ID: 1125456892

View in Genome Browser
Species Human (GRCh38)
Location 15:39869097-39869119
Sequence CCACTTGAACAGAATGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125456892 Original CRISPR CCACTTGAACAGAATGCAGA GGG (reversed) Intronic
902720241 1:18299368-18299390 CCACATGAATAGATTGTAGAAGG - Intronic
902735392 1:18397459-18397481 CCACTGGATCAGAATTCAGGGGG - Intergenic
902987471 1:20163830-20163852 CCCCTTGGTCAGAATGCTGAAGG + Intronic
905073665 1:35250368-35250390 CCACATCAACAGAATGAAGGAGG - Intergenic
906142177 1:43540362-43540384 CCACTTGAGCAGAGTTCTGAGGG + Intronic
906821205 1:48932073-48932095 CCACCTGAGCAGTATGCAGTGGG + Intronic
908710734 1:67011424-67011446 CCACTTGACCAGATTCCACAGGG - Intronic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
910769530 1:90817050-90817072 CTACTTGAATAGAATGGAGTGGG - Intergenic
911388635 1:97210143-97210165 CCAGTTAAACAAAATGAAGAAGG + Intronic
914463763 1:147908563-147908585 CAACATGAACAGGATGAAGATGG - Exonic
916839568 1:168585584-168585606 ACATTTGAACAGACTGCTGAGGG + Intergenic
918019110 1:180667358-180667380 CCACATTAACAGAATGAAGGGGG - Intronic
918550054 1:185732746-185732768 GCACTTGAAAAGAATGCTGTTGG - Intergenic
918887031 1:190207606-190207628 TCACTAGAAGAGAATGGAGAAGG + Intronic
920068609 1:203286898-203286920 CCACTTGTAGAGATTGCAGCTGG + Intergenic
921891419 1:220357770-220357792 CCACTTGAGCCCAATGCAGGGGG - Intergenic
923644885 1:235809202-235809224 CCATTTGAAGAGACTGCAGATGG - Exonic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1063618155 10:7620365-7620387 CCTCTTGAACTTTATGCAGATGG - Intronic
1063905549 10:10776924-10776946 AGACGTGAAGAGAATGCAGAGGG - Intergenic
1064330020 10:14384906-14384928 CCACTTAAACATAATTAAGATGG + Intronic
1067266648 10:44751506-44751528 CCTCTGGAAGAGAATGCTGATGG + Intergenic
1069018306 10:63457176-63457198 CAAATTGAAAAGAATGGAGACGG + Intronic
1069657230 10:70098979-70099001 GCCCTTGACCTGAATGCAGAGGG + Intronic
1070715159 10:78714954-78714976 CTGCTTGAACAAAATTCAGAAGG + Intergenic
1072136730 10:92554210-92554232 CCACATTAACAGAATGAAGGGGG + Intronic
1073465945 10:103694513-103694535 CCACTTAATCAGAATGCTGGGGG + Intronic
1074548987 10:114425985-114426007 ACACTTGAGCAGACTGCAGTGGG + Intergenic
1075838932 10:125480507-125480529 AAAGTTGAACAGAATGCAAAAGG + Intergenic
1076296612 10:129390811-129390833 ACATTTGGACAAAATGCAGAAGG + Intergenic
1086919797 11:92573382-92573404 CCAATAAAACAGAAAGCAGAGGG - Intronic
1087061105 11:93978478-93978500 CCCTTTGAATAGAATTCAGAGGG + Intergenic
1088030678 11:105245568-105245590 CCAATGAAACAGAATGCACAGGG + Intergenic
1089623221 11:119734820-119734842 CCACTTGAAGAGCAGGCAGTTGG + Intergenic
1091229240 11:133977148-133977170 CCACTTGAGCAGAAAGGGGAGGG + Intergenic
1093815911 12:23546366-23546388 GCAGTTAAACAGAATGAAGAAGG - Exonic
1095274086 12:40258905-40258927 TCACTTGACTAGAATGCAGTAGG - Intronic
1095882270 12:47150610-47150632 CCTCTTGAACAGAAGCCTGAAGG + Intronic
1096527744 12:52222266-52222288 CCACAAGAACAGCAAGCAGATGG - Intergenic
1098458637 12:70706013-70706035 CTACTTAAACAGAATGAAAAAGG + Intronic
1099064426 12:77955908-77955930 CTCCTAGAAAAGAATGCAGAAGG - Intronic
1099359268 12:81678889-81678911 GCATTTGAACAGGATGGAGAGGG - Intronic
1099806565 12:87527713-87527735 CCACTGAAACAAAAGGCAGAAGG - Intergenic
1100122112 12:91380750-91380772 CCAGTTGAATAGACTGCTGAGGG + Intergenic
1100795678 12:98179429-98179451 TCACTGTAACAGAATGCAGTGGG - Intergenic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1105285071 13:18996737-18996759 CCACATGGCCAGAAAGCAGAAGG + Intergenic
1105602352 13:21898629-21898651 CCACTGTGACAGAATGCAGCAGG + Intergenic
1106340826 13:28824987-28825009 CCACCTGACCAGAGTGCAGCTGG + Intronic
1108011747 13:46021758-46021780 CTACTTGAACAGAAGACAAAAGG + Intronic
1109266661 13:60208426-60208448 CCACATTAACAGAATGAAGGGGG + Intergenic
1116693915 14:48148371-48148393 ACACTTGTACAGAATAAAGAAGG - Intergenic
1118856844 14:69629651-69629673 CAACTTGAACAGAAACAAGAGGG - Intronic
1119246157 14:73110263-73110285 CCACTTGCCCAGGAGGCAGAGGG - Intronic
1119690592 14:76669019-76669041 CTACTTGAAGAAAATGCATATGG - Intergenic
1120792100 14:88593669-88593691 CCACATGAAAAGAATGAAGTTGG + Intronic
1125456892 15:39869097-39869119 CCACTTGAACAGAATGCAGAGGG - Intronic
1125607946 15:40952892-40952914 GCACTTGAGCGGAATGCGGACGG + Intergenic
1126193684 15:45906224-45906246 GCACTTGAAAATAATGCATAGGG + Intergenic
1126254148 15:46605315-46605337 TCACTGGAACAGAGAGCAGAAGG - Intergenic
1126751693 15:51884312-51884334 CCCCTTGAAAAGCATGCAAAAGG + Intronic
1127973365 15:63979392-63979414 CCACTTGAGCAGAAAGCAGGCGG + Intronic
1128410928 15:67396244-67396266 CCACTGGGTCAGATTGCAGAGGG + Intronic
1130026566 15:80275954-80275976 ACACTTGATCAGGATGCATAGGG + Intergenic
1130066357 15:80608211-80608233 CAACTTGATCAGATTGAAGAAGG + Intergenic
1131621840 15:94076443-94076465 CCAGTTGAAAACAATTCAGATGG - Intergenic
1136358627 16:29763073-29763095 CCACAGGGACAGAAAGCAGATGG - Intergenic
1137514471 16:49131073-49131095 CCACTTAAAGAGAAAGCAGCTGG + Intergenic
1137777835 16:51071324-51071346 CCACAAGAAACGAATGCAGACGG + Intergenic
1138124945 16:54431050-54431072 CCACTTAAAAAGAAAGCAGAGGG - Intergenic
1139431547 16:66913537-66913559 CCCTTTGAAGTGAATGCAGAGGG - Exonic
1139962283 16:70724909-70724931 CCACCTACCCAGAATGCAGATGG - Intronic
1142183966 16:88685794-88685816 TCACCTGAACTGAATGCAGGAGG + Intronic
1142660053 17:1422529-1422551 CAAGTTGCACAGAATGCAGAGGG + Exonic
1145005877 17:19337460-19337482 GCACTTGCACAGAGAGCAGAGGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151054186 17:71012784-71012806 CCACTTGAAGAAAAGGAAGAAGG + Intergenic
1151258453 17:72898080-72898102 CCAAGTGAACTGAATGCAGCAGG + Intronic
1156044962 18:32867704-32867726 CCACCTTAAAAGAATGAAGAGGG - Intergenic
1156332715 18:36139595-36139617 TCACTTGGCCTGAATGCAGATGG - Exonic
1157652215 18:49345109-49345131 CCACTTGATAAGAATACACAAGG + Intronic
1159855835 18:73586524-73586546 ACACTGGAAAAGAAGGCAGAAGG + Intergenic
1160432978 18:78824966-78824988 GCAGTTGAACAGAAAGCAAACGG + Intergenic
1160437826 18:78865446-78865468 GCTCATGTACAGAATGCAGAGGG + Intergenic
1161211398 19:3067926-3067948 TAACAAGAACAGAATGCAGATGG + Intergenic
1167976252 19:53228677-53228699 CTCCTTGAGGAGAATGCAGATGG + Intergenic
1168411768 19:56144708-56144730 CCCCTTGACCACAAGGCAGAGGG - Intronic
925077379 2:1028598-1028620 CCACATGAAGGGAAAGCAGAGGG - Intronic
925801524 2:7606838-7606860 CCACTTGATGAAAATGCACAAGG + Intergenic
926371029 2:12178854-12178876 CCACATGATCAGTAAGCAGAAGG + Intergenic
926977391 2:18528957-18528979 CCCCTAGAACTGCATGCAGAAGG - Intergenic
926986534 2:18630760-18630782 ACACTTGAACAGAGAGCTGAAGG - Intergenic
947047573 2:226005508-226005530 ACACTGCAACAGAATGCAGGGGG + Intergenic
947392298 2:229651664-229651686 ACATTGGAACAGAATACAGATGG + Intronic
949060044 2:241951612-241951634 ACACTTGAAAGGAATGCAGTCGG - Intergenic
1169999555 20:11599423-11599445 CCACATTAACAGAATGAAGTTGG + Intergenic
1170031435 20:11948185-11948207 CCAATTGGACAGTAAGCAGATGG + Intergenic
1173274218 20:41565388-41565410 CCACTTAAAAAGAATCCAGCTGG - Intronic
1175772006 20:61629875-61629897 CCAGCTGAACAGGAGGCAGAGGG + Intronic
1176013760 20:62916940-62916962 CCAGGTGAACAGCATGCACATGG - Intronic
1176258122 20:64164160-64164182 CCACTGGCAGAGAAAGCAGAGGG + Intronic
1177272279 21:18865279-18865301 CCAATGGAACAGAATAGAGAAGG - Intergenic
1178660018 21:34499417-34499439 TCTCTTGAACAGAATCCGGAGGG - Intergenic
1183100098 22:35578638-35578660 CCCCTTGAACTGAAGCCAGAGGG + Intergenic
1184359216 22:44004043-44004065 CCTCTAGAACAGGATGGAGAGGG + Intronic
949257622 3:2067774-2067796 ATACTTGAAAATAATGCAGATGG + Intergenic
950090858 3:10293170-10293192 ACACTTGAAAAGAATGAGGAAGG - Intronic
951545681 3:23822715-23822737 CAGCTTGAACAGAATACAAAAGG - Intronic
952577711 3:34794835-34794857 CTAGTTGAACAGACTGCAGAGGG + Intergenic
956679644 3:71766467-71766489 TCACTTCAACACAATACAGAAGG + Intergenic
957617380 3:82547928-82547950 CCACGTGAATATAATGGAGAAGG + Intergenic
959390778 3:105770586-105770608 TCCCTTGAACAGAATGGGGAGGG + Intronic
960314045 3:116154613-116154635 CCAGTGGAGCTGAATGCAGATGG - Intronic
961842148 3:129723675-129723697 CTATTTGGACAGAATGTAGAGGG - Intronic
964374967 3:156041094-156041116 TCACTTGAACAAATTCCAGAAGG + Intronic
965136052 3:164769870-164769892 CCACTTGAGTTTAATGCAGATGG - Intergenic
965420257 3:168449061-168449083 TGACCTGACCAGAATGCAGATGG - Intergenic
969877408 4:10145996-10146018 CCACTCCAACACTATGCAGAGGG - Intergenic
971362816 4:25952739-25952761 ACACTTCAACAGAATGCTGAGGG + Intergenic
977660809 4:99583201-99583223 TCACTTTAAAAGAATGGAGAAGG - Intronic
979413113 4:120403690-120403712 CCACGGGAACAAAATGCAGTGGG + Intergenic
979783204 4:124682055-124682077 GCACTTAAAAAGAATGCACAGGG + Intronic
981527083 4:145717362-145717384 CCACTTGCAAAGAATGAAAAAGG - Intronic
982058638 4:151579559-151579581 TCACTTGATCAGTATGCAAAAGG + Intronic
983176354 4:164592980-164593002 CAACTTGATCAGACTGCAAAAGG + Intergenic
994275066 5:97826303-97826325 ACACTTAAATAGAATGCATATGG + Intergenic
994435541 5:99726467-99726489 CCACTTGAAAAGAATGAAACTGG + Intergenic
995667990 5:114566427-114566449 TCACTTGAAAAGCATGGAGATGG + Intergenic
995780285 5:115767931-115767953 CCTCTTGCACAGATTGCAGATGG - Intergenic
997025750 5:130058904-130058926 CCACTTGAAGATAAAGCAAAGGG - Intronic
997114633 5:131112774-131112796 CCACTGGAACAGAAGGAAAAAGG + Intergenic
1001466879 5:171975254-171975276 CCACTAGAAAAGAATGGAGCTGG + Intronic
1001546099 5:172571225-172571247 CCAGTTTAACAGGAAGCAGAGGG + Intergenic
1002284159 5:178151255-178151277 ACACTTGAACAGCACGCTGATGG + Intronic
1002863576 6:1101465-1101487 CCACTGTGACAGAATGCACATGG + Intergenic
1003203782 6:3988935-3988957 ACACTTGAACAGAAGACTGAAGG + Intergenic
1003383409 6:5645741-5645763 CCACGTCAACTGAATGCAGCCGG - Intronic
1004488570 6:16092005-16092027 CTTCTTGAACAAAATACAGATGG + Intergenic
1005530144 6:26696035-26696057 CCAGTGGAACAGAATAGAGAGGG + Intergenic
1005540652 6:26805612-26805634 CCAGTGGAACAGAATAGAGAGGG - Intergenic
1005898110 6:30195598-30195620 GCACTGGGACAGACTGCAGAAGG - Intronic
1006558583 6:34889581-34889603 CCACCTGAGCAGACTGGAGAGGG - Exonic
1007193998 6:40043965-40043987 CCACATTAACAGAATGAAGGAGG + Intergenic
1008997146 6:57672485-57672507 GCCTTTGAGCAGAATGCAGAAGG - Intergenic
1009011465 6:57847707-57847729 CCAGTGGAACAGAATAGAGAGGG - Intergenic
1011433618 6:87314628-87314650 CCACTTGCCCAGAATGAAGGTGG - Intronic
1012265167 6:97132764-97132786 CCACTTGAACAAACTTCAAAAGG - Intronic
1015469010 6:133581521-133581543 CCACATTAACAGAATGAAGGGGG + Intergenic
1015493315 6:133853837-133853859 CCACTTTATATGAATGCAGATGG - Intergenic
1020496178 7:8855628-8855650 CCACTGGAGCAGAATTCTGATGG - Intergenic
1021938635 7:25656433-25656455 CCACCTGTACAGAATGCACCAGG + Intergenic
1030512492 7:110500990-110501012 CCACATTAACAGAATGAAGAGGG - Intergenic
1032106136 7:129032081-129032103 CCACATTAACAGAATGAAGAAGG + Intronic
1033321100 7:140340331-140340353 CCACGTGAAAAGAATGAAGTTGG - Intronic
1033712481 7:143962513-143962535 CCACTGGAAATGATTGCAGAAGG + Intergenic
1034116476 7:148588429-148588451 CCACATGCACAGAATACAGAAGG - Intergenic
1034469222 7:151246755-151246777 CCACTTGTCCAGACTCCAGAAGG + Intronic
1035946246 8:3966263-3966285 ATACTTAAACTGAATGCAGAGGG + Intronic
1037161070 8:15772873-15772895 CCACATGAACAGAATGAAGAGGG + Intergenic
1038780137 8:30563135-30563157 CCACAGGAACAGCATGCACATGG - Intronic
1039315714 8:36369357-36369379 CCACTAGAATAGATTCCAGAGGG - Intergenic
1039806810 8:41006981-41007003 CCTTTTGGACAGAATGCAGGAGG - Intergenic
1040487131 8:47884194-47884216 CCACTTGAGGAGAAGGCAGGAGG - Intronic
1042200765 8:66277933-66277955 CCACTGAATCAGATTGCAGAGGG - Intergenic
1042357600 8:67846243-67846265 ACATTTGAACAGAAAGCTGATGG - Intergenic
1042395031 8:68281920-68281942 CCACAGGATCAGAATGTAGAGGG + Intergenic
1043590323 8:81824703-81824725 TAACTTGAACAGAATGTAAAAGG - Intronic
1046273557 8:111927177-111927199 CCACTTATACAGAATCCTGAGGG - Intergenic
1046767666 8:118087589-118087611 CCAGTTGAACAGAATATTGAAGG + Intronic
1048447367 8:134501923-134501945 CCACTTTAAGACAATTCAGATGG + Intronic
1050794350 9:9518725-9518747 CCAGTTTAACAGAATGGACAAGG + Intronic
1052736910 9:32352097-32352119 CCACTGCAACACAAGGCAGAGGG + Intergenic
1056312864 9:85358853-85358875 TCCCTTGAACAGAATTCAGGGGG - Intergenic
1056446852 9:86674686-86674708 ACACTTGAGCAGGAGGCAGAAGG + Intergenic
1057985600 9:99710561-99710583 CCACTGGGATAGAGTGCAGATGG - Intergenic
1057989733 9:99756190-99756212 CCACTTGACCTGAAAGTAGAGGG - Intergenic
1059234316 9:112749695-112749717 CAAATAGAAGAGAATGCAGAGGG - Intergenic
1203779368 EBV:92352-92374 ACACCTGAACAGGATGGAGAAGG - Intergenic
1185793471 X:2945250-2945272 CCACGTGGCCAGAATGCAGCAGG + Intronic
1186001161 X:5012502-5012524 CCAATGGAACAGAAAACAGAAGG + Intergenic
1187027925 X:15455313-15455335 CCAGTTGAAAAGAATGTACAGGG + Intronic
1187994488 X:24910921-24910943 ACACTTGAAAAGAATGTGGATGG - Intronic
1188009801 X:25043608-25043630 ACACTTGAGCACAATGCTGAAGG + Intergenic
1188809323 X:34633434-34633456 GCACTGGAACAGAAGTCAGAAGG + Intronic
1189642036 X:43083276-43083298 GCACTTAAAAAGAATGCAAATGG + Intergenic
1190994076 X:55587477-55587499 TCACATTAACAGAATGCAGGGGG + Intergenic
1192171613 X:68859040-68859062 CCAGTTGAAGAGAAGGCAGTGGG + Intergenic
1193831869 X:86298015-86298037 TCACTTCAATAGAAGGCAGAAGG - Intronic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195253552 X:103071500-103071522 CCACATTAACAGAATGAAGGGGG + Intergenic
1199295374 X:146151703-146151725 ACATTTGAAAAGAATGCACATGG + Intergenic
1199947800 X:152681803-152681825 CCGCTGGACCAGAAGGCAGATGG + Intergenic
1199961879 X:152786651-152786673 CCGCTGGACCAGAAGGCAGATGG - Intergenic