ID: 1125457147

View in Genome Browser
Species Human (GRCh38)
Location 15:39871418-39871440
Sequence CTTCCATCTCTTATCACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125457144_1125457147 -5 Left 1125457144 15:39871400-39871422 CCATTCTTTGTTAATATCCTTCC 0: 1
1: 0
2: 0
3: 30
4: 496
Right 1125457147 15:39871418-39871440 CTTCCATCTCTTATCACACAGGG 0: 1
1: 0
2: 1
3: 14
4: 171
1125457143_1125457147 23 Left 1125457143 15:39871372-39871394 CCATAAAGAAAAAGTGGGGACTA 0: 1
1: 0
2: 1
3: 15
4: 203
Right 1125457147 15:39871418-39871440 CTTCCATCTCTTATCACACAGGG 0: 1
1: 0
2: 1
3: 14
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125457147 Original CRISPR CTTCCATCTCTTATCACACA GGG Intronic
900520970 1:3105355-3105377 CTTCCATCTCTGGACCCACAGGG - Intronic
901538856 1:9901644-9901666 CTTCCATATCCTCTCCCACATGG - Intronic
904569850 1:31455187-31455209 CTTCCATCACTCATCACCCCAGG + Intergenic
907074768 1:51568204-51568226 TTTCCATCTCTGATCTCCCAGGG + Intergenic
907464461 1:54625478-54625500 CTTCCATGCCTTATTACAGAAGG - Intronic
907734902 1:57103109-57103131 CTTCCAGCTGTTAGCACCCAGGG - Intronic
909866635 1:80681467-80681489 CTGCCACCTCTTCTTACACATGG - Intergenic
911984190 1:104600640-104600662 CATCAATCTCTTCCCACACAAGG + Intergenic
912557628 1:110527710-110527732 CTGACATCTGTTATCTCACATGG - Intergenic
913072661 1:115314854-115314876 CTTCCAGCACTTATCACCAACGG - Intronic
913401184 1:118435199-118435221 CTTCCATTTCTTATCTTATATGG - Intergenic
915294446 1:154910237-154910259 CTTCCATCTCCCATCACACCTGG + Intergenic
916210474 1:162356065-162356087 CATTCATATCTTATCTCACATGG + Intronic
921619525 1:217310654-217310676 TTTCCACCTCTGATCCCACAGGG + Intergenic
922098588 1:222463369-222463391 CTTTCATCTCTCATCGCACATGG - Intergenic
1069735887 10:70653973-70653995 CTTCCTTCTCTTAGGACTCAAGG - Intergenic
1072371033 10:94766685-94766707 CTTGCATCTCTTATTTCAGAAGG - Intronic
1074829617 10:117239873-117239895 CAACCATCTCTTCTCACACATGG + Intergenic
1075187782 10:120278321-120278343 CTTCCATCTCTGGCCACACAAGG - Intergenic
1079103495 11:17556263-17556285 CTTCCATTTCTGATGACACAGGG + Intronic
1080860496 11:36146312-36146334 TTGCCATCTCTTATCACTGATGG - Intronic
1081059489 11:38455658-38455680 CTTCCAGCTGTGATCTCACATGG - Intergenic
1081280822 11:41207663-41207685 CTTCCAGGTGTTTTCACACAGGG - Intronic
1084404098 11:68961064-68961086 CTTCACTCTCTGACCACACAAGG - Intergenic
1085275604 11:75296993-75297015 TTTCCATCTTTGATAACACAAGG + Intronic
1085733018 11:79015156-79015178 ATTCCATGTGTTAACACACAGGG - Intronic
1087129065 11:94653199-94653221 CTTCCATCCAATATCACTCATGG - Intergenic
1090070131 11:123536813-123536835 CTTCCAACTCCTGTCCCACAAGG + Intronic
1090147555 11:124341575-124341597 CTTCCTACTCTAAACACACATGG + Intergenic
1090945221 11:131423821-131423843 CTTCCATCTCTTATCTAGGAAGG + Intronic
1093146244 12:15570114-15570136 CTTCCATCTCTTCTGACATATGG - Intronic
1093434395 12:19119345-19119367 CTTCCCTCTGTTACCCCACATGG + Intergenic
1094010085 12:25798848-25798870 CTTTGTTCTCTTATTACACATGG - Intergenic
1094777605 12:33749216-33749238 CCTCCATCACTCATCACTCAAGG - Intergenic
1096776839 12:53969479-53969501 CTTCCACCTCTTCTCAGACTTGG - Intergenic
1096924042 12:55122317-55122339 CTTCCCTCCCTCAACACACAAGG + Intergenic
1097541839 12:60952998-60953020 TATCAATCTCTTGTCACACAAGG - Intergenic
1097683985 12:62675315-62675337 ATTCCATTTTTTAACACACAAGG + Intronic
1098221086 12:68270570-68270592 CCTCAATTTCTCATCACACAGGG + Intergenic
1099896228 12:88650830-88650852 CTTCCTTCTCATATCCCTCATGG - Intergenic
1101437855 12:104679504-104679526 CTTCCTTCTCAAACCACACACGG - Intronic
1103346768 12:120256394-120256416 CTTCTTTCTCTTTTCTCACAGGG - Intronic
1104084990 12:125466253-125466275 GTTCCATCTCCTATCTGACAAGG - Intronic
1105204355 13:18207666-18207688 CTTTCATGTACTATCACACATGG - Intergenic
1106957091 13:34951739-34951761 CTTCCATCTCTTCTCTCACAGGG + Intronic
1107818692 13:44267030-44267052 GCTCCTTCTCTCATCACACAGGG - Intergenic
1109232417 13:59774820-59774842 CCTGCATCTCTTTTCACAGAGGG - Exonic
1111178207 13:84626167-84626189 CTTCCATGTATCATCACACTGGG + Intergenic
1121192931 14:92045790-92045812 TATCAATCTCTTCTCACACAAGG - Exonic
1121286904 14:92743123-92743145 CTACCATCTCATTTCACAGATGG - Intronic
1121980282 14:98448500-98448522 CATCAATCTCTTCCCACACAAGG - Intergenic
1124407245 15:29404003-29404025 CTGCCATCTCTGCTCACACCAGG + Intronic
1125457147 15:39871418-39871440 CTTCCATCTCTTATCACACAGGG + Intronic
1126328071 15:47503793-47503815 CTTCCATTTCTTCCCACACTCGG + Intronic
1126476133 15:49067104-49067126 CTTGCTTATCTTATCAAACAAGG + Intergenic
1127394148 15:58530071-58530093 TTTCCTTCTCTTATCAATCAAGG - Intronic
1127574377 15:60275690-60275712 CTTCCATGTCTTTTCACAGCTGG + Intergenic
1129137029 15:73563285-73563307 CTTTCTTCTCTTATCTCTCATGG - Intronic
1129752141 15:78073410-78073432 ATACCATTTCTTATCACAGAGGG - Intronic
1130112207 15:80975075-80975097 CTTTCAGCTCTTCTTACACATGG - Intronic
1140982896 16:80127612-80127634 CTTCCACCTCTTCCCTCACAGGG - Intergenic
1141407175 16:83804680-83804702 ATTCCATCGCTGCTCACACAAGG + Intergenic
1142815740 17:2423701-2423723 TTCCCATCTCTTCTCACAGAAGG + Intronic
1146744971 17:35320303-35320325 CTACCATCTATGATCACTCAAGG + Intergenic
1147245116 17:39115213-39115235 CTTCCATCTATTCTGACTCAAGG + Intronic
1149611504 17:57960710-57960732 CATCCAGCTATTATCTCACAAGG - Intergenic
1150499523 17:65637201-65637223 CGTCCACCTCTTCTCACACAAGG - Intronic
1152137219 17:78511726-78511748 CTTGCATCTCTAATCACATTTGG + Intronic
1153738970 18:8102861-8102883 CTTTCATGTCTTATTATACACGG - Intronic
1155183678 18:23369664-23369686 CTTCCATGCCTCTTCACACATGG + Intronic
1155360877 18:25000646-25000668 CTTCTTTTTCTCATCACACATGG + Intergenic
1155560896 18:27075714-27075736 CTTACATCTCCTATTAGACATGG + Intronic
1156650474 18:39220322-39220344 CTTGTTTCTCTTATCACTCATGG - Intergenic
1158069880 18:53458482-53458504 GTTACTTCACTTATCACACAGGG + Intronic
1158327434 18:56326632-56326654 CTTGCATGACTTATCACACATGG - Intergenic
1159034980 18:63268047-63268069 TTTGCATCTCTTTTCACGCATGG + Intronic
1160364187 18:78310096-78310118 CTTCCTTCCATTATCTCACAGGG + Intergenic
1163335299 19:16667396-16667418 CTTCCTTCTCTTTCCTCACATGG - Intronic
1164784366 19:30918405-30918427 CTTGCCTCTCATCTCACACATGG + Intergenic
1164960231 19:32421861-32421883 ATTCCATCTCTTAACAAATATGG - Intronic
1165790706 19:38490039-38490061 CCTCCATCTCTCCTCCCACACGG + Intronic
1168211793 19:54896057-54896079 CATCAATCTCTTCCCACACAAGG - Intergenic
925719631 2:6814364-6814386 TTGCCATCTCTTCTCAAACAGGG - Intergenic
925872601 2:8284113-8284135 CTCTCATCTCTTCTAACACATGG + Intergenic
926538859 2:14149999-14150021 CTTCCATCTAATATTACACTGGG + Intergenic
926623599 2:15070675-15070697 ATTCCATCTCTTCTCACACCAGG + Intergenic
930098671 2:47586496-47586518 TATCCATCTCTTCTCACACAAGG - Intergenic
936978599 2:118243141-118243163 CTTCCTTCTCTTTGCACACTGGG + Intergenic
938563288 2:132494123-132494145 CTCCCATCTCTTAACAATCAAGG - Intronic
942455857 2:176137550-176137572 ATTCCATCTCATACAACACAAGG - Intergenic
942502384 2:176605161-176605183 CCTACATCTCTTATCTCAGAGGG + Intergenic
943132711 2:183874733-183874755 CTGCTATATCTTATCAGACAAGG + Intergenic
943880820 2:193141636-193141658 CTTCCTTCCCTCAACACACAGGG - Intergenic
945625138 2:212194830-212194852 CTTCCATCTATTAAGCCACATGG + Intronic
948720007 2:239893592-239893614 CTTCCATCTCTTCTGCCACGTGG - Intronic
1168837322 20:885852-885874 CTTTCTTCTCTTGCCACACATGG - Intronic
1169015119 20:2285787-2285809 CTTCCATATCTTTTCAAATAAGG - Intergenic
1169333925 20:4739552-4739574 ATTCCAGCTCTTATCCCCCAAGG - Intronic
1169335006 20:4748766-4748788 CTCCCCTTTCTTAGCACACAAGG + Intergenic
1172919192 20:38467352-38467374 CTTCCATCTCTTATTCTCCATGG + Intergenic
1175548470 20:59798169-59798191 CTTCCATCTCTTGTCATGTAAGG - Intronic
1176713623 21:10330420-10330442 CTTTCATGTACTATCACACATGG + Intergenic
1180830244 22:18901941-18901963 CTTTCATGTACTATCACACATGG + Intergenic
1181544640 22:23595020-23595042 CTTTCCTCTCTTCTCACCCATGG - Intergenic
1181815673 22:25434875-25434897 CTTTCCTCTCTTCTCACCCATGG + Intergenic
1181815822 22:25436189-25436211 CTTCCATCTCTTGTCAAAGCAGG - Intergenic
1181906389 22:26200554-26200576 CTTCCACCCCTTCTCACATAGGG - Intronic
1181913087 22:26256084-26256106 CTGCCCTCTCTTCTCACAAAAGG + Intronic
1185114134 22:48921646-48921668 CTCACATGTCTTATGACACACGG - Intergenic
1203280333 22_KI270734v1_random:127212-127234 CTTTCATGTACTATCACACATGG + Intergenic
949213535 3:1536151-1536173 CTCCCAGCTCTTATCACAGTTGG - Intergenic
949582167 3:5399370-5399392 CTCCAATCTCCTATCACAAAGGG - Intergenic
949589654 3:5480930-5480952 CTTCCAGTTTTTATCCCACAAGG + Intergenic
949639658 3:6021655-6021677 TTGCTATCTCTTTTCACACATGG + Intergenic
952288129 3:31987956-31987978 CATCCTTCCCTTATCACAAAAGG - Intronic
959406615 3:105968998-105969020 CTACCATCTGTAGTCACACATGG + Intergenic
959469941 3:106737955-106737977 CTTCCTTCTGTGTTCACACATGG + Intergenic
960629161 3:119711701-119711723 ATTCCATCCCTGATAACACAAGG - Intronic
962347865 3:134633749-134633771 CTTTCTTGTCTTATTACACAGGG - Intronic
962696954 3:137959006-137959028 CTTCCATGTCTTACCACTAAGGG - Intergenic
962954022 3:140247777-140247799 GTTCCATCTCTTGCCACATAAGG - Intronic
966182527 3:177199659-177199681 CTTCTATCCCTTATTCCACAAGG + Intergenic
966279657 3:178212207-178212229 TATCAATCTCTTCTCACACAAGG + Intergenic
966651247 3:182303627-182303649 CTTCCATATCTTATCGTAAAAGG - Intergenic
968644941 4:1735676-1735698 CTGCCATCCCCTAACACACACGG - Intronic
975189797 4:71446884-71446906 AATCCCTCACTTATCACACAGGG - Intronic
980590604 4:134882877-134882899 TTTTCATCTCTCATCAAACAAGG + Intergenic
982828207 4:160027000-160027022 CTACCATCTATTTTCACTCAAGG + Intergenic
983739542 4:171111741-171111763 CCTCAATCTCTTAGCTCACAGGG + Intergenic
986129809 5:4918931-4918953 CTTCCATCCAGTAACACACAGGG - Intergenic
988963062 5:36388799-36388821 CATCCATCTCTGTTTACACATGG + Intergenic
988996569 5:36721035-36721057 CTGCCATCTGTTTTCACACTAGG + Intergenic
991813095 5:70490219-70490241 CTGCCACCTCTTACCACTCACGG + Intergenic
991994944 5:72377599-72377621 CATCTATCTCTTCTCACACTTGG + Intergenic
992556603 5:77909608-77909630 GGTCTCTCTCTTATCACACAGGG + Intergenic
993115463 5:83715058-83715080 AATCCATCTGTTCTCACACAGGG + Intronic
994125777 5:96168114-96168136 TATCAATCTCTTCTCACACAAGG - Intergenic
994163204 5:96580079-96580101 CTTCCTTCTCTTTTCCCATAAGG + Intronic
995242859 5:109904654-109904676 CTTCACTCTCTTATTACAAATGG + Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
996538077 5:124599483-124599505 GTTTCATCTCACATCACACACGG - Intergenic
1001038264 5:168313882-168313904 CTTCAATCTCTTATTTCACATGG - Intronic
1002952726 6:1831272-1831294 CTTATATCACTTGTCACACATGG - Intronic
1003919892 6:10823290-10823312 ATTCCATATCTAATAACACATGG + Intronic
1004235639 6:13872620-13872642 GTTCAATCTCTTTGCACACAAGG + Intergenic
1004458939 6:15817721-15817743 CCCCCATCTCCTTTCACACAGGG - Intergenic
1006879226 6:37324740-37324762 CTTACTTCTCTTCTCACACCAGG + Intronic
1007932266 6:45702321-45702343 CTTCTATCCCTGATCACTCAAGG - Intergenic
1008357349 6:50570281-50570303 CTTGCATCTCTAATCATCCATGG - Intergenic
1008786713 6:55176447-55176469 ATTACATCTCTTAAGACACATGG + Intronic
1010312492 6:74403738-74403760 CTTCTATCTCTTTTCCCAAAGGG - Intergenic
1012028700 6:94030259-94030281 CTACCATCTATAATCACTCAAGG - Intergenic
1012036005 6:94140521-94140543 CTTCCATCTCTTATTTCTCTAGG - Intergenic
1015236462 6:130976960-130976982 CTTACAGCCCTTATCACATATGG - Intronic
1015339390 6:132080502-132080524 CCTTCATCACTTATCACATAGGG + Intergenic
1015701012 6:136036226-136036248 CTTTCATCTCTTATCAGAGAGGG + Intronic
1017699488 6:157054522-157054544 CTTCCTACTTTTATAACACAGGG - Intronic
1018570730 6:165206891-165206913 CTGCCATTTCTTATGGCACAGGG - Intergenic
1018882321 6:167896859-167896881 CTTCCTTCTCTTCTCACAGATGG + Exonic
1021072946 7:16265349-16265371 TCCCTATCTCTTATCACACAAGG + Intronic
1024810663 7:53207627-53207649 CTGCCATCTCTTATCCCAGGTGG - Intergenic
1027871024 7:83708848-83708870 CTTCCTTCTCCTCTCTCACAAGG - Intergenic
1028589514 7:92480632-92480654 TATCAATCTCTTCTCACACAAGG - Intergenic
1031336938 7:120546437-120546459 CTTCCTTCTCTTAATTCACAAGG - Intronic
1032664461 7:134021777-134021799 CTTCTTTCTCTTGACACACACGG + Intronic
1037396690 8:18451074-18451096 TTTCCCCCTCTTATCACAAAGGG - Intergenic
1040796244 8:51292593-51292615 CTTCCATCTCCTATTTCAGAAGG - Intergenic
1043777531 8:84288650-84288672 CTTGCATCTCTTCTCATTCATGG - Intronic
1045628228 8:104083070-104083092 CTTCTCTGTCTTCTCACACAGGG + Intronic
1047644669 8:126857522-126857544 CCTCCATCTATCAGCACACATGG - Intergenic
1047962716 8:130022563-130022585 CTCCTATCTCTTATCACATAGGG - Intergenic
1050079027 9:1895354-1895376 CCTCCATGTTATATCACACAAGG + Intergenic
1050171273 9:2820145-2820167 CTTCCCTCTTATTTCACACATGG + Intronic
1050218716 9:3361275-3361297 ATTCCTTCTCTTTTCTCACAAGG - Intronic
1050286826 9:4111795-4111817 CTTCCAAGTCATATCCCACAAGG - Intronic
1053098456 9:35349395-35349417 CTTCCTTCTCTCTTCCCACAAGG - Intronic
1187167431 X:16817527-16817549 TATCCTTCTCTTATCACAAATGG - Intronic
1189256864 X:39646649-39646671 CTTCCAGCTGTGATCTCACATGG - Intergenic
1189752832 X:44240237-44240259 CCTCAAGCTCTTCTCACACAGGG - Intronic
1192527541 X:71860762-71860784 CATCCTTCTCTTTTCACAGATGG + Intergenic
1195134955 X:101896084-101896106 CTTCCTTCTCATATCAAACTTGG - Intronic
1196594606 X:117529349-117529371 CCTCCATTTCTTATCACTAAAGG + Intergenic
1197119729 X:122876117-122876139 CTTCTATATCCTATCACAGATGG + Intergenic
1200950762 Y:8897359-8897381 CTTTCAGCTCTTATCACTCTTGG + Intergenic
1201513275 Y:14788882-14788904 CTTCCATCTTTACTCACCCAGGG + Intronic
1201911546 Y:19138111-19138133 CTTCCATCTCCTATTTCAGAAGG + Intergenic
1202076162 Y:21039877-21039899 TATCAATCTCTTCTCACACAAGG - Intergenic