ID: 1125454479

View in Genome Browser
Species Human (GRCh38)
Location 15:39843317-39843339
Sequence CTCAATCATATGTATTTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125454476_1125454479 10 Left 1125454476 15:39843284-39843306 CCAAGTAGGGCACAAAAGATAGT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1125454479 15:39843317-39843339 CTCAATCATATGTATTTCAAAGG 0: 1
1: 0
2: 3
3: 15
4: 244
1125454475_1125454479 13 Left 1125454475 15:39843281-39843303 CCTCCAAGTAGGGCACAAAAGAT 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1125454479 15:39843317-39843339 CTCAATCATATGTATTTCAAAGG 0: 1
1: 0
2: 3
3: 15
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125454479 Original CRISPR CTCAATCATATGTATTTCAA AGG Intronic
900697541 1:4021558-4021580 CTCAGGAAAATGTATTTCAAGGG + Intergenic
905326008 1:37152420-37152442 CTCAATGACAGGTATGTCAAGGG - Intergenic
905698904 1:39997026-39997048 CTGTATCATATGTATTACAGAGG - Intergenic
906443715 1:45874799-45874821 CTCAATCATACCTACTTCACTGG - Intronic
906645505 1:47471634-47471656 CTGAATGATATTGATTTCAAGGG - Intergenic
908297984 1:62732117-62732139 CTCACTTATATTTCTTTCAATGG + Intergenic
909003501 1:70247717-70247739 TTAAAACATTTGTATTTCAAAGG + Intronic
909771033 1:79421607-79421629 GTCTTTCATATGAATTTCAATGG - Intergenic
911830171 1:102540377-102540399 CTCAATTATATTACTTTCAAAGG + Intergenic
911832763 1:102575475-102575497 CAGAATCTTATGTTTTTCAAGGG + Intergenic
912027376 1:105194673-105194695 CTCAGTGATAAGTAATTCAAAGG - Intergenic
912094613 1:106122198-106122220 TTCAATCATTTGTAATACAAAGG - Intergenic
912401884 1:109400224-109400246 CTGAATCACATGCATTTCATAGG - Exonic
915740512 1:158115284-158115306 CTCAGTCATCTGTATGTAAATGG - Intergenic
917062254 1:171053668-171053690 ATTAATCATATTTATTTTAAAGG - Intronic
919001623 1:191839146-191839168 CTCAATGATATTTATTTTAAAGG - Intergenic
921480988 1:215664659-215664681 CTTCAACATATGTATTTGAAGGG - Intronic
921544893 1:216463212-216463234 CTCCATCATTTGTCTTTAAAAGG + Intergenic
921932987 1:220770515-220770537 CTCCAACATCTGTATTTGAAGGG - Intronic
924285256 1:242479432-242479454 CTAAATCATGTATGTTTCAACGG - Intronic
924885135 1:248207118-248207140 ATTAATCATTTGTATTTCTATGG + Intergenic
1064756821 10:18578866-18578888 CTCAATCATATGTCTTACATAGG + Intronic
1066477576 10:35762937-35762959 CTAAATCTTATGTATTTCTTTGG + Intergenic
1066642778 10:37572880-37572902 CCCAAGAATATGGATTTCAAGGG + Intergenic
1067539422 10:47140980-47141002 TTGAATCATGTGTACTTCAACGG - Intergenic
1068011624 10:51458778-51458800 CTCAATCCTGTGTTGTTCAAGGG - Intronic
1068295292 10:55062988-55063010 CAAAATGATATGTATTTCATAGG - Intronic
1069015433 10:63424039-63424061 CACAATCATATGTCTGACAATGG - Intronic
1069123569 10:64600579-64600601 CTCAATCACCTGTATTTACATGG + Intergenic
1070218735 10:74416920-74416942 CTCAATAATATATTTTTCACAGG + Intronic
1071109895 10:82143593-82143615 CTAAATCACATTGATTTCAATGG - Intronic
1072040889 10:91605474-91605496 CTCAATCATAAATATTTGACAGG - Intergenic
1072101377 10:92232456-92232478 CCCAATTTGATGTATTTCAAGGG - Intronic
1072331286 10:94355041-94355063 CTCAATCAAATGTTCTTCTATGG + Exonic
1072773932 10:98170275-98170297 CTCAACCAGATGATTTTCAAAGG + Intronic
1074092745 10:110277617-110277639 CTAAATCAAAGGTATATCAATGG - Intronic
1074654792 10:115572826-115572848 CCCAATCATATGTCCTGCAAGGG - Intronic
1075298428 10:121298608-121298630 CTCAAATTTATGTATTTCTAGGG + Intergenic
1076692791 10:132232291-132232313 CTTAATCAAATCCATTTCAACGG - Intronic
1079829805 11:25249061-25249083 CTCAATCTTAAAAATTTCAATGG - Intergenic
1081187099 11:40057177-40057199 TTTAATCATATATATTTCAGGGG - Intergenic
1082091484 11:48093917-48093939 CACAATCATGTGTCTGTCAAAGG - Intronic
1082207265 11:49452878-49452900 CTGAACCATGTGTATTTCAGAGG - Intergenic
1083025348 11:59546117-59546139 CTTAAACATATGAATTTCAAGGG - Intergenic
1085125632 11:74000408-74000430 CTCAATCATGAGTACCTCAAAGG - Exonic
1085714984 11:78864550-78864572 CTCAAGCATGTATATCTCAAGGG - Intronic
1085715329 11:78867576-78867598 CTCGATCATATGTATTTCATGGG - Intronic
1087199855 11:95334519-95334541 CTTCAACATATGAATTTCAAGGG + Intergenic
1088747905 11:112819903-112819925 CCCAATCATATTCATTTGAAGGG + Intergenic
1090505820 11:127312309-127312331 CTAAATCATATGGATTTTAATGG - Intergenic
1090675259 11:128986915-128986937 TTCATTCATATGTATCTCAGAGG - Intronic
1094177542 12:27556880-27556902 CTCAAACATATATGTTTGAAGGG + Intronic
1096951943 12:55482507-55482529 CCCAATCATATCTATTCTAATGG + Intergenic
1100270125 12:93016718-93016740 CTCCAACATATGAATTTCAGGGG - Intergenic
1101132365 12:101702564-101702586 CTCTATAATATGTAATACAAAGG - Intronic
1101437308 12:104675245-104675267 CTTAATGAGATCTATTTCAACGG - Intronic
1102831595 12:116006838-116006860 CTCAAGAATACCTATTTCAATGG + Intronic
1106683153 13:32029083-32029105 GCCACTCATATATATTTCAAGGG - Intergenic
1106852933 13:33814754-33814776 CTCATTCATAGGCATTTAAAAGG - Intergenic
1107180005 13:37447984-37448006 CTGCAGCATATGTATTTCATGGG - Intergenic
1107194468 13:37632134-37632156 CTCCATCATCTGAATTGCAAAGG - Intergenic
1107579974 13:41772593-41772615 CTCAAACATGTGTATTTTCATGG + Intronic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1107745211 13:43498050-43498072 CTAAACCATATATATTTCACTGG + Intronic
1110103549 13:71640431-71640453 CTGAATCCTATGTATTACATAGG + Intronic
1113278033 13:108756302-108756324 CTCATACATATATAATTCAAAGG - Intronic
1113340508 13:109419528-109419550 ATCAATCATATGAAATTAAAGGG - Intergenic
1117348317 14:54855980-54856002 TTCACTCATTTGTATTTAAATGG + Intronic
1125454479 15:39843317-39843339 CTCAATCATATGTATTTCAAAGG + Intronic
1126459820 15:48903146-48903168 CTCAATCACATATAATTAAAGGG + Intronic
1128875769 15:71200017-71200039 CACAGTCATAGGTATTTCAGAGG + Intronic
1129024727 15:72559987-72560009 CTTAAGTATATATATTTCAAAGG + Intronic
1133840954 16:9408745-9408767 CCCAATGATATGTGTTCCAAAGG - Intergenic
1133939660 16:10297847-10297869 CTCAGACATTTGCATTTCAAAGG + Intergenic
1133957456 16:10457239-10457261 TTAAATCACATGTATTTCGATGG - Intronic
1136399300 16:30009251-30009273 CTCAAGCCCATGGATTTCAATGG - Exonic
1137229775 16:46553174-46553196 CTAAATCCTATGTTATTCAAAGG + Intergenic
1138917645 16:61486515-61486537 CTTCAACATATGGATTTCAAAGG - Intergenic
1140036373 16:71374526-71374548 CTCAGTCATATAAATTTCAAAGG - Intronic
1143326584 17:6102894-6102916 CCCATTCATAAGTATTTCATTGG + Intronic
1144000830 17:11053348-11053370 AAGAATCATATGTATTTCCATGG + Intergenic
1144321811 17:14130701-14130723 CTTCATCATATGCATTTCCATGG + Intronic
1144468603 17:15516980-15517002 CTCAATCATATCTATTCAAGTGG + Intronic
1145339724 17:21943768-21943790 ATCAATCATATGGATTTGAATGG + Intergenic
1146124117 17:30218514-30218536 GTCACTCATATGTATTTGCAAGG + Intronic
1149146288 17:53497354-53497376 GTCAAACATATATGTTTCAAAGG - Intergenic
1155731082 18:29159276-29159298 TTCAATTAGATTTATTTCAACGG + Intergenic
1155901060 18:31390957-31390979 CTCAATTATATAAATTTCATTGG + Intronic
1156803779 18:41151276-41151298 CTCACTCATAAGTAATTCCAGGG + Intergenic
1157928628 18:51794215-51794237 CTCAAACCTATGTTATTCAAGGG - Intergenic
1158907089 18:62024226-62024248 CACCTTCATAAGTATTTCAATGG - Intergenic
1162635203 19:11962663-11962685 CTGAAACAGATATATTTCAAAGG + Intronic
1166467210 19:43043142-43043164 CTCCATCATATGCTTTGCAATGG - Intronic
925772725 2:7298866-7298888 CACAATCATTTGGATTTTAATGG + Intergenic
925835939 2:7947029-7947051 CTTAATTATATGTATTTTAATGG - Intergenic
927171390 2:20373129-20373151 CTCAATCTCATTTTTTTCAAAGG + Intergenic
929862918 2:45694572-45694594 CTCATTCATATGCATTTCCCAGG - Intronic
929912614 2:46103541-46103563 CTCACTCCCATGTTTTTCAAGGG - Intronic
929972560 2:46595451-46595473 CTCAATCATATTCCCTTCAAGGG + Intronic
930312023 2:49753913-49753935 TTTAATCATAGGCATTTCAATGG + Intergenic
930325404 2:49910447-49910469 GTCAATCCCATGTAGTTCAAGGG + Intergenic
933424468 2:82092098-82092120 TTGAATTATCTGTATTTCAAAGG - Intergenic
933789908 2:85875537-85875559 CTCACTCATCTACATTTCAAAGG + Intronic
935062106 2:99617484-99617506 CTCAATTATAAGTTTTTAAAAGG - Intronic
935411060 2:102762794-102762816 CTCAATTAGATGTCTTTAAAAGG + Intronic
937146911 2:119655336-119655358 CTCAATCATTAGTATCTCTAAGG + Intronic
937719643 2:125079016-125079038 CTCTGTTTTATGTATTTCAATGG + Intergenic
939063560 2:137454307-137454329 CTCACTCATAAGTTTTTGAATGG + Intronic
942090491 2:172485316-172485338 CTAAATCAAATGTCTTTGAAGGG + Intronic
942104365 2:172618014-172618036 TTAAATCATATCTATTACAATGG - Intergenic
943669280 2:190643992-190644014 CTCAAGGAAATGTATTTAAAAGG + Intergenic
943844020 2:192618479-192618501 CAAAATCACATTTATTTCAAAGG - Intergenic
944820500 2:203425643-203425665 CACAATCAAATGTAGTTAAATGG - Intronic
945830835 2:214783238-214783260 CTCAAGCCTATGTTATTCAAGGG + Intronic
945885225 2:215368753-215368775 CTAAATCATCTATATTCCAAGGG - Intronic
946086046 2:217172744-217172766 CTTGATCATCTGTTTTTCAATGG + Intergenic
1169397791 20:5250173-5250195 CTTTATCATATATATTTCTAAGG + Intergenic
1169514504 20:6301064-6301086 GTCAATCCTATGTATATCCATGG + Intergenic
1169843329 20:9963228-9963250 CTCAATCATGTCTATGTAAAGGG - Intergenic
1169872315 20:10261171-10261193 CTCAATCATTTTTAGTACAATGG + Intronic
1171101625 20:22389092-22389114 CTCATTCATTTGTCTGTCAAGGG - Intergenic
1173030289 20:39351627-39351649 CACAATCATTTGTATTTCTGTGG - Intergenic
1174726464 20:52867867-52867889 CTCACTCATATGTTTTTTATTGG - Intergenic
1176886288 21:14259409-14259431 TTAAATCATATGTATATCAAAGG + Intergenic
949768648 3:7554148-7554170 CTCCATGATAGGTATTTCTATGG - Intronic
951232577 3:20196883-20196905 CACAATCATCTGCATTTCTATGG - Intergenic
951788665 3:26453769-26453791 CCCACACATATGTATTTTAATGG + Intergenic
952323505 3:32299611-32299633 CTGAATCATTTGTAACTCAAAGG - Intronic
952505584 3:34004364-34004386 CTCAATCATATGACTTTCTTTGG - Intergenic
952528504 3:34239158-34239180 CTTATTCATATATATTTCTAAGG - Intergenic
953245081 3:41183559-41183581 CTCAATAATAGGTATTTCTGAGG - Intergenic
953777260 3:45831064-45831086 CTCAGTTACCTGTATTTCAATGG + Exonic
955115207 3:55991516-55991538 TTCAAGTATATGTATTTAAAAGG + Intronic
956983222 3:74664912-74664934 CTGAATCAAATTTATTTAAATGG + Intergenic
957706805 3:83798331-83798353 TTCAAAGATATTTATTTCAAAGG - Intergenic
957980217 3:87499763-87499785 GTCAATGTTATGTATTTGAATGG - Intergenic
958475341 3:94573744-94573766 CTCATTCATATGTCTTCCTAAGG + Intergenic
958613229 3:96454273-96454295 CTAAATCATCTATATTTAAATGG + Intergenic
959294464 3:104518668-104518690 CTCAGTCATATTTTTTGCAAAGG - Intergenic
959567476 3:107847403-107847425 TACAATCATCTGTTTTTCAAAGG - Intergenic
959933246 3:112004609-112004631 GATAATCATATGTATTTCACAGG + Intronic
961147679 3:124608726-124608748 CTGAATCTTCTGTATTTCCAAGG + Intronic
961347413 3:126273151-126273173 CTGAAATATATTTATTTCAAAGG - Intergenic
962281073 3:134052327-134052349 CTCATTCATGTGTATTTTAGAGG + Intergenic
963580085 3:147115185-147115207 CTCAAGCATATGAATATGAATGG + Intergenic
963990948 3:151653030-151653052 TTCAATCTTATTTACTTCAATGG - Intergenic
965319810 3:167239346-167239368 TTCAAACCTATGTTTTTCAAGGG - Intergenic
965833717 3:172828138-172828160 CTTATTCTTAAGTATTTCAATGG - Intergenic
966027486 3:175302310-175302332 CACTGACATATGTATTTCAATGG + Intronic
966577787 3:181522286-181522308 CTCCAACATATGAATTTCAGAGG + Intergenic
966647665 3:182264775-182264797 CCAAATCATTTTTATTTCAATGG + Intergenic
967649645 3:191970817-191970839 ATCAATCATAAGAATTTTAATGG - Intergenic
967885381 3:194330157-194330179 CTGGATCATCTGTATTTCACTGG + Intergenic
970711806 4:18872383-18872405 CTTAATCTTATGGATTTCAGAGG + Intergenic
971271522 4:25151629-25151651 CTAAATCATATCTTTTTAAATGG + Intronic
972745609 4:41929534-41929556 CTAAAGCATAAGCATTTCAAAGG - Intergenic
973024243 4:45247729-45247751 TTTAATCATATGAATTTTAATGG + Intergenic
974890807 4:67880014-67880036 CTCATTTATATGACTTTCAAAGG + Intronic
975446231 4:74468737-74468759 ATTAATGATATGTATTTTAAAGG - Intergenic
975897315 4:79107988-79108010 CTAAATGATAAGTATTTGAAAGG + Intergenic
979559503 4:122086384-122086406 CTCAATCATGTTTATTTCCTGGG - Intergenic
980176879 4:129356604-129356626 TTCAATCATATGTCTCTTAAAGG + Intergenic
980319391 4:131249633-131249655 ATGAATCATATATATTTCATTGG + Intergenic
980510597 4:133781664-133781686 AACATTCATAAGTATTTCAAAGG + Intergenic
980518118 4:133891793-133891815 CTAAAATATATATATTTCAAAGG + Intergenic
980664912 4:135919700-135919722 CTCATTTATATGTTTTTAAATGG - Intergenic
980764685 4:137286498-137286520 CTAAAACATATGAATTTCGAGGG + Intergenic
981161365 4:141503052-141503074 CTTAAACATATGAATTTCAGAGG - Intergenic
982953927 4:161738337-161738359 CTAAATCATATGTATTGTAAAGG - Intronic
982958015 4:161795322-161795344 CTAAATTATCTGTATTCCAAAGG + Intronic
985262049 4:188123782-188123804 CTCAATTATATGTTTTACATTGG + Intergenic
986835407 5:11631665-11631687 CTCAATCATATTTGTCTGAAAGG - Intronic
986845532 5:11748342-11748364 CTAAATTATATATATTTAAAAGG + Intronic
987533781 5:19157755-19157777 TTCAATCAGATTTATTTCTAAGG + Intergenic
987883220 5:23776700-23776722 CTCTATCATCAGTATTTAAAGGG - Intergenic
987936373 5:24470590-24470612 TACAAATATATGTATTTCAAAGG + Intergenic
988516287 5:31907610-31907632 CTCTCTCATCTGTATTTCATGGG - Intronic
988952348 5:36276221-36276243 CTAAAGCAAATGTCTTTCAAAGG - Intronic
990172065 5:53062539-53062561 CTCAGGGATCTGTATTTCAAAGG + Intronic
991327774 5:65456714-65456736 CATAATAATATCTATTTCAATGG + Intronic
992343844 5:75855785-75855807 CTGGATCATTTGTAATTCAAAGG - Intergenic
993545298 5:89204355-89204377 CTCAAATATCTGTATTTCCAAGG + Intergenic
993770852 5:91924583-91924605 CTAAATTATCTGTAGTTCAATGG - Intergenic
994064855 5:95527415-95527437 ATCAGTTTTATGTATTTCAAAGG - Intronic
994713118 5:103290307-103290329 CTCTCTCATTTGTATGTCAAAGG - Intergenic
994977717 5:106831458-106831480 TTCAAACCTATGTTTTTCAAGGG + Intergenic
995160698 5:108977500-108977522 TTCAAACCTATGTAGTTCAAGGG + Intronic
995870070 5:116735083-116735105 ATCAATCATTGGTATTTGAAAGG - Intergenic
996080366 5:119252560-119252582 CTAAATTATATGTAATTTAAAGG - Intergenic
999116843 5:149171810-149171832 CTCAAACATATCTCTTTGAAGGG + Intronic
999365062 5:151018060-151018082 GTCAACCAAATGTATTTAAAAGG + Intergenic
999893283 5:156001896-156001918 CTCAAAAATATGTACTTCTAAGG + Intronic
1002855475 6:1034166-1034188 CTAAATCATGTTTTTTTCAAAGG - Intergenic
1002950453 6:1804886-1804908 CTCAATGGAATGTATTTCCAAGG + Intronic
1003780328 6:9417156-9417178 GTAAATCATATGTATTCTAAGGG + Intergenic
1004211103 6:13645328-13645350 CTCAAATATATGTATTTCAAGGG + Intronic
1004895055 6:20140203-20140225 CTCACTCACATTTAATTCAATGG + Intronic
1008289570 6:49697357-49697379 TTCATTCATTTGGATTTCAATGG - Intronic
1009522156 6:64696388-64696410 ATGAATCATATGTATTCCAGAGG + Intronic
1009763770 6:68041138-68041160 TTCAATCAGATGTATTTCAGAGG - Intergenic
1009794037 6:68442986-68443008 CTCATTCATATACATTTCAATGG - Intergenic
1009939094 6:70268557-70268579 CTCAATCCAATGTATTTTATTGG + Intronic
1011717307 6:90120983-90121005 CTCAATCATATCTAATTCAATGG - Intronic
1011837749 6:91454983-91455005 CACAAACATATGTATGTAAAAGG - Intergenic
1012417874 6:99029374-99029396 CTCAAACATAAGTATGGCAATGG + Intergenic
1012992883 6:105944493-105944515 CTCAATCAAGTTTATTTCATGGG + Intergenic
1014044040 6:116863046-116863068 ATAAATAATATGTATTTCAATGG - Intergenic
1014917767 6:127173543-127173565 CTAAAAAAAATGTATTTCAAAGG + Intronic
1015234021 6:130950133-130950155 ATCAATCAGAGGTACTTCAAGGG + Intronic
1015245344 6:131068013-131068035 CTCAACCATAGGTTTTGCAAAGG + Intergenic
1015357471 6:132295885-132295907 CTGAAACATATTTATTTAAAAGG + Intergenic
1016188756 6:141233615-141233637 CTAAACCATATATAGTTCAAGGG + Intergenic
1017345793 6:153379421-153379443 CTCAAGCATTTGTACTTCACTGG - Intergenic
1019402501 7:864055-864077 TTCAAACTTATGTATTTTAATGG + Intronic
1020560139 7:9721082-9721104 CTTACACATCTGTATTTCAATGG - Intergenic
1020629303 7:10621239-10621261 CTGATTCATATTTTTTTCAAAGG + Intergenic
1020815887 7:12905424-12905446 TTTAAACATTTGTATTTCAAAGG + Intergenic
1020990552 7:15190690-15190712 CTCAATAATTTGTATTTCGTTGG - Intergenic
1021631755 7:22654432-22654454 CTCAATTATATTTACTCCAAGGG - Intergenic
1021927122 7:25544428-25544450 CTCAATCAATGGTATTTCAAAGG + Intergenic
1024449862 7:49527177-49527199 CTCGGTTATATTTATTTCAAAGG + Intergenic
1027499471 7:78930689-78930711 CTAAATCAAATGTCTTTCATGGG + Intronic
1028899293 7:96078279-96078301 CTCAATCATTTTAATTGCAAAGG - Intronic
1029531972 7:101131451-101131473 CTCAATTGGATGTATGTCAAAGG - Intronic
1031233732 7:119144555-119144577 GTAAATAATATGGATTTCAATGG + Intergenic
1031660200 7:124414628-124414650 CTGATTAATATATATTTCAATGG - Intergenic
1031817366 7:126454582-126454604 CTCCAACATTTGTATTTCGAAGG + Intronic
1034097515 7:148423967-148423989 CCCTAACATATGGATTTCAAAGG + Intergenic
1034515223 7:151571760-151571782 CTAAATCGTATGGATTTGAAAGG + Intronic
1035887187 8:3304295-3304317 CTAAGTCTTATTTATTTCAATGG - Intronic
1037446835 8:18973667-18973689 CTCAATCCTAAGTATATGAAAGG + Intronic
1039148347 8:34475665-34475687 CTGAATTCTATGTATATCAAGGG + Intergenic
1040674228 8:49729504-49729526 CTCAATCAGATTTATTTTTAAGG - Intergenic
1040791869 8:51240292-51240314 TTAATTCATATGTATTTTAATGG - Intergenic
1040938609 8:52809007-52809029 CTAAAACATCTGTGTTTCAAAGG - Intergenic
1041866326 8:62578452-62578474 CTCAATAAAATGTGATTCAAGGG + Intronic
1042213150 8:66401807-66401829 CTCAACCATATGTAATTCTCTGG + Intergenic
1043549844 8:81358437-81358459 CTGTATCATTTGTTTTTCAATGG - Intergenic
1044078130 8:87848211-87848233 CTTAAACATATGTATTTTAAGGG + Intergenic
1045774555 8:105787013-105787035 CTCAATAAACTGTATTTCAGTGG + Intronic
1046185935 8:110718144-110718166 CTCATGCATATCTATTTCAGTGG + Intergenic
1046365718 8:113228550-113228572 CTCAATGAAATGTATTTAAAAGG - Intronic
1047676634 8:127209594-127209616 CTCAACCATCTGTATTTGATTGG + Intergenic
1048064496 8:130953824-130953846 CTTCATCATATGTCATTCAATGG - Intronic
1048450510 8:134529350-134529372 CTTAATCAGGTGTATTTTAAGGG + Intronic
1050058199 9:1677796-1677818 CCCATTCATTTGTATTTCATGGG + Intergenic
1051562252 9:18454850-18454872 CCCAACCACATTTATTTCAAAGG + Intergenic
1051572107 9:18570513-18570535 TTTAAACATGTGTATTTCAAGGG + Intronic
1051769343 9:20559263-20559285 CTCATACATATGTTTTGCAAAGG - Intronic
1052125723 9:24772385-24772407 TTCAATCAAATATATATCAAGGG - Intergenic
1055123787 9:72694854-72694876 CTTAATTAAATGTATTTTAATGG + Intronic
1188861293 X:35259682-35259704 CTTCAATATATGTATTTCAAGGG - Intergenic
1189866740 X:45338194-45338216 CTCAATGATCTGTCTTTCAGTGG - Intergenic
1193284032 X:79690889-79690911 GTCAGTCTTATGTAATTCAAAGG - Intergenic
1194482745 X:94446804-94446826 TTCAATCATGTTTTTTTCAAAGG - Intergenic
1195684342 X:107572021-107572043 CGCAATCATATTTATTTGCATGG + Intronic
1195701108 X:107706486-107706508 ATCAATCACAAGTCTTTCAAAGG + Intergenic
1196936698 X:120737477-120737499 CTAAATCATATGTAGATGAAAGG - Intergenic
1197169573 X:123416232-123416254 GTTTATCATATGTAATTCAAAGG + Intronic
1197295026 X:124708227-124708249 CAAAAGCATATGTATTTAAAGGG + Intronic
1199044975 X:143159128-143159150 TTCCAACATATGTATTTCAGGGG + Intergenic
1201924318 Y:19268162-19268184 CTCAAGGATAAGTTTTTCAATGG - Intergenic
1202188475 Y:22215087-22215109 CTCAATAATATTTATGTGAAAGG + Intergenic