ID: 1125452782

View in Genome Browser
Species Human (GRCh38)
Location 15:39826393-39826415
Sequence TGGAGTAAAGACAGGACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125452778_1125452782 10 Left 1125452778 15:39826360-39826382 CCACTTCTGGAACAAGGTTGAGA 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1125452782 15:39826393-39826415 TGGAGTAAAGACAGGACCCCAGG 0: 1
1: 0
2: 2
3: 8
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125452782 Original CRISPR TGGAGTAAAGACAGGACCCC AGG Intronic
900433288 1:2612830-2612852 TGGAGAGAAGAGGGGACCCCAGG + Intronic
900691478 1:3983111-3983133 AGGAGTAAAGACAGGATGGCTGG + Intergenic
902161378 1:14533236-14533258 TGGGATAAACACAGTACCCCAGG + Intergenic
904825519 1:33271518-33271540 TGGAGTAAAGATTGGAACCCGGG + Intronic
905825082 1:41020999-41021021 GGGAGGGAAGACAGGACCCCTGG - Exonic
908822801 1:68105154-68105176 TGGAGGAAAGCCAGGAGCCAGGG + Intronic
908988934 1:70060945-70060967 TGAAGTAAAGACATAACTCCTGG - Intronic
908989121 1:70063488-70063510 TGAAGTAAAGACATAACTCCTGG + Intronic
911260082 1:95675277-95675299 TGGAGGCAAGGCAGGACCTCTGG - Intergenic
911754019 1:101531780-101531802 TGTAGTAAAGCCAGGACCCATGG - Intergenic
915525048 1:156470901-156470923 CAGAGCTAAGACAGGACCCCAGG + Intronic
917691691 1:177476561-177476583 TGGAGAAAAGACAGGAGCTTGGG + Intergenic
920352510 1:205346830-205346852 TGCAGTGAAGAAAGGAGCCCAGG + Intronic
921836074 1:219780021-219780043 TGGAGAAAGGACTGGACCCATGG + Intronic
922874493 1:228929223-228929245 TGGAATTAGGAAAGGACCCCAGG + Intergenic
923748759 1:236727349-236727371 TGGAGAAGAGAGAGGAACCCTGG + Intronic
1062827921 10:586014-586036 AGGATTAAAGGCAGGACTCCTGG + Intronic
1062985113 10:1761375-1761397 TGGATTATAGTCAGGACCCGGGG + Intergenic
1063366075 10:5491692-5491714 TGAAGGAGAGACAGGATCCCCGG - Intergenic
1064138271 10:12768935-12768957 TGTAGTGAAGACAGGAACACGGG + Intronic
1067094995 10:43294457-43294479 TGGGGTAACCACAGGACCTCAGG - Intergenic
1068300191 10:55128905-55128927 TGCAGTAAATACAGAACTCCTGG + Intronic
1068346559 10:55787464-55787486 GGGAGAAGATACAGGACCCCTGG + Intergenic
1068958257 10:62840865-62840887 TGGAGTAAAAACAGAATCCATGG - Intronic
1069797339 10:71061831-71061853 CGGAGTGAAGACCGGAGCCCAGG + Intergenic
1073619615 10:105033322-105033344 TTGAGTGAAGTCAGGACCTCTGG + Intronic
1073959697 10:108912211-108912233 TGGAGCCAAGAGAGGTCCCCGGG + Intergenic
1074818659 10:117163394-117163416 TCGAGGAAAGACAGGACCGGGGG - Intergenic
1076366044 10:129921693-129921715 TGGCCTGAAGAGAGGACCCCTGG + Intronic
1076693522 10:132236173-132236195 AGGAGCACAGAAAGGACCCCTGG + Intronic
1077352440 11:2099174-2099196 TGGAGTGGAGACCGGACCGCAGG + Intergenic
1077400254 11:2352118-2352140 TGGAGTCAAGGGAGGAACCCAGG - Intergenic
1077591073 11:3491420-3491442 TGGAGTGTAGGCAGGACCCGTGG + Intergenic
1077838312 11:5944897-5944919 AGGAGTGAAGAGAGGATCCCTGG + Intergenic
1078271945 11:9804042-9804064 TGGAGGCAGGAAAGGACCCCAGG + Intronic
1080231736 11:30023910-30023932 TGGAGCAAAGACAAGATCCTGGG + Intergenic
1081690423 11:45074195-45074217 TGGAGGAGAGAGAGGACCCCTGG - Intergenic
1082676193 11:56105956-56105978 TGCAGAGAAGACAGGACTCCAGG + Exonic
1082677436 11:56123286-56123308 TGCAGAGAAGACAGGACTCCAGG + Exonic
1082690003 11:56290130-56290152 TGCAGAGAAGACAGGACTCCAGG - Exonic
1083536278 11:63469413-63469435 TGGAGCAAAGAAAAGAGCCCTGG + Intronic
1083594549 11:63912640-63912662 TGGTGAGAAGAGAGGACCCCAGG - Intronic
1083617558 11:64034186-64034208 TGGAGGAATGACAGAGCCCCAGG + Intronic
1084246786 11:67863171-67863193 TGGAGTGTAGGCAGGACCCGTGG + Intergenic
1084614938 11:70229527-70229549 GGGAGGAAGGAGAGGACCCCAGG + Intergenic
1084647959 11:70471602-70471624 TGGAGTATAGACAGAACCCAGGG - Intronic
1084825892 11:71731321-71731343 TGGAGTGTAGGCAGGACCCATGG - Intergenic
1089665203 11:120013824-120013846 AGGAGTAAAGGCAGGAGCCGGGG - Intergenic
1092237210 12:6817618-6817640 TGGAGAAAAGCCAGGAGCCAGGG - Intronic
1096644680 12:53025265-53025287 TGGACTCAAAACAGGACCCTTGG - Intronic
1096646777 12:53042799-53042821 TGGAGCATAGAAAGGAGCCCGGG + Intergenic
1097193491 12:57231510-57231532 TGTTGTTCAGACAGGACCCCAGG - Exonic
1101241998 12:102848255-102848277 TTGAGGATAGACAGGACACCAGG + Intronic
1101242030 12:102848430-102848452 TTGAGGATAGACAGGACACCAGG + Intronic
1101242038 12:102848465-102848487 TGGAGGGTAGACAGGACACCAGG + Intronic
1101242044 12:102848500-102848522 TTGAGGATAGACAGGACACCAGG + Intronic
1101242052 12:102848535-102848557 TGGAGGGTAGACAGGACACCAGG + Intronic
1101757075 12:107629485-107629507 TGGAGTAAATTCAGGTCCTCTGG - Intronic
1102553244 12:113708003-113708025 TGCAGTAAACACAGGAGCACAGG - Intergenic
1103926806 12:124427746-124427768 TGTAATAATGGCAGGACCCCCGG + Intronic
1104602939 12:130165157-130165179 CAGAGGAAAGACAGGACCCGGGG + Exonic
1107396689 13:40025320-40025342 TGGAGTAGAGTCAGGAACCAAGG - Intergenic
1108062352 13:46546083-46546105 AGGATTCAAGACAGGGCCCCAGG - Intergenic
1108680146 13:52773075-52773097 TGGAGACCAGACAGAACCCCTGG - Intergenic
1108827269 13:54428884-54428906 AGGAGCAAAGACAGGAAACCAGG + Intergenic
1116161478 14:41271326-41271348 TGAAATAAAGAAAGGACTCCTGG - Intergenic
1121307768 14:92917714-92917736 TGGGGCACAGGCAGGACCCCTGG + Intergenic
1121604418 14:95230219-95230241 TGGAGGGCAGACAGAACCCCAGG + Intronic
1122050654 14:99057543-99057565 TGGAGGAAAGAAAAGACCCTGGG + Intergenic
1122297504 14:100713666-100713688 TGGAGTAAAGACAGCACTGATGG + Intergenic
1202852753 14_GL000225v1_random:31320-31342 TGGAGGAGATTCAGGACCCCGGG + Intergenic
1125452782 15:39826393-39826415 TGGAGTAAAGACAGGACCCCAGG + Intronic
1127427080 15:58867290-58867312 TGGAAGAAAGGAAGGACCCCCGG - Intronic
1128378345 15:67093155-67093177 TGGTGTCAGGACAGGACTCCTGG + Intronic
1130078625 15:80711496-80711518 TGCAGTAATGACAAGACCTCTGG - Intronic
1133155120 16:3868909-3868931 AGGAGTCAAGACTGGATCCCGGG + Intronic
1136472147 16:30488269-30488291 TGGAGTATAGAGAAGACTCCAGG + Intronic
1137231034 16:46568535-46568557 GGCAGGAAAGCCAGGACCCCGGG + Intergenic
1138191454 16:55017189-55017211 TGCAGGAGAGACAGGACCCAGGG - Intergenic
1140226250 16:73079632-73079654 GGGAGTAAAGATAGGAGGCCAGG - Intergenic
1141598645 16:85112384-85112406 GGGAATAAGGACAGGGCCCCAGG + Exonic
1143401540 17:6648177-6648199 TGAAGAAAAGAAAGGACCTCTGG + Intronic
1143574411 17:7782060-7782082 GGGAGTAAAAGCAGGAACCCTGG + Intronic
1143673341 17:8412057-8412079 GGGAGAAAAGACATCACCCCGGG + Intergenic
1144941715 17:18946778-18946800 TGGAGTTGAGTCAGGAACCCAGG + Intergenic
1144954607 17:19012777-19012799 TGGCGTAAAGCTTGGACCCCAGG + Intronic
1145410071 17:22652184-22652206 AGGAGAAGATACAGGACCCCTGG + Intergenic
1147331424 17:39701368-39701390 TGGGGTCAAGATGGGACCCCAGG + Intronic
1148087210 17:45001380-45001402 TGAAGTGAAGACAGGAGACCTGG - Intergenic
1149188104 17:54026108-54026130 CAGAGTAAAGACAGGAATCCTGG + Intergenic
1149665543 17:58362706-58362728 GGGAGGAAACACAGGAGCCCGGG + Intronic
1151322086 17:73358466-73358488 TGGAGTAGAGCCAGGAGACCTGG + Intronic
1151538584 17:74752435-74752457 TGGATTAAGGACAGGCTCCCTGG - Intronic
1152434093 17:80264606-80264628 TGGAGGAAGGAGAGGGCCCCGGG - Intronic
1153260547 18:3219910-3219932 AGGGCTAAAGACAGGACCCTGGG + Exonic
1157230586 18:45912046-45912068 TGTAGTAAAGACAACACCCTGGG - Intronic
1159059176 18:63496831-63496853 TGGAGCAGAGACAGGAGGCCAGG + Intronic
1160073393 18:75648486-75648508 TGGAGTAATAGCAGGAACCCTGG + Intergenic
1160073475 18:75649255-75649277 TGGAGTAATGCAAGGAACCCAGG - Intergenic
1160587258 18:79919615-79919637 TGGAGGAGAGACAGGAACCGAGG + Intronic
1160587334 18:79919997-79920019 TGGAGGAGAGACAGGAACCGAGG + Intronic
1160587347 18:79920074-79920096 TGGAGGAGAGACAGGAACCGAGG + Intronic
1160587410 18:79920378-79920400 TGGAGGAGAGACAGGAACCGAGG + Intronic
1160587692 18:79921792-79921814 TGGAGGAGAGACAGGAACCGAGG + Intronic
1161243894 19:3238342-3238364 TGGAAGAAAGACATGAACCCTGG - Intronic
1161668153 19:5589512-5589534 TGGAGACAAGACAGGACACTCGG + Intronic
1162692897 19:12448780-12448802 TGGAGTAAAGAGAAGAGACCAGG - Intronic
1163485051 19:17580539-17580561 TGGAGTGAATGCAGGAGCCCAGG - Intronic
1163891785 19:20023041-20023063 TGGAGCAAAGACAGGAGCCCTGG - Exonic
1164042495 19:21505959-21505981 CGGAGGGAAGACAGGACGCCCGG - Intronic
1164783268 19:30910360-30910382 TAGAGAAAAGACAGTACCCAAGG + Intergenic
1165159598 19:33808233-33808255 TGGATGAAAGACAAGGCCCCAGG - Intronic
1165392911 19:35548599-35548621 TGGAGTAAAGACAGGGTCCATGG + Intergenic
1165554460 19:36617945-36617967 AGGAGTAAAGACTGCATCCCAGG - Intronic
1165661398 19:37583634-37583656 TGGAGCAAGGAAAGGAGCCCTGG - Intronic
1166079581 19:40435218-40435240 TTGAGTAGAGACAGGACCTCAGG + Intergenic
1167715613 19:51141345-51141367 TGGAGCAAAGACACCAGCCCCGG - Intergenic
925118209 2:1398166-1398188 TGGGGAAAAGACAGAAGCCCTGG - Intronic
927879752 2:26682103-26682125 TTGAGTTAAGGCAGGACTCCTGG - Intergenic
929469370 2:42176041-42176063 TGGAGTAGAGAAAAGACCACTGG - Intronic
930031912 2:47063636-47063658 TGGAGTCAGGGCAGGCCCCCAGG + Intronic
932297214 2:70636298-70636320 TGGAGTAAAGAAGGGAACTCGGG - Intronic
935378373 2:102423249-102423271 TGGAGTGATGACAGGAACACGGG + Exonic
938062307 2:128263113-128263135 TGGTGTGAAGACAGAACGCCGGG + Intronic
941220704 2:162776685-162776707 TGCAGTACAGTCAGGTCCCCTGG - Intronic
942210441 2:173664309-173664331 TGGGGTAGAGTCAGGCCCCCAGG + Intergenic
949007663 2:241658884-241658906 TGGGGCAAGGGCAGGACCCCTGG + Intronic
1168788905 20:562905-562927 TGGATTATTGAGAGGACCCCGGG + Intergenic
1168959552 20:1859530-1859552 TGGGGTCAAGATAGGACCCAGGG + Intergenic
1169195313 20:3679573-3679595 TGGAGTAAAGACAGAGCACAGGG + Intronic
1172441430 20:34969137-34969159 TGGAGGAAAGAGGGTACCCCTGG + Intergenic
1172527837 20:35611153-35611175 AGGAGCAAAGACAGAAACCCAGG + Intergenic
1174273722 20:49388236-49388258 TGGAGAAAGGAGAAGACCCCTGG + Intronic
1177374344 21:20249580-20249602 TGGAGTACAGACATGAGCCACGG + Intergenic
1177479724 21:21670429-21670451 AGTAGTAAAGATAGCACCCCTGG - Intergenic
1179786949 21:43735523-43735545 TGGGATGAGGACAGGACCCCAGG + Intronic
1181839811 22:25647152-25647174 TGGAGGAAGGAGAGGGCCCCGGG + Intronic
1181928274 22:26377881-26377903 TGGGGATAAGACAGGACCACTGG - Intronic
1184836677 22:47027940-47027962 TGGAGCACAGTCAGGGCCCCTGG + Intronic
950457814 3:13103095-13103117 TGAAGTAGAGCCAGGGCCCCAGG + Intergenic
950739975 3:15042743-15042765 TGCAATACAGACGGGACCCCAGG + Intronic
951052873 3:18114175-18114197 TGGAATAAAGAAAGGACCATTGG - Intronic
954457070 3:50605471-50605493 TGGAGTTCACACAGGACCCTGGG - Intergenic
955105866 3:55897448-55897470 TGGAATGAAGACAGGAAACCAGG - Intronic
955931627 3:64063369-64063391 TGGAGTAGAGTCAGGTCCACAGG - Intergenic
956744438 3:72300359-72300381 AGGAGCAAAGGCAGGAACCCAGG + Intergenic
960727542 3:120685499-120685521 TGGATTAAAAACAGAACCCAGGG + Intergenic
961186278 3:124918027-124918049 TGGAGTTAAGACAGGAGGTCCGG + Intronic
961292289 3:125857496-125857518 TGGAGTGTAGGCAGGACCCGTGG - Intergenic
961894907 3:130158905-130158927 TGGAGTGTAGGCAGGACCCGTGG + Intergenic
964063918 3:152558600-152558622 TTTAGTCAAGACAGGACCACAGG + Intergenic
964391865 3:156206190-156206212 TGGAGGAGAGACAGATCCCCAGG - Intronic
967140654 3:186555850-186555872 AGGAGTAAAGACATGAACTCAGG - Intronic
968419685 4:473644-473666 TAAAGTAGGGACAGGACCCCTGG + Intronic
969005007 4:4011953-4011975 TGGAGTGAAGGCAGGACCCCTGG + Intergenic
969747862 4:9088190-9088212 TGGAGTGTAGGCAGGACCCGCGG - Intergenic
969808902 4:9632723-9632745 TGGAGTGTAGGCAGGACCCGTGG - Intergenic
974645483 4:64685899-64685921 TGAAGTAAGAACAGGAACCCTGG + Intergenic
979630936 4:122901979-122902001 TGGAGTAAAGACAGAACAAGAGG - Intronic
982364395 4:154559328-154559350 TGTAGTACTGACAGGACCACTGG + Intergenic
984504269 4:180597120-180597142 TAGAGAAAAGACAGGAAGCCTGG - Intergenic
985697649 5:1350024-1350046 TGAAGTAAAGACAGGCCCTTGGG - Intergenic
992144091 5:73827599-73827621 TGGAGTAGAGACTTGAACCCAGG + Intronic
995192172 5:109329552-109329574 AGGAGTATATACAAGACCCCTGG - Intergenic
997297086 5:132775192-132775214 GAGAGCAAACACAGGACCCCAGG + Intronic
997590273 5:135067999-135068021 TGGACTAATGGCAGGGCCCCTGG - Intronic
1000382997 5:160645639-160645661 TAGAGTAAAGGCCAGACCCCAGG - Intronic
1000637464 5:163660246-163660268 AGGTGTTAAGAGAGGACCCCTGG + Intergenic
1001695010 5:173663544-173663566 TGCTGGAAACACAGGACCCCAGG - Intergenic
1002781842 6:372982-373004 TGGAGAAAGGACAGGGCCCATGG + Intergenic
1006388749 6:33746635-33746657 TGGAATGGAGACAAGACCCCAGG + Intronic
1006581830 6:35081784-35081806 CTGAGTAAATCCAGGACCCCTGG - Intronic
1014809544 6:125870227-125870249 TGGACTAAAGACAGGACTGAGGG - Intronic
1016079368 6:139837015-139837037 TGCATTAAAGACTGGACCCTTGG - Intergenic
1017209832 6:151842934-151842956 TGGAGAAGAGACAGGATCTCAGG + Intronic
1018863972 6:167733415-167733437 TGGTGGAAAGACAGGAACTCAGG - Intergenic
1018863987 6:167733526-167733548 TGGTGGAAAGACAGGAACTCAGG - Intergenic
1020025304 7:4895505-4895527 TGGAGTTTAGCCAGGAGCCCAGG + Intergenic
1023688559 7:42762934-42762956 TGGAGCAAGGACAGAACACCGGG + Intergenic
1023871540 7:44265716-44265738 TGGGGTAAAGAAAGGGCACCTGG + Intronic
1024081970 7:45863679-45863701 TGGAGTAGAGACTGGAACCTGGG + Intergenic
1025160046 7:56650015-56650037 TGGAGCAAAGAAAAGAGCCCTGG - Intergenic
1026528683 7:71177954-71177976 TGAATTAAAGACAGGGCCACAGG - Intronic
1026582885 7:71632719-71632741 TGAAATAAAGACAGGTTCCCCGG - Intronic
1026955178 7:74372430-74372452 AGGAATAAATAAAGGACCCCGGG - Intronic
1032209578 7:129901260-129901282 TGGAGGGAGGACAGGAGCCCAGG + Intronic
1036370924 8:8162385-8162407 TGGAGTGTAGGCAGGACCCGTGG - Intergenic
1036879970 8:12503251-12503273 TGGAGTGTAGGCAGGACCCGTGG + Intergenic
1037778609 8:21852074-21852096 TGGAGAAAAGCCAGGCCCACTGG - Intergenic
1038888956 8:31696810-31696832 TAGAATAATGAAAGGACCCCTGG - Intronic
1039477006 8:37844315-37844337 TGGAGTAAAGTCAGGAGTGCAGG - Exonic
1042162147 8:65907274-65907296 TGGAGTGAAGATAGGACAACTGG + Intergenic
1044938416 8:97315629-97315651 GGAAGTTAAGACTGGACCCCTGG + Intergenic
1046124195 8:109883478-109883500 TGGAGTCAAGACAGAAGCCATGG - Intergenic
1048393133 8:133986876-133986898 TGGAGTAGAGACAAGACTCAAGG + Intergenic
1048848663 8:138623457-138623479 TGGAGCAGGGACAGGAGCCCTGG + Intronic
1049622554 8:143605170-143605192 TGCAGTAAAGCCAGGGGCCCTGG - Exonic
1049711078 8:144063611-144063633 TGGAGCAAAGCCAGGGCCCTGGG - Intronic
1049812011 8:144579860-144579882 TGGAGGAGAGGCTGGACCCCAGG - Intronic
1051014875 9:12462466-12462488 TGCAGTAAAGTCAGCACACCTGG + Intergenic
1052748321 9:32463231-32463253 TGGATTAAAAACAGGAGGCCTGG - Intronic
1053062762 9:35044650-35044672 TGGAGCAAAGAAAGAACCACTGG + Exonic
1055615131 9:78064176-78064198 TGGAGTATTTACAGGTCCCCTGG + Intergenic
1056454672 9:86748355-86748377 TGGACTAAAGAAAGCACTCCAGG - Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1058711599 9:107683840-107683862 TGTAAAAAAGACAGGAGCCCTGG - Intergenic
1061705164 9:132447476-132447498 GCGAGTGAAGACAAGACCCCAGG - Intronic
1061939546 9:133876654-133876676 TGGAGGGAAGGCAGGACCGCGGG + Intronic
1185745760 X:2572205-2572227 TGGAGCAAGGACAGGTCCCTGGG - Intergenic
1192092879 X:68179498-68179520 TGGGCCAAAGACAGGACCCAAGG - Intronic
1192591229 X:72361117-72361139 TGTAGTCTAGACAGGACACCAGG - Intronic
1194804639 X:98312293-98312315 TGCAGTAAAGACAATACCCAAGG + Intergenic
1196975821 X:121156478-121156500 TGGAGTAAAGACTGGACTCTGGG + Intergenic
1196981505 X:121219322-121219344 TGGAGTAAAGACAGGAATTTGGG - Intergenic
1199607648 X:149588579-149588601 TGGAGTAATATCAGGACACCAGG - Intergenic
1199631475 X:149780788-149780810 TGGAGTAATATCAGGACACCAGG + Intergenic
1199727978 X:150603835-150603857 TGGGCTAAGGAGAGGACCCCGGG + Intronic