAGAGGAAGG + Intergenic
951477954 3:23128753-23128775 CAGAGTGAAGAGAAAGGGGAAGG - Intergenic
951584446 3:24201144-24201166 GAAAATGAAGAGAAGCAGGTAGG + Intronic
952388167 3:32858075-32858097 GAGGAGGAAGAGAGAGAGGAGGG + Intronic
952401996 3:32971767-32971789 GAGAATCAAGAGAAAGGGTTTGG - Intergenic
952418887 3:33114003-33114025 GAGAAGGAAAGGAAAGAGGACGG - Exonic
952421203 3:33132720-33132742 AAGAATGAAGAGAAAAGGGAAGG - Intronic
952433298 3:33247129-33247151 AAGAAAGAAAAGAAAGAGGAAGG - Intergenic
952482532 3:33776245-33776267 GAGAAAGAGGAGAAAGAAGAAGG - Intergenic
952602322 3:35100379-35100401 AAGCAATAAGAGAAAGAGGCTGG + Intergenic
952871165 3:37902601-37902623 GAGAAACAAGAGGAAGAAGCGGG - Intronic
952875575 3:37941711-37941733 GATAAGGAGGAGAAAGAGGGTGG + Intronic
953044491 3:39282381-39282403 GAGAGTGAAGCCAAAGGGGCTGG - Intergenic
953052820 3:39361634-39361656 GAGAATGAAGAAAAGCAGGTTGG + Intergenic
953241011 3:41149542-41149564 GGGAATGAAAAGATAGGGGCGGG + Intergenic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
953405800 3:42659217-42659239 GAGGAAGAAGAGGAAGAGGAAGG + Exonic
953875157 3:46662453-46662475 GTGAGTCAAGAGAAAGAGGCTGG + Intergenic
953880940 3:46690996-46691018 GAGGCTGCAGAGAGAGAGGCAGG + Intronic
954479729 3:50787807-50787829 GAGGAGGAAGAGAGAGAGGAAGG - Intronic
954684701 3:52364180-52364202 TGTAATGAAGAGAAACAGGCTGG + Intronic
954894473 3:53964010-53964032 GAGAAAGAAGAGAACCAGGGAGG - Intergenic
955043878 3:55341668-55341690 GAAGATGAAGAGGAAGAAGCGGG + Intergenic
955098409 3:55822963-55822985 GCGAATGAAGAAAAAGAAGAAGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955152540 3:56382376-56382398 AAGAATGGAGAGAAATAGGATGG - Intronic
955274184 3:57531927-57531949 GAGGAGGTAGAGAAAGAGACAGG - Intronic
955417386 3:58705278-58705300 GAGAATGAAGAAGAAAAGGGAGG - Intergenic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
955607328 3:60719843-60719865 GGTAATGAAGGGAAAGAGACAGG - Intronic
955703119 3:61701900-61701922 GAGAGGGAAGAGAAAGAGGAAGG + Intronic
955823432 3:62920710-62920732 GTGGATGGAGAGAAAGAAGCAGG + Intergenic
955840773 3:63110445-63110467 GAGGAGGAAGAGAAGGAGGAGGG + Intergenic
955940987 3:64146958-64146980 GAGGAGGAAGAGGAAGAGGAAGG - Exonic
955996332 3:64684537-64684559 CAGAAGGAAGACAAAGGGGCAGG + Intronic
956540008 3:70326159-70326181 CAGAAGGAAGGGAAAGAGGAAGG - Intergenic
956565374 3:70631216-70631238 GAGAAAGAAGAAAGAGAGGAAGG + Intergenic
956606739 3:71080729-71080751 ACAAATGAAGAGAAAGAGGAAGG - Intronic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956733123 3:72214864-72214886 GAGGAGGAAGAGAAAGTGGATGG - Intergenic
956832460 3:73065120-73065142 GAGGATGAAGAGGAAGAAGAAGG + Exonic
956959291 3:74379400-74379422 AAAAATGAAGACAATGAGGCAGG - Intronic
956970502 3:74517765-74517787 GAGAATTAAATGAAAGGGGCAGG - Intronic
957005529 3:74941858-74941880 GAAAATGAAGTGAAATAGACAGG + Intergenic
957085566 3:75673443-75673465 GAAGATGTAGAGACAGAGGCAGG - Intergenic
957320659 3:78625960-78625982 CTGAATGAAGAGGAAGAGGCTGG + Intronic
957356002 3:79087494-79087516 AGGAAGGAAGAGAAAGAAGCTGG - Intronic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
957764046 3:84598377-84598399 GAGAATCAAGAGACAGGGGAGGG - Intergenic
957805892 3:85148871-85148893 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
957843875 3:85705160-85705182 AAGAATGAAAAGAAGGGGGCGGG - Intronic
958661174 3:97069346-97069368 GAGAAGGAAGAAGAAGAGGAAGG + Intronic
958920080 3:100095170-100095192 GAAAAAGAAGAGAAAGTGGGAGG - Intronic
958938773 3:100287107-100287129 AAAAAAGAAGAGAAAAAGGCTGG - Intronic
958962554 3:100523763-100523785 GAGAAGGAAGAGAAAGGAGGAGG - Intronic
958997967 3:100927619-100927641 TAGGAGGAAGAGAAAGAGGAAGG + Intronic
959112621 3:102140157-102140179 GAGAAAGAAAAGAGAGAGGGAGG - Intronic
959472216 3:106766000-106766022 GCAAATAAGGAGAAAGAGGCAGG + Intergenic
959766545 3:110037355-110037377 GAGAATGGCGTGAAAGAGGGAGG - Intergenic
959779953 3:110219115-110219137 GAGAAGGAAGGGAAATAAGCGGG - Intergenic
959944980 3:112116639-112116661 TAGAATGAAGTGATGGAGGCTGG + Exonic
960073982 3:113462941-113462963 GAAGAGGAAGAGAGAGAGGCAGG - Intronic
960204624 3:114880367-114880389 AAGAATGAATACAAAGAGGTGGG - Intronic
960214265 3:115011200-115011222 GAGGAGGAAGAGAAAGAGACAGG + Intronic
961053327 3:123766279-123766301 GAGGGTGGAGAGAAATAGGCAGG - Intronic
961153593 3:124660357-124660379 GAGAAGGAAGAGTGAGAGGGAGG - Intronic
961338765 3:126203280-126203302 GAAAATGCAGAGAAGGGGGCTGG + Intergenic
961835216 3:129652393-129652415 GGCAATGATGGGAAAGAGGCTGG + Intronic
962360715 3:134740591-134740613 AGGAAAGAAGAGAAAGAGGCGGG - Intronic
962444216 3:135450445-135450467 GAGAATGATGAGCAAGAAACAGG + Intergenic
962585659 3:136840533-136840555 GAGAAGGAAGGGAGAGAGGGAGG - Intronic
962674559 3:137745185-137745207 GAGAAGGAAGAGGAGGAGGAGGG + Intergenic
962862461 3:139417475-139417497 GAGAAGGTAGAGAAAGAGATAGG - Intergenic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
962984497 3:140522173-140522195 GGGAATGAAGAAAAGCAGGCTGG - Intronic
963274669 3:143318021-143318043 GAGAAGGAAGAAAATGAGGCCGG - Intronic
963283676 3:143412286-143412308 GAGAAGGAAGTGAAAAAGACAGG + Intronic
963462752 3:145637819-145637841 GAGAATGATGAGAATGATGAAGG - Intergenic
963490807 3:145998115-145998137 GAGGAGGAAGAGGAAGAGGAGGG - Intergenic
963496398 3:146068089-146068111 GAGAAGGAAGGGGAAGAGGAAGG - Intergenic
963515476 3:146302706-146302728 GAGGAAGTAGAGAAAGAGACAGG + Intergenic
963592834 3:147285427-147285449 GAGAAGAAAGAGGAAGAGGAGGG - Intergenic
963600478 3:147374074-147374096 GAGAATTAAGAGAGAGATGGTGG - Intergenic
963692432 3:148520823-148520845 GAGGAGGTAGAGAAAGAGACAGG + Intergenic
964023647 3:152044983-152045005 GAAGAGGAAGAGAAAGAGGAAGG + Intergenic
964453945 3:156839994-156840016 GAGGAGGAAGAGGAAGAGGAGGG - Intronic
964633002 3:158833041-158833063 GAGGAGGATGAGAGAGAGGCTGG + Intergenic
964650161 3:159002712-159002734 GTAAATGAAGACATAGAGGCAGG + Intronic
964922142 3:161910093-161910115 GAGTATGAGGAGAAAAAGCCTGG + Intergenic
965333596 3:167407738-167407760 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
965611362 3:170547150-170547172 GAGAATGAAAAGGAAGAGAGAGG - Intronic
965993965 3:174856010-174856032 GAGAAGTAAGAGAGAGAGACAGG + Intronic
966278218 3:178201046-178201068 TAGAATGAAGGAAAAGAGGTGGG - Intergenic
966319894 3:178690532-178690554 AAGAAGGAAGAGAAAGAGGGAGG + Intronic
966370944 3:179250150-179250172 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
966454674 3:180101876-180101898 GAGAATGAAGAAAAGCAGGGTGG + Intergenic
966626110 3:182018871-182018893 GAGAAAGAAAAGAAAGAAGAGGG - Intergenic
966668367 3:182498427-182498449 TAGAAAGAAGAGAAAGAAGCAGG + Intergenic
966857668 3:184206611-184206633 AAGAATGAAGAAGAAGAAGCAGG - Intronic
966916801 3:184588834-184588856 GAGGATGTAGAGATAGTGGCAGG + Intronic
967041565 3:185698166-185698188 GGTACTGAAAAGAAAGAGGCAGG + Intronic
967260520 3:187637252-187637274 GAGTATTAAGAGAGAGAGTCAGG - Intergenic
967263827 3:187672475-187672497 GAGAAGGCAGGGAAAGAGCCGGG - Intergenic
967530339 3:190542260-190542282 GAGAATGATGTGAAAGAATCAGG + Intronic
967553744 3:190830994-190831016 GAGAAAGAACGGAAAGAGGAAGG + Intergenic
967556219 3:190862384-190862406 GAGAAAGGAGAGAAAGAAGAGGG + Intronic
967736579 3:192959281-192959303 GAGAGGGAAGAGAAAGAGAAAGG + Intergenic
967787273 3:193511261-193511283 AAGGATGCAAAGAAAGAGGCAGG + Intronic
967832497 3:193932414-193932436 GAGAATGCAGAGGGAGAAGCTGG - Intergenic
967833954 3:193945275-193945297 GAGGATGAAGGGAGAGAGCCTGG - Intergenic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
967969271 3:194987140-194987162 TAGAATGAATATAAATAGGCTGG + Intergenic
968029908 3:195474860-195474882 GGGAAGGAAGAGAGAGAGGAAGG + Intergenic
968120001 3:196119528-196119550 AAGAATGATTAGAAGGAGGCTGG + Intergenic
968212772 3:196862625-196862647 GAGAATGAAAAGCAATAGGAAGG - Intergenic
968227239 3:196980900-196980922 GAGGATGAAAAGAAATAGGAAGG + Intergenic
968259823 3:197311663-197311685 GGGAAGGAAGAGAAAGATGAAGG - Intergenic
969871753 4:10109057-10109079 GAGAGTGAATAGTAAGTGGCCGG - Intronic
969927596 4:10599776-10599798 GACAAAGAAGAGACAGAGTCAGG - Intronic
969971395 4:11052050-11052072 AAGAATGAACAGAACGAGGTAGG - Intergenic
970071357 4:12163107-12163129 GAGAATGAAGAGGAAGAGATGGG + Intergenic
970122166 4:12768194-12768216 AAGAAGGAAGGGAAAGAGGGAGG + Intergenic
970127904 4:12834908-12834930 GAAAATTATGAGAAGGAGGCCGG - Intergenic
970254338 4:14151876-14151898 GAGAAAGAAGATAAAGGGGGCGG + Intergenic
970270172 4:14338155-14338177 GAGAATGAAGAAAAGGACACTGG + Intergenic
970290496 4:14565913-14565935 GAGAAAGAAGAGAAAAATGAAGG - Intergenic
970303339 4:14704261-14704283 GAGAAGGAAGAGCATGAAGCAGG + Intergenic
970729973 4:19091126-19091148 GAGAATGGAGAGTGAGAGGAGGG + Intergenic
970971914 4:21994733-21994755 GAGAAACAAGAGAGAGTGGCAGG + Intergenic
971042824 4:22773668-22773690 GAGAATGAAGTGAAGGAGAGGGG + Intergenic
971080319 4:23202691-23202713 GAGAAAGAAGAGATAAAGACAGG - Intergenic
971086722 4:23286313-23286335 GAAAAGGAGGAGAAAGAGGAGGG + Intergenic
971218339 4:24682412-24682434 CAGAATGAAAAGAGAGAGGGAGG - Intergenic
971271069 4:25146373-25146395 TAGAAAGAAGAGGAAGAGGAAGG - Intronic
971278366 4:25219555-25219577 GAGAAGGAGGAGAAACAGGAGGG + Intronic
971394402 4:26215022-26215044 AAGAAAGAAAAGAAAGAGGGAGG + Intronic
971410813 4:26369866-26369888 GAGAAGAGAGAGAAAGGGGCTGG - Intronic
971448500 4:26778117-26778139 GAGAAGGAAAGGAAAGAGGCCGG + Intergenic
971597388 4:28548604-28548626 GAATAGGAAGAAAAAGAGGCAGG + Intergenic
971708928 4:30086014-30086036 GAGAATGAAGTGAAACTGGGAGG + Intergenic
971790137 4:31159593-31159615 AAGAAAGAAGAGAAGAAGGCAGG + Intergenic
971796361 4:31233890-31233912 GAGTAGGAAGAGGAAGAGGAAGG + Intergenic
971891613 4:32530641-32530663 GAGAAGGCAGAGAAAGAGATAGG + Intergenic
972102585 4:35441066-35441088 GAGAGTGGTGAGAAAGAGGAGGG + Intergenic
972300736 4:37783395-37783417 GAGAAAGAAGAGAATGAGAGAGG - Intergenic
972315333 4:37920812-37920834 AAGAATGGAGACAAAGGGGCCGG + Intronic
972620524 4:40743908-40743930 GAAAATGGAGATAAATAGGCCGG - Intergenic
972728031 4:41763519-41763541 GAGAGTGAAGAGTGAGAGGAGGG + Intergenic
972790227 4:42364704-42364726 AAGAAAGAAGAGAGAGAGACTGG - Intergenic
972993953 4:44856273-44856295 CAGAATGAAGAAAAATGGGCAGG + Intergenic
973195485 4:47434905-47434927 GAGAGTGAACAGAATGAGGCAGG - Intergenic
973535812 4:51880832-51880854 TAGAATGAAGACAACCAGGCTGG + Intronic
973560312 4:52128824-52128846 GAGAAAGAAGAGACAGATGTTGG - Intergenic
973616725 4:52686217-52686239 GAGAAAGAGGAGGAAGAGGAAGG - Intergenic
973731931 4:53831282-53831304 GAGAAGGAAGAGATAAAGGCAGG + Intronic
973739092 4:53901926-53901948 GAGAAGGGAGATAAAGAGGAAGG + Intronic
973802364 4:54492005-54492027 GAGAAAGAAGGGAAAGAGGGGGG - Intergenic
973881445 4:55275357-55275379 AAAAAAGAAGAGAAAGAGGAGGG + Intergenic
974015663 4:56646651-56646673 CAAAATGAAGAGAAAGAGGGAGG - Intergenic
974088020 4:57281751-57281773 GAGAATGATGAAAAAGATGGAGG + Intergenic
974235511 4:59176230-59176252 GAGAAGGATGAGTAAGAGGAGGG - Intergenic
974301669 4:60076902-60076924 AAGAATGAAGAGAAAGACGGAGG + Intergenic
974340175 4:60604198-60604220 GAGAATGAAGAAAAGCAGGATGG - Intergenic
974360641 4:60873936-60873958 GAGAAAGAAGATAAATATGCTGG - Intergenic
974832002 4:67201182-67201204 GAGAATTCACAGAAAGAAGCAGG - Intergenic
974849930 4:67392024-67392046 ATCAATCAAGAGAAAGAGGCAGG + Intergenic
975493695 4:75015071-75015093 GAAAGTGAAGAGAGAGTGGCTGG - Intronic
975969582 4:80017154-80017176 GATAAGGAAGAGAGAGTGGCAGG - Intronic
976361776 4:84187551-84187573 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
976469251 4:85408164-85408186 GAATTTGAAGAGTAAGAGGCTGG + Intergenic
976656506 4:87494174-87494196 GAGGAAGAAGAAAAAGAGCCAGG - Exonic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
976909263 4:90280343-90280365 ATGAATGAAGAGAGAGAGGAAGG - Intronic
977232067 4:94463546-94463568 GAGAAAGAGGAGGAAGAGGAAGG + Intronic
977257803 4:94758871-94758893 GAGGATGAAGGGACAGAGGAGGG - Intronic
977415484 4:96727548-96727570 AAGAAGGAAGAGTAAGAGGAGGG + Intergenic
977789096 4:101077021-101077043 CAGAGTGAAGACACAGAGGCAGG + Intronic
977990964 4:103442231-103442253 AAGAATGGAGAAAATGAGGCAGG - Intergenic
978112594 4:104980109-104980131 GAGGATATAGAGAAAGAGACAGG + Intergenic
978575066 4:110181519-110181541 GACAATGGAGAGAAAAAGACTGG + Intronic
978657723 4:111085261-111085283 GAGTAGGAAAAGAAAGAGGAAGG - Intergenic
978830706 4:113080870-113080892 CAGAATGGAGAGGAAGAGGATGG + Intronic
978919227 4:114162267-114162289 GAGAATGGAGAGAGAAAGGTTGG + Intergenic
979133707 4:117082173-117082195 AAGAATAAAGGGAAAGATGCTGG - Intergenic
979264541 4:118685672-118685694 GAGAAGGGACAGAAAAAGGCGGG - Intronic
979305604 4:119139547-119139569 CTGAATGAAGAGAGAGAGGTAGG + Intronic
979397479 4:120205957-120205979 TAGACTGAAGAGGAAGAGGGTGG + Intergenic
979514155 4:121587646-121587668 TAGGCTGAAGAGAAATAGGCAGG - Intergenic
980136023 4:128859133-128859155 GAGCAGGAAGAGAAAAGGGCAGG + Intronic
980164991 4:129215148-129215170 GACAAAGCAGAAAAAGAGGCAGG - Intergenic
980190677 4:129520487-129520509 GAGGAAGAAGAGAAGGAGGAGGG + Intergenic
980211497 4:129794185-129794207 GAGAAGGACGAGAAAGAGGAGGG - Intergenic
980510050 4:133773162-133773184 GAGAAAAAAAAGAAAGAGGAAGG + Intergenic
980643860 4:135616253-135616275 GAGAATGAAGAAGATGAGGCCGG - Intergenic
980788252 4:137582460-137582482 GAGAAAGTAGGGAAAGAGACAGG + Intergenic
980844912 4:138312811-138312833 GAGGAGGAGGAGAAAGGGGCAGG - Intergenic
980889597 4:138800291-138800313 GAAAAGGAAAAGAAAGGGGCAGG + Intergenic
981111476 4:140939439-140939461 AGGAAAGAAGAGAAAGAGGAAGG + Intronic
981206454 4:142046594-142046616 TAGAGTGAAAAGAAAGAGGAGGG + Intronic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981224004 4:142270177-142270199 GAGATTGAGGAGAGAGAAGCAGG - Intronic
981365873 4:143902561-143902583 GAGGATGGAGAGAGAGAGGGAGG - Intronic
981572873 4:146172055-146172077 AAGAAGGAAAAGAAAGAGGGAGG - Intergenic
981728733 4:147875251-147875273 GAGCAGGGAGAGAAAGAGGTAGG - Intronic
981752162 4:148102986-148103008 ACGAATGGAGAGAAAGAGGAGGG - Intronic
981754095 4:148122566-148122588 GAGGAAGAAGGGAAAGAGGAAGG - Intronic
981857118 4:149307909-149307931 GAGAATGAGGAGCAAGATTCTGG - Intergenic
982410573 4:155071881-155071903 AAGAAAGTAGAGAAAGAGGAAGG + Intergenic
982667782 4:158287952-158287974 TAGAATTTAAAGAAAGAGGCCGG + Intergenic
982757788 4:159244099-159244121 AAAAATGAAGAGAGAAAGGCAGG + Intronic
983001219 4:162417383-162417405 GAGAATGGGGAGATAGAGGTAGG - Intergenic
983156851 4:164358570-164358592 CAGAATGAAGAGAAAGTGAAAGG + Intronic
983206497 4:164915817-164915839 AAGCAAGAAGAGGAAGAGGCAGG + Intergenic
983212126 4:164969729-164969751 AAGCAAGAAGAGGAAGAGGCAGG - Exonic
983365004 4:166775219-166775241 GTGGATGAGGAGAAAGTGGCAGG + Intronic
983491348 4:168393382-168393404 GCTACTGAAGAGAATGAGGCAGG + Intronic
983523413 4:168734937-168734959 GAGAGAGAGGAGAAAGAGGAGGG + Intronic
983640390 4:169939776-169939798 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
983883103 4:172954938-172954960 AAGAATGAAGACATAGAGGATGG + Intronic
983981111 4:173998677-173998699 GAGACTGACGAGTAACAGGCAGG + Intergenic
984250475 4:177327102-177327124 GAGAGAGAAGAGAAAGAGAAGGG - Intronic
984616442 4:181903872-181903894 CAGAATGAAAAAGAAGAGGCAGG - Intergenic
984629065 4:182040305-182040327 GAGAAGGAAGGGACAAAGGCAGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984761234 4:183364598-183364620 GAAGAGGAAGAGAAAGAGGATGG - Intergenic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
985232118 4:187830324-187830346 GAGAATGAGGAGATAGATGTTGG - Intergenic
985355606 4:189116131-189116153 GAAAATGGTGAGAAGGAGGCAGG + Intergenic
985444440 4:190014052-190014074 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
985490797 5:177754-177776 GAGAATCATGGGAAAGGGGCTGG - Intronic
985507144 5:289409-289431 GAGGATGAAGAGGAAGAAGAAGG - Intronic
985584488 5:723038-723060 GAGAATGAAGAGCATGAGCGGGG + Intronic
985597999 5:807365-807387 GAGAATGAAGAGCATGAGCGGGG + Intronic
985697313 5:1347912-1347934 GTGAATGAATACAGAGAGGCAGG - Intergenic
985822326 5:2168838-2168860 TTGAATGAAGGGAAAGAGCCAGG - Intergenic
985851629 5:2392633-2392655 AGGAAGGAAGAGAAAGAGGAAGG - Intergenic
985983197 5:3489197-3489219 GAGGAGGGAGAGAGAGAGGCCGG - Intergenic
986009667 5:3700806-3700828 GAGAAGGAAGAGAAGAAGGAGGG - Intergenic
986095117 5:4547102-4547124 GAAAAGAAAGAGAAAGAGGCTGG + Intergenic
986180242 5:5386283-5386305 GAGAACGAAGTGAATGAGGGAGG + Intergenic
986297425 5:6450201-6450223 GGGGATGAAGAAAAAGAAGCAGG - Intronic
986794889 5:11200647-11200669 GAAAGAGAAAAGAAAGAGGCTGG - Intronic
986881847 5:12183925-12183947 GGGAATGAAGAGAAGCAGGCAGG + Intergenic
986899199 5:12411511-12411533 GAGGAAGTAGAGAAAGAGACAGG - Intergenic
987069784 5:14325439-14325461 GAGAAGCAAGAGAAAAAGGAGGG + Intronic
987416197 5:17663995-17664017 GAGAATGAAGAAAAGCAGGATGG - Intergenic
987421315 5:17723799-17723821 GAAAGTGAAGTGAAAGAGGGAGG + Intergenic
987428617 5:17803546-17803568 GAGAAGGAGGAGGAAGAGGAGGG + Intergenic
987708858 5:21484949-21484971 GAAAAAGAAAAAAAAGAGGCCGG + Intergenic
987899062 5:23987492-23987514 GAGAAGAAACAGAGAGAGGCAGG - Intronic
988063785 5:26208172-26208194 GAGTATTAAGAAAAACAGGCTGG + Intergenic
988081870 5:26425622-26425644 GAGGATTAAGAGAGAGTGGCCGG - Intergenic
988101103 5:26680009-26680031 AAGAAAGAGGAGAAAGAGGGAGG - Intergenic
988164738 5:27572067-27572089 GAGAAGAAAGATAAAGAGGAGGG + Intergenic
988750754 5:34189197-34189219 GAAAAAGAAAAAAAAGAGGCCGG - Intergenic
988848078 5:35150229-35150251 AAGAATAAAGAGAAAGAAGTGGG - Intronic
989285952 5:39700099-39700121 GAGAAAAGAGAGAGAGAGGCTGG + Intergenic
989313775 5:40053067-40053089 AAGAATGAAGTAGAAGAGGCAGG - Intergenic
989391084 5:40901580-40901602 CAGAATGAATAGAAAAAGGTGGG - Intergenic
989626835 5:43437799-43437821 GAAAATGAAGTTAAAGAAGCAGG + Intergenic
989641077 5:43583745-43583767 GAGAATGAGGGGCCAGAGGCAGG + Intergenic
990079747 5:51898867-51898889 GAGAAAGAGGAGGAAGAGGAGGG + Intergenic
990168519 5:53020988-53021010 AAGAATCAAGATAAAAAGGCCGG - Intronic
990286653 5:54307026-54307048 GAGAAGAAAGAGTAAGATGCTGG + Intronic
990578695 5:57148376-57148398 GAGAAGGAAGAGAGAGAGAAGGG - Intergenic
990619066 5:57540379-57540401 GAGAAGTGAGAGAAAGAGGGAGG - Intergenic
990742590 5:58927462-58927484 AAGAAAGAAGAGGAAGAAGCTGG - Intergenic
991080130 5:62589554-62589576 GGGAATAAAGAGAAAGGGGTAGG - Intronic
991092919 5:62710144-62710166 AAGAAAGAAAAGAAAGAGGGAGG - Intergenic
991237931 5:64420425-64420447 GAGAAGGGAGAGAAAGAGATAGG + Intergenic
991245261 5:64503592-64503614 GAGAAGGAAGAGAGAGAGGAAGG + Intergenic
991327988 5:65459172-65459194 GAAAATGTAGAGAAACAGGCCGG - Intronic
991522287 5:67514543-67514565 GAGAAGGAAGAGAGAAAGCCAGG + Intergenic
991655640 5:68901600-68901622 GAGAGGGAAGAGAGAGAGGGAGG - Intergenic
991735891 5:69631122-69631144 GAAAAAGAAAAAAAAGAGGCCGG - Intergenic
991739019 5:69652410-69652432 GAAAAAGAAAAAAAAGAGGCCGG - Intergenic
991759179 5:69904021-69904043 GAAAAAGAAAAAAAAGAGGCCGG + Intergenic
991788157 5:70214101-70214123 GAAAAAGAAAAAAAAGAGGCCGG - Intergenic
991790594 5:70232151-70232173 GAAAAAGAAAAAAAAGAGGCCGG - Intergenic
991812385 5:70486761-70486783 GAAAAAGAAAAAAAAGAGGCCGG - Intergenic
991815344 5:70507238-70507260 GAAAAAGAAAAAAAAGAGGCCGG - Intergenic
991818480 5:70528527-70528549 GAAAAAGAAAAAAAAGAGGCCGG - Intergenic
991838408 5:70779087-70779109 GAAAAAGAAAAAAAAGAGGCCGG + Intergenic
991880604 5:71214465-71214487 GAAAAAGAAAAAAAAGAGGCCGG - Intergenic
991883041 5:71232486-71232508 GAAAAAGAAAAAAAAGAGGCCGG - Intergenic
991957881 5:72014098-72014120 GAGAAAGAAGAGATGGAGGGGGG + Intergenic
992017403 5:72589751-72589773 AAGGAAGAAGAGAGAGAGGCTGG + Intergenic
992079607 5:73222784-73222806 GGGCAAGAAGAGAAAGAGGGAGG - Intergenic
992414944 5:76543446-76543468 GAGAGTGAAGGCAAGGAGGCCGG - Intronic
992579267 5:78154541-78154563 GAGGAAGTAGAGAAAGGGGCAGG - Intronic
992705481 5:79387051-79387073 GAGAAAGAAAGGAAAGAGGAAGG - Intronic
993010859 5:82480695-82480717 GAGAAGGCAGAGAGAGGGGCAGG + Intergenic
993277934 5:85886210-85886232 TAAAATGAAAAGAAAGAGGGGGG - Intergenic
993616775 5:90122656-90122678 GAGAATGTATAGGGAGAGGCTGG - Intergenic
993916432 5:93748464-93748486 GAAAATAAAAAGACAGAGGCAGG + Intronic
994150426 5:96441325-96441347 GAGAAAGAAAAAAAAGAGGAAGG - Intergenic
994183097 5:96788997-96789019 GAGAAGGGAGAGAAAGTGCCAGG + Intronic
994194369 5:96906204-96906226 GAGAAGGAAGAGGAGGAGGAGGG - Intronic
994420986 5:99526298-99526320 GAAAAAGAAAAAAAAGAGGCTGG + Intergenic
994486057 5:100388016-100388038 GAAAAAGAAAAAAAAGAGGCCGG - Intergenic
994770522 5:103975328-103975350 GAGAATGAAGAGACAAAGGAAGG + Intergenic
994849769 5:105039109-105039131 CAGAAGGAAGAGAGAGAGGAGGG - Intergenic
994997103 5:107078153-107078175 GAGAAAAAATAGAAATAGGCCGG + Intergenic
995053922 5:107737809-107737831 GAGAAAGTAGAGAAAAAAGCGGG + Intergenic
995062449 5:107825693-107825715 AAGAATGAAGAGAAAGAAATTGG - Intergenic
995274722 5:110265175-110265197 GAGTATGAAGAGGAGGAGGGCGG - Intergenic
995767257 5:115632489-115632511 GAGAAAGAAAAGAAAAAGGAAGG + Intronic
995877017 5:116801023-116801045 GAGAATGTGAAGAAATAGGCAGG + Intergenic
996177251 5:120373884-120373906 GAAAAATAAGAGAAAGAGACAGG + Intergenic
996380976 5:122862317-122862339 AAGAAAAAAAAGAAAGAGGCTGG + Intronic
996486959 5:124047088-124047110 TAGAGTGAAGAGAAAGAGAGAGG + Intergenic
996542813 5:124647901-124647923 GACAAAGAAGGGAAAGAGACGGG - Exonic
996622796 5:125530086-125530108 GAGAAAGAAAAGAAAGAGGGAGG - Intergenic
996737029 5:126767513-126767535 GAGAAGAGAGAGAAAGAGGGAGG - Intergenic
996809172 5:127494983-127495005 AAGAAAGAAGAGAAAGAGGAAGG + Intergenic
996828180 5:127709142-127709164 GAGAAAGAAGAGAGAGAGAGGGG + Intergenic
996992463 5:129651450-129651472 GAGAATGATGGAAATGAGGCAGG - Intronic
997106386 5:131023812-131023834 GAGAAAGCTAAGAAAGAGGCTGG + Intergenic
997110111 5:131065589-131065611 AAGAAGGAAGAGAGAGAAGCAGG - Intergenic
997348558 5:133212086-133212108 GTGAATGAAGAGAAACTGGCAGG - Intronic
997654562 5:135545510-135545532 GATTTTGAAGAGATAGAGGCTGG + Intergenic
997755571 5:136395741-136395763 GAGAGGTAAGAGAAAGATGCAGG + Intronic
997804640 5:136905092-136905114 GAGGAGGAAGAGAAAGATGAAGG - Intergenic
997982880 5:138480589-138480611 AAGAAAGAAAAGAAAGAGGCCGG - Intergenic
998129323 5:139643377-139643399 AGGTCTGAAGAGAAAGAGGCTGG + Intergenic
998231696 5:140364995-140365017 GAGAGGGGAGAGAAAGGGGCAGG + Intronic
998410463 5:141906692-141906714 GAGGAGGAAGAGAAAGAAGGAGG + Intergenic
998534117 5:142913421-142913443 GAGAAGGAAAGGAAGGAGGCAGG - Intronic
998542884 5:142999448-142999470 GAGAAAGAGGAGAGTGAGGCGGG + Intronic
998628852 5:143876225-143876247 GAGAATGAAGAGAAGGGGCTTGG + Intergenic
998695090 5:144629904-144629926 GAGAATGAGGAGCAAGATGATGG + Intergenic
999084814 5:148878257-148878279 GAGAATGAGGAAGAAGAGGAGGG + Intergenic
999132550 5:149295600-149295622 GAGAATGGAGAGAAAGAGGAAGG + Intronic
999297249 5:150467414-150467436 TAGAATGGTGAGAAACAGGCTGG + Intergenic
999363061 5:151002449-151002471 TAGGATAAAGAAAAAGAGGCTGG + Intergenic
999394768 5:151220525-151220547 GTGAATGATAAGGAAGAGGCTGG - Intronic
999551556 5:152692938-152692960 GAGAAGGGAGAGAGAGAGGTTGG + Intergenic
999585536 5:153085740-153085762 GAGAATGGAGAGAAGGAAGAAGG + Intergenic
999656362 5:153814544-153814566 GAGAAAGAAGAGAAACTGGCAGG + Intergenic
999662233 5:153877336-153877358 GAGCATGCAGAGAGAGAGACAGG + Intergenic
999692676 5:154162327-154162349 AAGAAGGAAGAGAGAGAGGAGGG + Intronic
999872327 5:155765412-155765434 GTGAAGGAAGGGAAAGAGGGAGG + Intergenic
1000131680 5:158306275-158306297 GAGAATGCAGAGAAAACGCCAGG - Intergenic
1000327418 5:160182892-160182914 GAGAATAAAATGAAATAGGCCGG - Intergenic
1000776531 5:165426537-165426559 GAGAAGGAGGAAAAAGAGGAGGG - Intergenic
1000901590 5:166917996-166918018 GGGAATGAATAGAGAGGGGCTGG + Intergenic
1000997796 5:167976121-167976143 AGGAAAGAAGAGAAAGAGGAAGG - Intronic
1001040728 5:168333244-168333266 GAGGAGAAAGGGAAAGAGGCGGG - Intronic
1001129678 5:169053692-169053714 GTGAATGAAAAGAAGGGGGCGGG - Intronic
1001177836 5:169488313-169488335 GAGGAAGTAGAGAAAGAGACAGG + Intergenic
1001423417 5:171604835-171604857 GAAAAAGAAGAGCAGGAGGCTGG - Intergenic
1001618916 5:173065600-173065622 GGGAATAAAGAGAGAGAGGGAGG - Intronic
1001772820 5:174308767-174308789 GGGAATGGACAGAAAGAGGCAGG + Intergenic
1001919500 5:175588981-175589003 GAGAAAGAAAGGAAAGAGGAAGG + Intergenic
1002036201 5:176471974-176471996 GAGAATGTACAGATAGGGGCTGG - Intronic
1002112364 5:176926771-176926793 GAAAAAGAAGAGAAATAGGAGGG + Intronic
1002337627 5:178491170-178491192 GAGAGAGAAGAGAACGAGGAGGG + Intronic
1002404852 5:179022294-179022316 GAATATGAAGAGAAAAAGGGAGG + Intergenic
1002605514 5:180380688-180380710 GAGAATGAGCAGGAAGGGGCCGG - Intergenic
1002895041 6:1373832-1373854 GAGAATGAAGAGTATCAGGTAGG - Intergenic
1002913761 6:1511556-1511578 GAGAAGGAGGAGGAAGAGGAGGG - Intergenic
1002967059 6:1977609-1977631 GAGAATGAAGAAAAGCAGGGTGG + Intronic
1003380407 6:5619805-5619827 AAGAATGAAGAGAGGGAGACAGG - Intronic
1003496038 6:6663987-6664009 GACTAAGAAGAGAAAGGGGCAGG - Intergenic
1003548210 6:7079037-7079059 AAGGAGGAAGAGAAAGAGGAAGG + Intergenic
1003617064 6:7664701-7664723 GAGAAAGAAGGGAGAGAGGAGGG + Intergenic
1003944375 6:11059868-11059890 GAGAATGACGTGAACGAGGGAGG + Intergenic
1004135605 6:12963105-12963127 CAGAATTCAGAGAAAGAGACAGG + Intronic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004506054 6:16247669-16247691 AAGAATTAAGAGATACAGGCCGG - Intronic
1004633529 6:17444889-17444911 GAGAATGAAGGGAATGAGGCGGG - Intronic
1004638983 6:17495818-17495840 GAAAATACAGAGAAAGAGACAGG + Intronic
1004791823 6:19035048-19035070 GAGAATGAACAGGATGAAGCCGG + Intergenic
1005000504 6:21235504-21235526 AAAAATGAAGAGAGAGAGGGAGG + Intergenic
1005111924 6:22291663-22291685 GAGAAGGAGGAGAAAGAGAAAGG - Intronic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1005451546 6:25977695-25977717 GAGGAGGAAGAGAAAGAGGTGGG + Intronic
1005516163 6:26556367-26556389 GAAAATGTAGAGAAAGTGACTGG + Intergenic
1005548824 6:26895502-26895524 GAAAAAGAAAAAAAAGAGGCCGG - Intergenic
1005741852 6:28799251-28799273 AAGAAAGAAGAGAGGGAGGCAGG + Intergenic
1005802930 6:29445402-29445424 GAGAAAGAAGAAACAGAGGCAGG + Intronic
1005857648 6:29874780-29874802 GAGAAGAAAGAGAGAGAGGGAGG - Intergenic
1005986935 6:30881491-30881513 GAGAGTGGAGGGAAAGAGGAGGG - Intronic
1006179149 6:32143559-32143581 AAGAAAAAAGAAAAAGAGGCTGG + Intergenic
1006182920 6:32164660-32164682 GGGAATGGAGAGAGAGAGGAAGG + Exonic
1006193397 6:32222959-32222981 GAGACTGGAGAGAAAGGGGGAGG - Intronic
1006282772 6:33068812-33068834 AAGAATGAAGAGATAGGGTCAGG + Intronic
1006536409 6:34702594-34702616 AAGAATCATGAGACAGAGGCCGG + Intergenic
1006854285 6:37122415-37122437 AAGAAAGGAAAGAAAGAGGCTGG - Intergenic
1006980923 6:38147166-38147188 GAGAGTGAAAAGAGAGAGACTGG - Intronic
1007133195 6:39496079-39496101 GGGAAAGAAGAAAAACAGGCTGG - Intronic
1007164771 6:39821579-39821601 GAGAAGGAGGAGACAGAGGTGGG + Intronic
1007235930 6:40391566-40391588 GTGAATGAAGAGGAGGAGTCTGG + Exonic
1007404390 6:41625628-41625650 GAGTGTGAACAGAAAGAGGCTGG + Intergenic
1007405107 6:41630901-41630923 GAGGGAGGAGAGAAAGAGGCTGG + Intergenic
1008177447 6:48286687-48286709 GAGAAGGTAGAGAAAGAGATAGG - Intergenic
1008229187 6:48963167-48963189 GGGAATTAAGAGAAAGAAGATGG - Intergenic
1008442147 6:51543913-51543935 AAGGAGGAAGAGAAAGAGGAAGG - Intergenic
1008537552 6:52518299-52518321 AAGAATGAAGGGACTGAGGCTGG + Intronic
1008982285 6:57498781-57498803 GAAAATGAAGAACAAGAGGGTGG - Intronic
1009019577 6:57936614-57936636 GAAAAAGAAAAAAAAGAGGCCGG - Intergenic
1009234456 6:61105664-61105686 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1009352972 6:62706148-62706170 GAGGAGGAAGAGAAAGAGATAGG - Intergenic
1009372211 6:62919646-62919668 GAGAATAGAAAGAATGAGGCAGG - Intergenic
1009435436 6:63612928-63612950 GAGAGTGAAGAGAAAAAGGTGGG - Intergenic
1009498575 6:64382238-64382260 GAGAGTGAAGAGAATGAGATAGG - Intronic
1009514935 6:64603265-64603287 AAGAAAGAAGAGAAGGAGGATGG - Intronic
1009518133 6:64646126-64646148 GAGAATCAAGAGAAACCGGCAGG + Intronic
1009652977 6:66499901-66499923 CAGAAGGAAGAGAGAGAGGAAGG - Intergenic
1009659134 6:66587070-66587092 GAGAAAGAAAGGAAAGAGGGAGG - Intergenic
1010026790 6:71227973-71227995 TGAAATGAAGAGAAACAGGCAGG - Intergenic
1010060126 6:71613279-71613301 GAGATTGGTGAGAAAGGGGCAGG - Intergenic
1010290013 6:74124604-74124626 AAGAAGAAAGAGAAAAAGGCAGG - Intergenic
1010320727 6:74505727-74505749 GAGAGTGTAGAGAAAGAGAAAGG + Intergenic
1010345975 6:74811261-74811283 GAGAAAGAAGACAGAGAGGGAGG + Intergenic
1010555234 6:77271207-77271229 GTGAATGATGAGAAAAAGGGCGG - Intergenic
1010725510 6:79328213-79328235 GAAATTGCAGAGAAATAGGCAGG - Intergenic
1010996166 6:82535662-82535684 GAGAATGAGAAGAAATAGCCAGG + Intergenic
1011700390 6:89949948-89949970 GAGAGGGAGGAGAAAGAGGGGGG + Intronic
1011787741 6:90865687-90865709 GAGAGTGAAGAGAAAGTGAAAGG + Intergenic
1011878580 6:91993619-91993641 GAGTATGTGGAGAAAGTGGCAGG + Intergenic
1011934439 6:92757615-92757637 GAGAAGGAGGAGGAAGAGGAAGG + Intergenic
1012237708 6:96837593-96837615 GTGAGAGAAGAGAAAGAGGGAGG + Intergenic
1012411488 6:98963056-98963078 GTGAATCTAGAGACAGAGGCAGG - Intergenic
1012629657 6:101448649-101448671 GAGAATGAAAGGAAAGAAGTGGG + Intronic
1012694741 6:102364680-102364702 AAGAATGTAGAGATATAGGCTGG + Intergenic
1012712859 6:102630260-102630282 GAGAAAGAATAGAAAGAGGAGGG + Intergenic
1013136842 6:107290531-107290553 GGGAATGAAGTCAGAGAGGCGGG - Intronic
1013291510 6:108723130-108723152 GAGGATGAAGATAAAGTGGTAGG - Intergenic
1013368937 6:109454251-109454273 GAAAAAGAAGGGGAAGAGGCTGG + Intronic
1013535505 6:111059739-111059761 GAGAATGCAGCCAGAGAGGCAGG - Intergenic
1013734360 6:113208165-113208187 GGGAAAGCAGAGAAAGAAGCAGG - Intergenic
1013912076 6:115287858-115287880 GAGAAGCAAGAGAAATAGGATGG - Intergenic
1014203386 6:118628496-118628518 GAAAATAAAGAGAAAAAGGCTGG + Intronic
1014207584 6:118672893-118672915 GAGAAAGAAGAGGAGGAGGGAGG + Intronic
1014327008 6:120010184-120010206 GAGATAGGAGAGAAGGAGGCAGG + Intergenic
1014411838 6:121134334-121134356 GAGAATGGAGAGCAAGAGGAGGG - Intronic
1014645547 6:123968236-123968258 GAGAGCAAAGAGAAAGAGGTGGG + Intronic
1014653367 6:124069347-124069369 GAGAATGCTGAGTGAGAGGCTGG + Intronic
1014743464 6:125172048-125172070 AAGAAAGAAGAGAAAGAAGGTGG - Intronic
1014755952 6:125302021-125302043 GAGATAGAAGAGTAAGAGGAGGG - Intronic
1014856785 6:126411953-126411975 GAGAAAGGAGAGAGAGAGGGAGG - Intergenic
1014924459 6:127254691-127254713 AAGAAAGAAAAGAAAAAGGCCGG + Intergenic
1015076327 6:129162873-129162895 GAGAATGAAGAGAACTAGGAGGG + Intronic
1015237603 6:130988790-130988812 AAGAATGAAGGAAAGGAGGCTGG + Intronic
1015376317 6:132513964-132513986 GAGAATGAAGGAAAAAAGGAGGG + Intergenic
1015426137 6:133070045-133070067 GAGAATGAAGAGAGTGAGGATGG + Intergenic
1015445577 6:133300211-133300233 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
1015556781 6:134470745-134470767 GAAAGAGAAGAGAAAGAGGGAGG - Intergenic
1015563704 6:134543727-134543749 GAAAATGAAGAGAAATGGCCAGG + Intergenic
1015711990 6:136152058-136152080 GAGGAAGAAGAGGAAGAGGAGGG + Intronic
1015857104 6:137636511-137636533 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1015893714 6:137995893-137995915 CAGATTGAAAAGGAAGAGGCAGG + Intergenic
1015959625 6:138633241-138633263 GAGGAGGTAGAGAAAGAGACAGG + Intronic
1015977648 6:138807069-138807091 GAGGAGGAAGAGAAAGAGGAAGG + Intronic
1015994950 6:138987967-138987989 GAGGGTGCAGAGAAAGAGGCGGG + Exonic
1016003555 6:139066911-139066933 GAAAATGGAGAGAAGGAGGAAGG - Intergenic
1016136713 6:140553512-140553534 GAGAAGGTAGAGAAAGAGATAGG - Intergenic
1016138431 6:140576776-140576798 GAGAAAAAAGAGAGAGAGGATGG - Intergenic
1016158175 6:140840749-140840771 TTGAAAGAAGAGGAAGAGGCCGG - Intergenic
1016385550 6:143527444-143527466 GATAAAAAAGAGGAAGAGGCAGG - Intergenic
1016423928 6:143913830-143913852 GAGAATGAAGAAAAGTAGGGTGG - Intronic
1016626458 6:146175136-146175158 GGGAATGAACACAAGGAGGCAGG + Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017210483 6:151850393-151850415 GAGAGAGAAGAGAGAGAGGGAGG + Intronic
1017235431 6:152113054-152113076 GAGAAAGAAGCGCAAAAGGCCGG + Intronic
1017318777 6:153063635-153063657 GAGAAGGTAGAGAAAGAGAAGGG + Intronic
1017397284 6:154017133-154017155 GAGAAGGAAGAGGAAGAGAGAGG - Intronic
1017585460 6:155917045-155917067 CAATATGATGAGAAAGAGGCAGG + Intergenic
1017616359 6:156250703-156250725 AAGAGTGAGGAGAAAGAGACTGG - Intergenic
1017709549 6:157154875-157154897 TAGAAAGAAGAGCAACAGGCCGG - Intronic
1017728703 6:157295407-157295429 AAGAGTGAAGAGAAAGAACCAGG - Intronic
1017926584 6:158915898-158915920 GAAAATGAAGAGATGGAGGCCGG + Intergenic
1018386388 6:163307869-163307891 GAGAAAGAAAAGAAAGAGGCAGG - Intronic
1018441101 6:163814116-163814138 GAGAAGAAAGAGAAAGTGGTGGG - Intergenic
1018616075 6:165688154-165688176 GAGGAGGAAGAGATAGAGGGTGG - Intronic
1018861200 6:167712123-167712145 GAGAATGGAGAGATAGGGCCTGG + Intergenic
1019088493 6:169503126-169503148 CAGAGTGACGAGAAAGAGGCAGG + Intronic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019419795 7:945719-945741 GAGGAGGGAGGGAAAGAGGCTGG - Intronic
1019808777 7:3149084-3149106 GAGAAGGAAGAGAAAGAACGGGG + Intronic
1019964136 7:4484941-4484963 GAGAAGAGAGAGAAAGAGGAGGG + Intergenic
1020035832 7:4962555-4962577 GAGAAGGAAGAGGAGGAGGAGGG + Intergenic
1020088718 7:5325226-5325248 AAGAAGAAAGGGAAAGAGGCTGG - Exonic
1020390500 7:7652595-7652617 GAGAAGTAGGATAAAGAGGCAGG + Intronic
1020526847 7:9273019-9273041 GAAACTGACTAGAAAGAGGCAGG - Intergenic
1020595001 7:10195453-10195475 GAGAAAAAAAAGAAAGAGACAGG - Intergenic
1021130833 7:16911789-16911811 GAGAAGGTAGAGAAAAAGACAGG - Intergenic
1021382240 7:19982377-19982399 AAGGATGTAGAGAAAGAGGTAGG - Intergenic
1021408275 7:20299346-20299368 GAGAGAGAAGAAAAAGAAGCTGG + Intergenic
1021480651 7:21111938-21111960 GAGATGGAAGAGAAAGGGGAGGG - Intergenic
1021728140 7:23569873-23569895 GAGAAAGTAGAGAAAGAGATAGG - Intergenic
1021921446 7:25489527-25489549 AAGAATGAAGAGCAAGGGCCGGG + Intergenic
1022117478 7:27274944-27274966 GAGAAGGAAGAGAAGGGGGAAGG + Intergenic
1022357013 7:29625663-29625685 AAGAAAGAAGAGAGAGAGGAAGG + Intergenic
1022405459 7:30085829-30085851 GAGAAGGAAGAAGAAGAAGCTGG + Intronic
1022467617 7:30662144-30662166 GAGAATGAACAGTAAGTGGATGG - Exonic
1022845619 7:34206892-34206914 GAGAAAAAAGAGAAAATGGCAGG + Intergenic
1022849495 7:34245849-34245871 GAAAATGAGGAACAAGAGGCTGG + Intergenic
1022994324 7:35738832-35738854 GAGAGAGGAGAGAGAGAGGCGGG + Intergenic
1023027110 7:36060849-36060871 GAGAGAGAAGAGAGAGAGACAGG + Intergenic
1023149058 7:37182583-37182605 GAGAGAGAAGAGAGAGAGGAGGG - Intronic
1023149145 7:37183407-37183429 GACAATGAGGAGGAAGAGGCAGG + Intronic
1023233968 7:38064718-38064740 GAGAATGAGGGGAAAGAGAGAGG + Intergenic
1023240609 7:38142544-38142566 GAGAATGGAGAGGCTGAGGCAGG + Intergenic
1023533416 7:41183047-41183069 GAGAAAGAAAAGAGAGAGGGAGG - Intergenic
1023572602 7:41587988-41588010 GAGACTGAAGACAGAAAGGCTGG + Intergenic
1023655928 7:42420831-42420853 GAGAAAGAGGAGAAAGAGGGAGG + Intergenic
1023656165 7:42423045-42423067 GAGAATGCAGAGAAAGAGACAGG - Intergenic
1023880235 7:44314286-44314308 GAGAATGGATGGAAAGAGGATGG - Intronic
1024009198 7:45253318-45253340 GAGAGAGAAGAGAAGGAGACAGG - Intergenic
1024066786 7:45744224-45744246 GAGAAGCAAGAGAGAGAAGCGGG + Intergenic
1024121706 7:46248613-46248635 GAGAGTGAAGATGAAGAGGAGGG - Intergenic
1024127284 7:46312435-46312457 GAGAAGGAAAAGGAAGAGGGGGG + Intergenic
1024146635 7:46523525-46523547 GGGAAAGGAGAGAAAGAGGGGGG - Intergenic
1024168259 7:46756739-46756761 GAGAAGGGAGAGAAGGAGGAAGG + Intronic
1024256570 7:47544189-47544211 GAGCAGGAAGAGTCAGAGGCTGG + Intronic
1024258899 7:47559558-47559580 GAGAATGGAGAACAAGAGGCAGG + Intronic
1024456321 7:49611659-49611681 GAGAATTAAGAAAAAAATGCTGG + Intergenic
1024481095 7:49864250-49864272 GAGAAAGAAGACAAAGAAGGAGG + Intronic
1024497523 7:50065366-50065388 GAGAATCAAGAGAAAGGGTTTGG + Intronic
1024517983 7:50276596-50276618 GAGAAAGAAAAAAAAGAGGAAGG + Intergenic
1024691591 7:51808947-51808969 AAAAAGGAAGAAAAAGAGGCAGG - Intergenic
1025045793 7:55691000-55691022 GAGAAAGAAAGGAAAGAGGAAGG + Intergenic
1025236235 7:57236627-57236649 GAGGAATAAGAGAAAGAGGAGGG - Intergenic
1025828511 7:65030438-65030460 GAGGATGAAGAGGAAGAAGGAGG + Intergenic
1025887756 7:65614442-65614464 GAGGAGGAAGAGAAAGAAGGAGG - Intergenic
1026592863 7:71711781-71711803 GAGACAGAAGAGAAAGAGACAGG - Intronic
1026598433 7:71753300-71753322 GAAAAAAAAGAGAAAGAAGCTGG - Intergenic
1026760500 7:73122598-73122620 GAAAAAAAAAAGAAAGAGGCTGG + Intergenic
1026809316 7:73449028-73449050 GAGAATGGAGAGCAAGAAACTGG + Intronic
1026837605 7:73648802-73648824 GAGAAAGGAGAGAGAGAGGAGGG - Intergenic
1026855051 7:73747935-73747957 GAAAAAGAAAAAAAAGAGGCTGG - Intergenic
1026955024 7:74371630-74371652 GGGAATGGAGAGAGAGAGGGAGG + Intronic
1027036842 7:74931419-74931441 GAAAAAAAAAAGAAAGAGGCTGG + Intergenic
1027086721 7:75270040-75270062 GAAAAAAAAAAGAAAGAGGCTGG - Intergenic
1027176423 7:75906643-75906665 GACAATGAAGAGAGCCAGGCGGG + Intronic
1027416922 7:77983520-77983542 GAAAAAGAAGGGAAAGAGGGAGG - Intergenic
1027487853 7:78784353-78784375 GAGAATGAGGAGCAAGAGACAGG - Intronic
1027539962 7:79453945-79453967 GTGAAGGCAGAGAGAGAGGCAGG + Intergenic
1027589920 7:80105690-80105712 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
1027743419 7:82041236-82041258 GAGAAGGAAGAAAAAGATGCAGG + Intronic
1027784686 7:82566105-82566127 AAGAAAGAGGAGAAAGTGGCCGG - Intergenic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028076218 7:86518787-86518809 GAGAATTAATAGAAAGTGGATGG - Intergenic
1028339205 7:89696624-89696646 GAGAAGGTAGAGAAAGAGATAGG + Intergenic
1028950397 7:96629232-96629254 GAGAAGGTAGAGAAAAAGACGGG - Intronic
1029234144 7:99099264-99099286 GAGAAGGAATGGAGAGAGGCAGG + Intronic
1029316334 7:99717935-99717957 GAGAGTGGAGACAGAGAGGCAGG + Intronic
1029450111 7:100636749-100636771 GAGAGGGAAGAGAAAGTGGGGGG - Intronic
1029840483 7:103357814-103357836 GACAATCAAGAGAAAGTGGGAGG - Intronic
1029873607 7:103723234-103723256 GAGAAAGAGGAGAAAGATGCTGG + Intronic
1029957507 7:104655019-104655041 AAGGAAGAAGGGAAAGAGGCAGG - Intronic
1030102826 7:105961539-105961561 GAGAAAGAAGTGAAAGAAACTGG - Intronic
1030528123 7:110677990-110678012 GAGGATGAAGAAAATGATGCTGG - Intronic
1030562007 7:111099901-111099923 GAGAAAGAAGAGGAAGATGTTGG + Exonic
1030961450 7:115928528-115928550 GTGAATGAAGAGAACGAAACAGG + Intergenic
1031014901 7:116562891-116562913 AGGAAGGAAGAGAAAGAGGAAGG + Intergenic
1031018963 7:116605998-116606020 AAGAAAGGAGAGAAAGAGGAAGG + Intergenic
1031023270 7:116651288-116651310 GAAAAGGAAGATAAAGAAGCAGG + Intergenic
1031154769 7:118096543-118096565 GAGAAGGAAGAAAAAGAAGAAGG - Intergenic
1031328952 7:120438815-120438837 GAAAATGAAAAGAAACAAGCTGG - Intronic
1031351642 7:120739221-120739243 GAGAATGAAGGGAGGGAGGGAGG + Intronic
1031630200 7:124034478-124034500 GGGAAGGAGGAGAAAGAGGGAGG - Intergenic
1031644240 7:124203646-124203668 GAGCTTGAAGGGAATGAGGCAGG + Intergenic
1031789444 7:126082533-126082555 GAGAAGGAGGAGGAAGAGGAGGG - Intergenic
1031794157 7:126150115-126150137 GGGAAGGAGGAGAAAGAGGGAGG + Intergenic
1031894610 7:127334817-127334839 GAAGATGCAGAGAAAGAGGAAGG + Intergenic
1032114270 7:129103582-129103604 CAGCATGAAGAAAAAGAGGAAGG - Intergenic
1032466793 7:132151238-132151260 GAGGATGAAGAGGAAGAAGAAGG + Intronic
1032523275 7:132561942-132561964 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1032707210 7:134431821-134431843 CAGGAAGAAAAGAAAGAGGCTGG + Intergenic
1032716397 7:134512574-134512596 GAGAATGAGGGGCAAGAGACAGG + Intergenic
1032719346 7:134538016-134538038 GTGAAGGGAGAGAAAGAGGTGGG + Intronic
1032724315 7:134576785-134576807 GTGAAGGGAGAGAAAGAGGTGGG + Intronic
1032765075 7:134984003-134984025 GAGGAAGAAGAGGAAGAGGAAGG - Intergenic
1033065572 7:138150619-138150641 GAGAAGGAGGAGGAAGAGGAAGG + Intergenic
1033255536 7:139798222-139798244 CAGAAGGAAAAGAAAGAAGCCGG + Intronic
1033489052 7:141823710-141823732 GAGAAGGTAGAGAAAGAGATAGG - Intergenic
1033610832 7:142961889-142961911 GAGAAGGAGGAGAGAGAAGCTGG + Intronic
1033904000 7:146178756-146178778 TAGAATGAAGAGAAACAAACAGG + Intronic
1034016560 7:147593996-147594018 GAAGATGAAGAGACAGACGCAGG + Intronic
1034063290 7:148112738-148112760 GAGAATATAGAGAAAGGGGCTGG + Intronic
1034353253 7:150430954-150430976 GAAGATGAAGAGAAAAAGCCAGG + Intergenic
1034386001 7:150741830-150741852 GAGAATTATTAGAAAGAGGCAGG - Intronic
1034457494 7:151178967-151178989 GGGAAGGAGGAGGAAGAGGCAGG - Intronic
1034546078 7:151790226-151790248 GAGCAGGAAGAGCAAGAGGAAGG - Intronic
1034986430 7:155518286-155518308 GAGGAGGAAGAGGAAGAGGGTGG + Intronic
1035063549 7:156088850-156088872 GAAAATGAAGAGACAGAGGAGGG + Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035117139 7:156533983-156534005 GAGAATGAAGAGATCGATCCCGG + Intergenic
1035535845 8:390908-390930 GAGAATGAAGTGATAGAGGAGGG - Intergenic
1035627868 8:1087309-1087331 GCGGATGAAGGGAAAGAGTCTGG - Intergenic
1035670373 8:1412342-1412364 GAGATGGAGGAGAAAGAGCCCGG - Intergenic
1035775755 8:2186825-2186847 GAGGATGAGGACAAAGAGACAGG + Intergenic
1035901267 8:3460602-3460624 GAGAATGAAGATAAACAGGAGGG + Intronic
1035992763 8:4510771-4510793 GGGAAGGAAGAGAAAGGGGAAGG - Intronic
1036942792 8:13067532-13067554 GAGGATGAAGAGAAAGCAGTGGG - Intergenic
1037126715 8:15360681-15360703 GAAAATCAAGACCAAGAGGCAGG + Intergenic
1037183782 8:16037194-16037216 GAGTATGAACAGAGAAAGGCAGG + Intergenic
1037209836 8:16373362-16373384 GAGAAAGAAAAGAAGGAGGATGG - Intronic
1037702076 8:21284454-21284476 GAGGATGAAGAGGAAGAGCAGGG + Intergenic
1037734389 8:21555072-21555094 GAGTAAGAAGAGAGAAAGGCAGG + Intergenic
1037929958 8:22873116-22873138 GAGTATAAAGAGAAAGGGGCTGG + Intronic
1038067122 8:23974777-23974799 GAAAAGGAGGAGAAAGAGGGAGG + Intergenic
1038070298 8:24006028-24006050 GAGAATGAAGTAAAAGTTGCAGG + Intergenic
1038234321 8:25737198-25737220 GAAGAGGAAGAGAAAGAGGAGGG - Intergenic
1038399115 8:27269558-27269580 GAGATTGATGAGGAAGGGGCTGG + Intergenic
1038483602 8:27918599-27918621 GAGAAGGAGGAGGAAGAGGAGGG + Intronic
1038662766 8:29511468-29511490 CAGAATGAAGGGAAAGAGAAAGG + Intergenic
1038715451 8:29986990-29987012 AAAAAAGAAAAGAAAGAGGCTGG + Intergenic
1038967625 8:32593096-32593118 GAGGAGGAAGAGGAAGAGGCGGG + Intronic
1039118565 8:34119967-34119989 GAGAAAGAAGAGAAGGAGAAGGG - Intergenic
1039205495 8:35148752-35148774 TCGAATTAAGAGAAAAAGGCCGG + Intergenic
1039314537 8:36356738-36356760 GAGAAAGAAGGGAAGGAGGCAGG + Intergenic
1039340112 8:36638741-36638763 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1039562350 8:38522801-38522823 GAGAAAGAAGAGAGAGAGGAAGG - Intronic
1039764422 8:40613105-40613127 GAGAATGACTGGATAGAGGCCGG - Intronic
1039785362 8:40829979-40830001 TAGATGGAAGAAAAAGAGGCTGG + Intronic
1039820407 8:41129567-41129589 GAGAATGAAGAAAAGCAGGTGGG + Intergenic
1039883610 8:41642720-41642742 CAGAAAGTAGACAAAGAGGCCGG - Intergenic
1040002346 8:42588494-42588516 GAAAATAAAGAAACAGAGGCTGG + Intergenic
1040750602 8:50701693-50701715 GAAGATGAAGAGGAAGAGGAAGG - Intronic
1040773174 8:51004327-51004349 GATAAAAAAGATAAAGAGGCAGG + Intergenic
1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG + Intronic
1041142757 8:54840732-54840754 AAGGATGAACAGAAAGATGCAGG - Intergenic
1041312952 8:56535012-56535034 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1041362334 8:57066746-57066768 AAGAATGACGAGAATGGGGCTGG - Intergenic
1041369634 8:57145000-57145022 GAGAATCAAGAGAAGGAGACAGG + Intergenic
1041557670 8:59176075-59176097 GTGAAAGAAGAGAAAGATGATGG + Intergenic
1041593528 8:59619767-59619789 GAGAAGGAAGGGAGAGAGGATGG - Intergenic
1041871052 8:62634752-62634774 AACAAAGAAGAGAAAGAGGAGGG + Intronic
1041904142 8:63013196-63013218 AAGAATGAACAGAAACAGGAAGG - Intergenic
1042420251 8:68580282-68580304 GAAGATGAAGTGAAAGGGGCAGG + Intronic
1042701421 8:71618961-71618983 GAGGCTGAAGAGAAAGAGGAGGG - Intergenic
1043186278 8:77154617-77154639 AAGAAAGCAGAGTAAGAGGCAGG - Intergenic
1043281474 8:78472228-78472250 GAGGATGTAGAGTAAGAGGAGGG + Intergenic
1043475039 8:80597813-80597835 GAAAAGGGAGAGAAAGAGGAAGG - Intergenic
1043802482 8:84627624-84627646 GAGAAAGAAGTGAAAGAGACAGG - Intronic
1044018462 8:87074720-87074742 GAGAATGAAGAAAAGCAGGGTGG - Intronic
1044113234 8:88302861-88302883 GAGAATGAAGAAAAGCAGGGAGG + Intronic
1044354782 8:91208443-91208465 GAGAATGAAAAGAAACATTCAGG + Intronic
1044428995 8:92086816-92086838 GAGAAGGAAGAGGCAGGGGCAGG - Intronic
1044447682 8:92297463-92297485 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1044458057 8:92412018-92412040 GAGAAGGAAGGGAAGGAGGAGGG + Intergenic
1044489293 8:92793142-92793164 GGGAAGACAGAGAAAGAGGCTGG - Intergenic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044584374 8:93855961-93855983 AAGAATGATGAGGAAGAGGATGG - Intergenic
1044701027 8:94965340-94965362 GGGAATGAGGAAGAAGAGGCTGG + Intronic
1044773149 8:95658928-95658950 GAGAAGGAAGGGAAAGTGGAGGG - Intergenic
1044888524 8:96806780-96806802 GAGAAGGAAGAGAATGAGATGGG + Intronic
1045567855 8:103339652-103339674 GGGACTGAAGAGAAAGAAGCAGG - Intergenic
1045737952 8:105318584-105318606 AAGAAGGAAGAGAAGGAGGGAGG - Intronic
1045816486 8:106282722-106282744 GAGAAGGAGGAGAAAGAAGAGGG + Intronic
1045836546 8:106528100-106528122 GAGAAAGAAAGGAAAGAGGGAGG - Intronic
1045887245 8:107113239-107113261 CAGAAGGAAGAAAAAGAGGTGGG + Intergenic
1046001543 8:108426423-108426445 GAGGATGAGGAAATAGAGGCAGG - Intronic
1046346704 8:112938293-112938315 AAGAATAAAGAGAAAGTTGCAGG - Intronic
1046401677 8:113712910-113712932 GAGAATCAAGTAAAAGAAGCAGG + Intergenic
1046731833 8:117734423-117734445 AAAACAGAAGAGAAAGAGGCAGG + Intergenic
1046906843 8:119582608-119582630 GAAAATTAAGAAAAGGAGGCAGG + Intronic
1046999641 8:120561029-120561051 GAAACAGAAGGGAAAGAGGCTGG + Intronic
1047441330 8:124880980-124881002 CAGAATGAAGATTAAGAGGGTGG - Intergenic
1047518690 8:125577794-125577816 GAGAAAGAAGAGAAAGGAGGAGG - Intergenic
1047595971 8:126378315-126378337 GAGAAGGAAGAAAAGGAGGAAGG - Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1047983850 8:130212445-130212467 GAGCATGAGGTGACAGAGGCAGG + Intronic
1048220096 8:132533183-132533205 GAGGAGGATGAGAAAGAGGAAGG + Intergenic
1048554745 8:135463929-135463951 GAGAATGCACAGAAAGCAGCTGG - Intronic
1048623609 8:136160964-136160986 AAGAAAGAAGAGTTAGAGGCCGG + Intergenic
1048629022 8:136220350-136220372 GAGAAGGAACAGAAAGAGAAGGG + Intergenic
1048630435 8:136236458-136236480 GAGAGTGAAGAGAAAGAGGAGGG - Intergenic
1048734754 8:137486838-137486860 GAGAAGGAAAAGAAAGAAGGAGG - Intergenic
1048755908 8:137737961-137737983 GAGAAGGAAGAAAGAGAGGCAGG + Intergenic
1048762490 8:137810807-137810829 GGGAATGGAGAGGAAGAGGTTGG + Intergenic
1049316171 8:141969527-141969549 GAGAATTTAGAGAAAAAGCCTGG - Intergenic
1049581628 8:143414124-143414146 GAGAAAGGAGAGAAAAAGGTGGG + Intergenic
1049897236 9:119406-119428 AAGAATGAAGAGCCAGAGCCAGG - Intergenic
1050367520 9:4886131-4886153 GAGACTAACCAGAAAGAGGCAGG - Intergenic
1050439071 9:5641516-5641538 GAGGAAGTAGAGAAAGAGACCGG - Intronic
1050831170 9:10015710-10015732 CAGAAAGAAGAGAAAGAGGTGGG + Intronic
1050847418 9:10239823-10239845 GAGACTGAGGGGCAAGAGGCAGG - Intronic
1051318178 9:15866445-15866467 TATGATGATGAGAAAGAGGCAGG + Intronic
1051729615 9:20126826-20126848 GAGAATGTAGTGCCAGAGGCAGG + Intergenic
1052051293 9:23851521-23851543 GAAAGGGAAGAGAGAGAGGCGGG - Intergenic
1052142188 9:25000966-25000988 GAGAATGAGGAGGAACAGGAGGG + Intergenic
1052176884 9:25473007-25473029 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1052305684 9:27006675-27006697 GAGGAGGAAGGGAAGGAGGCAGG + Intronic
1052431911 9:28377247-28377269 GAGAAGGCAGAGGAAGAGGAGGG - Intronic
1052648304 9:31267684-31267706 GAGAAAGAAGAGAGAAAGGAGGG - Intergenic
1052802121 9:32978479-32978501 GAGAATGAGGGGCAAGAGACGGG + Intronic
1053185120 9:36009469-36009491 AAGAAGGAAGGGAAAGAGGAAGG + Intergenic
1053185402 9:36012150-36012172 GAGAATGAAGAGAAGACGGGAGG + Intergenic
1053273409 9:36765808-36765830 GAGAATGCACAGAAAGAAACCGG + Intergenic
1053580533 9:39399419-39399441 GAGGAAGAAGGGAAAGAGGAAGG - Intergenic
1053606677 9:39666978-39667000 GAGAATGAAATGAATGAGGAGGG + Intergenic
1053740338 9:41129671-41129693 AAGAATGAAGAGCCAGAGCCAGG - Intergenic
1053749661 9:41239246-41239268 GATGATGTAGAGAAAGAGGCAGG - Intergenic
1053845029 9:42227497-42227519 GAGGAAGAAGGGAAAGAGGAAGG - Intergenic
1053864596 9:42423605-42423627 GAGAATGAAATGAACGAGGAGGG + Intergenic
1053904440 9:42826761-42826783 GACAAGGAGGAGAAAGAGGGTGG + Intergenic
1054102120 9:60958224-60958246 GAGGAAGAAGGGAAAGAGGAAGG - Intergenic
1054246858 9:62675426-62675448 GAGAATGAAATGAATGAGGAGGG - Intergenic
1054255158 9:62803505-62803527 GAAGATGTAGAGAAAGAGGCAGG - Intergenic
1054255165 9:62803583-62803605 GAAGATGTAAAGAAAGAGGCAGG - Intergenic
1054336145 9:63812023-63812045 GAAGATGTAAAGAAAGAGGCAGG + Intergenic
1054336152 9:63812101-63812123 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
1054443303 9:65285664-65285686 AAGAATGAAGAGCCAGAGCCAGG - Intergenic
1054530545 9:66178753-66178775 GACAAGGAGGAGAAAGAGGGTGG - Intergenic
1054560979 9:66709960-66709982 GAGAATGAAATGAATGAGGAGGG - Intergenic
1054584239 9:66948639-66948661 GAGGAAGAAGGGAAAGAGGAAGG + Intergenic
1054688011 9:68301642-68301664 AAGAATGAAGAGCCAGAGCCAGG + Intergenic
1054702831 9:68431297-68431319 GAGAATGCGAAGAAAGAGGTAGG - Intronic
1054739228 9:68787927-68787949 TAGAAAGATTAGAAAGAGGCTGG - Intronic
1054799468 9:69333036-69333058 GAGAGAGAAAAGGAAGAGGCAGG + Intronic
1055084992 9:72304926-72304948 GAAAAGGAAGAGAGGGAGGCTGG - Intergenic
1055166314 9:73199658-73199680 GAGGAGGAAAAGAAAAAGGCAGG + Intergenic
1055300028 9:74873090-74873112 TAGAATGTAGAGATGGAGGCAGG - Intronic
1055438062 9:76312105-76312127 AAGAATGGAGAGAGGGAGGCAGG + Intronic
1055462977 9:76536863-76536885 TAGAAAGAAGAGAAAGAGAGAGG + Intergenic
1055956258 9:81776376-81776398 GAAAAGGAAGAGAAGGAAGCAGG + Intergenic
1056017391 9:82404587-82404609 AAGAATGAAAACAAAGAGGATGG + Intergenic
1056523338 9:87420300-87420322 GAGAAGGAGGAGGAAGAGGAGGG - Intergenic
1056637360 9:88342340-88342362 GAGAATGAAGAGATAAACCCTGG + Intergenic
1056652637 9:88481105-88481127 GAAAATAATGAGAAAGAGGATGG - Intergenic
1056778078 9:89528575-89528597 GAACATGAAGAGGGAGAGGCTGG + Intergenic
1056856507 9:90134486-90134508 AAAAAGGAAGAGAAAGAGCCCGG - Intergenic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1057105172 9:92408108-92408130 GAGAATGAAGATGAAGATGGGGG - Intronic
1057292817 9:93818218-93818240 GGGAAGGAAGAGAAAGAGGGAGG + Intergenic
1057292886 9:93818477-93818499 AAGAAGGAAGGGAAAGAGGGAGG + Intergenic
1057477113 9:95412124-95412146 GTGAAGGAAGAGAAAGAGGCAGG + Intergenic
1057480363 9:95440553-95440575 GAGAAGGAAGAAAAACAGGGAGG + Intergenic
1057537334 9:95925184-95925206 GACACTCAAGAGAAAGAGGTGGG - Intronic
1057814121 9:98281516-98281538 GAGAAGGAAGAGAGACAGGAAGG - Intergenic
1058300797 9:103370250-103370272 TAGAAATAAGAAAAAGAGGCCGG + Intergenic
1058569576 9:106326236-106326258 GAGAATCAAGAGAGGGAGGGAGG + Intergenic
1058875874 9:109244400-109244422 GAGAAAGAAGAGAAGGAAGGAGG + Intronic
1059174404 9:112155926-112155948 AAGAAGGAAGAGAAGGAGGAAGG + Intronic
1059220693 9:112615123-112615145 AAAAATGAAGAGGAGGAGGCCGG + Intronic
1059510111 9:114837039-114837061 GAGAATGAAGAAAACCAGGGTGG - Intergenic
1059619343 9:115986430-115986452 GAAAATGGAGAGAGAGAAGCAGG + Intergenic
1059648271 9:116288478-116288500 GAGAAGGAAGAAAGGGAGGCAGG - Intronic
1059679463 9:116572183-116572205 GAGAAGGCAGGGAGAGAGGCTGG - Intronic
1059890394 9:118795621-118795643 GAGAATTAAAAGGCAGAGGCAGG - Intergenic
1060199467 9:121644200-121644222 GAGGAAGAAGAGGAAGAGGAAGG + Intronic
1060844492 9:126825235-126825257 AAGAATGAAGAAAAATGGGCTGG - Intronic
1061345554 9:130022153-130022175 TAAAAAGAAGAGAAAGAGGCTGG - Intronic
1061738817 9:132684100-132684122 GAGAATGAAGAGTCAGAGACAGG - Intronic
1061883270 9:133578515-133578537 AAAAATGGAGAGAAAGAGGCTGG + Exonic
1062071378 9:134556768-134556790 CAGAATGTATAGAAAGAGCCAGG - Intergenic
1062080825 9:134622529-134622551 GAAAGAGAAGAGAAAGAGGAGGG - Intergenic
1062080855 9:134622630-134622652 GGGAAAGAAGAGAAAGAGGAGGG - Intergenic
1062080886 9:134622729-134622751 GAAAGAGAAGAGAAAGAGGAGGG - Intergenic
1062080917 9:134622830-134622852 GGGAAAGAAGAGAAAGAGGAGGG - Intergenic
1062670318 9:137704966-137704988 GAAAAGGAAGAGAGAGAGGGAGG - Intronic
1062744648 9:138203574-138203596 GACAAGGAAGAGAATGAGGAGGG + Intergenic
1203372418 Un_KI270442v1:321245-321267 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
1203376078 Un_KI270442v1:379441-379463 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
1203376084 Un_KI270442v1:379519-379541 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
1185486809 X:487797-487819 GAGAAAGAGAAGAAAGAGACAGG + Intergenic
1185492360 X:527346-527368 GAGAAAGAAAGGAAAGAGGAAGG - Intergenic
1185492366 X:527411-527433 GAGAAAGAAAGGAAAGAGGAAGG - Intergenic
1185492377 X:527541-527563 GAGAAAGAAAGGAAAGAGGAAGG - Intergenic
1185492450 X:528241-528263 GAGAAAGAAAGGAAAGAGGAAGG - Intergenic
1185492463 X:528375-528397 GAGAAAGAAAGGAAAGAGGAAGG - Intergenic
1185662062 X:1735677-1735699 GAGGAGGGAGAGAAAGAGGAGGG - Intergenic
1185662065 X:1735692-1735714 GAGGAGGGAGAGAAAGAGGAGGG - Intergenic
1185665568 X:1762736-1762758 CAAAAAGAAGAAAAAGAGGCCGG - Intergenic
1185861545 X:3583975-3583997 GAAAAAGAAGAGAAACAGGAAGG + Intergenic
1185872165 X:3673421-3673443 GAGGATGAAAGGAGAGAGGCAGG + Intronic
1185872473 X:3675448-3675470 GAGAAGGAAGAGATGGAGGAGGG - Intronic
1185950294 X:4424807-4424829 GACAATGAAGAGACAGTGGCTGG + Intergenic
1186020065 X:5245128-5245150 AAGAAGGAAGGGAAAGAGGGAGG - Intergenic
1186060887 X:5705714-5705736 GAGGAAGAAGAGAGAGAGGAAGG - Intergenic
1186072098 X:5833137-5833159 GAGAGAGGAGAGAGAGAGGCAGG - Intergenic
1186102995 X:6176470-6176492 GAGATTCAAATGAAAGAGGCAGG + Intronic
1186107103 X:6219421-6219443 AAGAAAGAAGAGAAAAAGGAAGG - Intronic
1186159859 X:6765784-6765806 GAAAAAGAAGAGAAAGAGGTTGG + Intergenic
1186172411 X:6891441-6891463 GAGAATGGAAAGAAAGGGGAAGG - Intergenic
1186286041 X:8045187-8045209 GAGAATGAAGAGGAAATGGCAGG + Intergenic
1186288697 X:8072851-8072873 TATAATGAAAAGAAGGAGGCTGG + Intergenic
1186467805 X:9797680-9797702 GAGAAGGAAGAGCAAGTGGGGGG - Intronic
1186751631 X:12627500-12627522 GAGCCTGAGGAGAAAGAGGTTGG + Intronic
1186790595 X:12994220-12994242 GAGAAAGGAAAGAAAGAGGGAGG - Intergenic
1186908021 X:14132194-14132216 GAGAAAGAAGAGGAAAAGGCAGG + Intergenic
1186988422 X:15041081-15041103 GAGAAAAAAGAGAAAAAGGATGG - Intergenic
1187242738 X:17528344-17528366 GAGGAAGAAGAGAGAGAGGGAGG - Intronic
1187499853 X:19830787-19830809 GAGAAAGAAAAGAAAGAGAAGGG + Intronic
1187552957 X:20324205-20324227 GAGAGAGAAGAGAAGGAGGGAGG - Intergenic
1187912303 X:24122183-24122205 GAGCATGAACAGCAGGAGGCAGG + Intergenic
1187991773 X:24881908-24881930 GAGAATGATGAGAAAGGGCAGGG + Intronic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188260660 X:28019190-28019212 CAGGAGGAAGAGAAAGAGGGTGG + Intergenic
1188315808 X:28672343-28672365 GTGAATGAAAAGATAGAAGCTGG + Intronic
1188437480 X:30178913-30178935 GAAAAGGAAGAGAATGTGGCAGG - Intergenic
1188486449 X:30687375-30687397 GAAAAAGAAAAGGAAGAGGCAGG - Intronic
1188846123 X:35075026-35075048 GAGAAGGTAGAGAAAGAAGTGGG - Intergenic
1188930052 X:36097904-36097926 GAGGAGGTAGAGAAAGAGCCGGG - Intronic
1189282596 X:39829313-39829335 GAGCATGAAGAAAAAGATGGTGG - Intergenic
1189388575 X:40557243-40557265 GAGAAAGAAGGGAGAGAGGGAGG - Intergenic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190104989 X:47553534-47553556 AAAAATGAAGAGGAAGAGGTGGG - Intergenic
1190110274 X:47585028-47585050 GAAAATGCTGGGAAAGAGGCGGG - Intronic
1191108382 X:56786603-56786625 GAGAAGGAGGAGAAAGAAGAAGG - Intergenic
1191781719 X:64875519-64875541 GAGGAGGTAGAGAAAGAGACAGG + Intergenic
1191832576 X:65430853-65430875 GAGAATGAAGAAAAGCAGGATGG - Intronic
1191955437 X:66638663-66638685 GATAAAGAAGAGAAGGAGGCTGG - Intronic
1192088203 X:68122897-68122919 GAGGAGGTAGAGAAAGAGACAGG + Intronic
1192143956 X:68668213-68668235 GAGAAAAAAGAGAAAGAAGAAGG - Intronic
1192202941 X:69078425-69078447 AAGAAAGAAGAGAAGGAGGTGGG - Intergenic
1192292666 X:69814693-69814715 GAGAATGAAGAAAAGCAGGATGG + Intronic
1192330547 X:70171968-70171990 GAATATGAAAAGAAAGGGGCTGG - Intergenic
1192360666 X:70436792-70436814 AAAAATGAAGAGAGAGAGGGTGG + Intergenic
1192449598 X:71235692-71235714 GAGAAAGAAGGGAGACAGGCAGG - Intergenic
1192461635 X:71322054-71322076 TAGTTTGAAGAGAAAGAGGAAGG + Intergenic
1192503005 X:71665512-71665534 GAGGATGAAGAGGGAGAGGAGGG + Intergenic
1192567335 X:72176147-72176169 GAGAATGTGGAGAAATAGGAAGG + Intergenic
1192709286 X:73563186-73563208 CGAAATGAAGAGAAAGAGGAGGG - Exonic
1192779176 X:74276933-74276955 CAGAAAGAAGAGTAAGAGGAGGG + Intergenic
1192855806 X:75010636-75010658 GAGAATGTAGAGAAAGAGGTAGG - Intergenic
1192897400 X:75458937-75458959 GAGAATGAAGAAAAGCAGGGTGG + Intronic
1193046469 X:77059905-77059927 AGGAAGGAAGAGAAAGAGGAGGG + Intergenic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1193366048 X:80635700-80635722 GAGGAGGTAGAGAAAGAGGTAGG - Intergenic
1193650532 X:84125556-84125578 AAAAATAAAGAGAAAAAGGCTGG + Intronic
1193673719 X:84420538-84420560 GAGAAAGTAGAGAAAGAGATAGG + Intronic
1193683582 X:84551559-84551581 GAGGAAGTAGAGAAAGAGACAGG - Intergenic
1193851506 X:86543139-86543161 AAGAATGAGGACACAGAGGCAGG + Intronic
1193915626 X:87358848-87358870 GAGGAAGTAGAGAAAGAGGTAGG + Intergenic
1193980734 X:88179315-88179337 GAGGAAGGAGAGAAAGAGACGGG - Intergenic
1194079404 X:89439932-89439954 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1194347823 X:92787395-92787417 TAGAAGCAAGAGAGAGAGGCAGG + Intergenic
1194398610 X:93415889-93415911 GAGGATGTAGAGAAAGAGATAGG + Intergenic
1194418231 X:93638920-93638942 CAAAATGAAGAGAGAGAGGAGGG - Intergenic
1194506492 X:94739524-94739546 GAGAATGAAGAAAAACAAGGTGG - Intergenic
1194771145 X:97907384-97907406 GAACATGAAGAAAAACAGGCTGG + Intergenic
1194780644 X:98021868-98021890 GAGAAAGTAGAGAAAGAGATAGG - Intergenic
1195349761 X:103985150-103985172 GGGGAGGAAGAGGAAGAGGCAGG - Intergenic
1195357682 X:104053689-104053711 GGGGAGGAAGAGGAAGAGGCAGG + Intergenic
1195515623 X:105772219-105772241 GAGGAGGGAGAGAAATAGGCAGG + Intergenic
1195702881 X:107717848-107717870 GAGACTAAAGAGAAAAGGGCTGG - Intronic
1195750379 X:108157885-108157907 TAAAGTGAAGAGAAACAGGCAGG - Intronic
1195870543 X:109480943-109480965 GAGAAGGAAGGAAAAGAGGAAGG + Intronic
1195907263 X:109856761-109856783 GAGAAGGCAGAGAGAGAGGATGG + Intergenic
1195910428 X:109883660-109883682 AAAAAAGAAGAGAAAAAGGCTGG - Intergenic
1195997834 X:110749012-110749034 GAGAATGAAAATAAAAAGGAAGG + Intronic
1196018149 X:110961227-110961249 GAAAATGAAGAGGCAGATGCTGG - Intronic
1196196023 X:112839726-112839748 GAAAATGAAGAGAAAGAAAAGGG - Intronic
1196270700 X:113707091-113707113 GAAAAACAAGAGAAAGAAGCAGG - Intergenic
1196316969 X:114238306-114238328 GAGAATGTGGAGAAATAGGAAGG - Intergenic
1196399372 X:115298388-115298410 GAGGATGTAGAGAAAGAGATAGG - Intronic
1196573967 X:117296935-117296957 GAGAATGAAGAGTGGGAGGAGGG - Intergenic
1196609736 X:117697282-117697304 GAGGATGCAGAGAAAGAGATGGG + Intergenic
1196743498 X:119046555-119046577 GAGCAAGAAAAGAGAGAGGCCGG - Intergenic
1196784527 X:119410341-119410363 GACCGTGAAGAGAAAGATGCAGG + Exonic
1196867245 X:120081359-120081381 GAGAATCAAGAGAAAGGGTTTGG + Intergenic
1196875854 X:120154923-120154945 GAGAATCAAGAGAAAGGGTTTGG - Intergenic
1196964184 X:121037817-121037839 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1197014735 X:121609764-121609786 AAGAATGAAGGGAGAGAGGGAGG + Intergenic
1197133288 X:123030935-123030957 GAGAAAGATGAGAGAGAGGCAGG - Intergenic
1197180767 X:123533661-123533683 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1197195347 X:123694316-123694338 TAGAAAGAACAGAAAGGGGCTGG + Intronic
1197246234 X:124169848-124169870 AAGAATGTAGAGAAACAGGAAGG + Intronic
1197435511 X:126423743-126423765 GAGGAGGCAGAGAAAGAGACAGG - Intergenic
1197861623 X:130977450-130977472 GAGAATAAAGTGCAAGATGCTGG + Intergenic
1197882470 X:131181349-131181371 CAGAAGGAAGAGAAACAGGAAGG - Intergenic
1197906098 X:131427352-131427374 GAGAAGGATGAGAAGGAGGAAGG - Intergenic
1198041740 X:132859695-132859717 AAGAATGAAGAAAAGAAGGCAGG + Intronic
1198105305 X:133455944-133455966 GAGAATGTAGATAAAGTGCCTGG - Intergenic
1198147346 X:133870646-133870668 TCAAGTGAAGAGAAAGAGGCAGG - Intronic
1198161995 X:134017224-134017246 GAGAGAAAAGAAAAAGAGGCTGG - Intergenic
1198442805 X:136680765-136680787 GATAATGAACTGCAAGAGGCAGG + Exonic
1198688538 X:139253824-139253846 GAGATGACAGAGAAAGAGGCAGG + Intergenic
1198706365 X:139452860-139452882 GAGAATGAAAAGAGAGATGATGG + Intergenic
1198753376 X:139957750-139957772 GAAAATGAAGAGAAAGAGAGAGG - Intronic
1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG + Intronic
1199128285 X:144152216-144152238 GAAAAGGAAGATAAAGGGGCAGG + Intergenic
1199250912 X:145660419-145660441 CAGGAGGAAGAGAAAAAGGCGGG - Intergenic
1199315218 X:146368936-146368958 GAGAAAGAAGAGAAAGAGAAGGG + Intergenic
1199358820 X:146893155-146893177 TAGAATTAAGAGGAATAGGCTGG - Intergenic
1199372721 X:147070050-147070072 GAGACTGGAGAGGAAGGGGCAGG + Intergenic
1199498918 X:148487643-148487665 GAGGATGAAGAGGAAGAGGAGGG - Intergenic
1199543473 X:148983216-148983238 GATAATAAAAAGAAAGAAGCTGG + Intronic
1199628349 X:149760179-149760201 GGGGATGAAGGGAAAGGGGCAGG - Intergenic
1199791289 X:151157535-151157557 GAGAAAGAACAGAAAGAGCTTGG + Intergenic
1199939935 X:152615216-152615238 GAAAATGAGGGTAAAGAGGCAGG + Intergenic
1200432022 Y:3095237-3095259 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1200656151 Y:5904031-5904053 TAGAAGCAAGAGAGAGAGGCAGG + Intergenic
1201065947 Y:10094060-10094082 GAAGATGTAGAGAAAGAGGCAGG - Intergenic
1201065954 Y:10094138-10094160 GAAGATGTAGGGAAAGAGGCAGG - Intergenic
1201417383 Y:13760988-13761010 GAGAATGAAAAGAAAATGGGAGG + Intergenic
1201453017 Y:14136382-14136404 GAGAAGGAAGAGAAAGAGTGAGG - Intergenic
1201553539 Y:15244275-15244297 GAAAAAAAAGAGAAAGAGGGTGG + Intergenic
1201741150 Y:17325709-17325731 GAGAAAGAGGAGAAAGAGAGAGG + Intergenic
1202071440 Y:20995862-20995884 GAGAATCAAGAGAAAGTGTTTGG - Intergenic
1202374423 Y:24220622-24220644 GAGAAGAAAGAGAAAGAGAGAGG + Intergenic
1202496357 Y:25449498-25449520 GAGAAGAAAGAGAAAGAGAGAGG - Intergenic