ID: 1125462139

View in Genome Browser
Species Human (GRCh38)
Location 15:39917630-39917652
Sequence CAAGCCCAGCTGAACTTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 147}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125462135_1125462139 13 Left 1125462135 15:39917594-39917616 CCAAAGTGTTGGGATTACAGGTG 0: 5278
1: 86308
2: 220449
3: 250032
4: 194863
Right 1125462139 15:39917630-39917652 CAAGCCCAGCTGAACTTTTAAGG 0: 1
1: 0
2: 2
3: 14
4: 147
1125462128_1125462139 26 Left 1125462128 15:39917581-39917603 CCACCTCGGCCTCCCAAAGTGTT 0: 4825
1: 102576
2: 192656
3: 133596
4: 67130
Right 1125462139 15:39917630-39917652 CAAGCCCAGCTGAACTTTTAAGG 0: 1
1: 0
2: 2
3: 14
4: 147
1125462132_1125462139 17 Left 1125462132 15:39917590-39917612 CCTCCCAAAGTGTTGGGATTACA 0: 20711
1: 314656
2: 260585
3: 140497
4: 126854
Right 1125462139 15:39917630-39917652 CAAGCCCAGCTGAACTTTTAAGG 0: 1
1: 0
2: 2
3: 14
4: 147
1125462134_1125462139 14 Left 1125462134 15:39917593-39917615 CCCAAAGTGTTGGGATTACAGGT 0: 5541
1: 96600
2: 319290
3: 235104
4: 137727
Right 1125462139 15:39917630-39917652 CAAGCCCAGCTGAACTTTTAAGG 0: 1
1: 0
2: 2
3: 14
4: 147
1125462130_1125462139 23 Left 1125462130 15:39917584-39917606 CCTCGGCCTCCCAAAGTGTTGGG 0: 6468
1: 135481
2: 274928
3: 207474
4: 120415
Right 1125462139 15:39917630-39917652 CAAGCCCAGCTGAACTTTTAAGG 0: 1
1: 0
2: 2
3: 14
4: 147
1125462127_1125462139 27 Left 1125462127 15:39917580-39917602 CCCACCTCGGCCTCCCAAAGTGT 0: 2579
1: 49781
2: 203709
3: 273134
4: 174902
Right 1125462139 15:39917630-39917652 CAAGCCCAGCTGAACTTTTAAGG 0: 1
1: 0
2: 2
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125462139 Original CRISPR CAAGCCCAGCTGAACTTTTA AGG Intronic
900588896 1:3450298-3450320 CATGCCCAGCTGATCCTTTGGGG + Intergenic
907232678 1:53014527-53014549 CCATACCAGCTAAACTTTTAGGG + Intronic
907998778 1:59659496-59659518 CAAGCCGAGCCCAACTTTTGTGG - Intronic
913525074 1:119683488-119683510 CACGCCCAGCTAACTTTTTAAGG - Intronic
914743894 1:150487127-150487149 CAAGGGCAGGTGAACTTTTGAGG - Intergenic
918342069 1:183576219-183576241 CAAGTAAAGCTGAACTTTTCAGG - Intronic
921692393 1:218165392-218165414 CAAGGGCAGCCGAACTTTGAAGG - Intergenic
1063531593 10:6838413-6838435 CAATCCCTGCTTAACTCTTAAGG - Intergenic
1064094858 10:12416786-12416808 TAAGCTCAGCTGAACTGATAAGG - Intronic
1065116427 10:22487758-22487780 CAACCCCAGCTGTACTGTTACGG - Intergenic
1067370416 10:45677263-45677285 CAAGCCCAGCTGAGATCTGATGG + Intergenic
1073819002 10:107238553-107238575 TAAGCCCAGCTCAACCTATATGG + Intergenic
1074596659 10:114874143-114874165 GAAGCACAGCTGAACTTGTTTGG + Intronic
1077870012 11:6253806-6253828 CATGTCCAGCTGAGATTTTATGG + Intergenic
1081284826 11:41255109-41255131 CAAGCCTTGTTGAGCTTTTAGGG - Intronic
1084594475 11:70108801-70108823 CAAGCCCAGCTGTGCTTTTAAGG - Intronic
1085825156 11:79839483-79839505 CAAGTCCGGCTGAAAGTTTAAGG - Intergenic
1086133905 11:83427783-83427805 CAAGGCCAGCTTAGATTTTAGGG + Intergenic
1087183212 11:95159491-95159513 AAAGCCCAGCTGACCATTAATGG - Intergenic
1087726925 11:101729326-101729348 CAAGCCCAAGGGAACCTTTATGG - Intronic
1089043888 11:115481833-115481855 GAAGGCCAGCTGAAATTTTGAGG - Intronic
1089705864 11:120277132-120277154 CATGCCCGGCTAAACTTTTTTGG - Intronic
1092509316 12:9137322-9137344 AAAGACCAGTTGACCTTTTATGG + Intergenic
1093566709 12:20615198-20615220 CTGGCCCAGTTTAACTTTTAAGG + Intronic
1093861595 12:24173423-24173445 CAAGCTCAACTTAACTGTTAGGG - Intergenic
1095207086 12:39450663-39450685 CATGCCCAGCTAATTTTTTAAGG + Intergenic
1095651267 12:44612596-44612618 CTAGCCCTTCTGAAATTTTATGG - Intronic
1100095676 12:91032589-91032611 CAAGCCCAGAACAACTTGTAAGG + Intergenic
1102586238 12:113924931-113924953 CAAGCCCAGCTGCTCTTATGGGG - Intronic
1103156980 12:118693957-118693979 CAACTCCATCTGAACTTTAAGGG + Intergenic
1105009974 12:132749150-132749172 CACGCCCAGCTGATTTTTTTGGG + Intronic
1109466216 13:62735432-62735454 CCATCCCAGCTGAATTTTTAGGG - Intergenic
1110057316 13:70989254-70989276 AAATCCCAGCTGTACTTTGAAGG + Intergenic
1112420088 13:99240750-99240772 CCAGCCCAGCTGAACTGGGATGG - Intronic
1115702600 14:35969374-35969396 CAATCCCAGGTGAACTTTTCTGG + Intergenic
1117679969 14:58193883-58193905 CAAGCCCAGCTTAGGTTCTAGGG - Intronic
1118432094 14:65729180-65729202 CATGCCCAGCTAATTTTTTATGG + Intronic
1120850267 14:89163275-89163297 CAAGCACAGCTTGATTTTTATGG - Intronic
1121238227 14:92409030-92409052 AAAGCCCAGCTCAACATATATGG - Intronic
1122155146 14:99746351-99746373 CAATCCCCTCTGAACTTTTCGGG + Intronic
1124361490 15:29039693-29039715 CAAGCCTAGCTGAACGCTGATGG + Intronic
1125462139 15:39917630-39917652 CAAGCCCAGCTGAACTTTTAAGG + Intronic
1126397665 15:48236010-48236032 CATGCCCAGATAAAATTTTAGGG + Intronic
1127942184 15:63709976-63709998 GAAGCCTAGGAGAACTTTTAAGG + Intronic
1131600996 15:93848671-93848693 CAGACACAGCTGAACATTTAAGG - Intergenic
1134240951 16:12506307-12506329 CAAGCCCAGCTTTTTTTTTAGGG - Intronic
1135529574 16:23240985-23241007 CAAGCCCAGCTGGCCTTATCAGG - Intergenic
1136014785 16:27389281-27389303 CAAACCAAGATGAGCTTTTAAGG + Intergenic
1137558905 16:49490509-49490531 CAAGCCCACAGGAACTTGTAGGG + Exonic
1138034141 16:53585870-53585892 CAGGCCCAGATGATTTTTTAGGG - Intergenic
1138074478 16:54027268-54027290 CAAGCATAGCTGAATTTTTGGGG + Intronic
1138439525 16:57025844-57025866 CAAGTCCTGCTGATCTTTGATGG + Exonic
1140038985 16:71392972-71392994 CAAGCCCAGATTAGCTCTTATGG + Intergenic
1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG + Intergenic
1145837302 17:27964249-27964271 CAAGCCCAGCCGAGCCTGTATGG + Intergenic
1146980897 17:37160589-37160611 CCTGCCCAGCTGAACTTTGATGG - Intronic
1158929114 18:62303635-62303657 AAAGCCCAGCTGAAGTCCTATGG - Intronic
1159333109 18:67027106-67027128 CCGGCCTATCTGAACTTTTAAGG + Intergenic
1159352250 18:67290933-67290955 CAAGGCCAGCAGATCTCTTAAGG - Intergenic
1159456088 18:68661594-68661616 CTAGCCCAGGGGAAATTTTATGG + Intergenic
1160963363 19:1734634-1734656 TCAGCCCAGCTGAACTTGAAAGG - Intergenic
1161477541 19:4494759-4494781 CACGCCCAGCTAATTTTTTAAGG - Intronic
1162923249 19:13916271-13916293 CACACCCAGCTGAGCTTTTTGGG - Intronic
1163225944 19:15961398-15961420 CCAGCCAGGCTGAGCTTTTAAGG - Intergenic
1164256016 19:23528909-23528931 CAAGCCCAGCTAATTTTTTTAGG - Intronic
1165761242 19:38322367-38322389 CAAACACAGCTGGAGTTTTATGG + Intronic
1167573809 19:50307846-50307868 AAAGCACAGCTGAGCTTTTAAGG - Intronic
1167975137 19:53220365-53220387 CAAGCCCAGCTGAATTCATCTGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
939600451 2:144182671-144182693 CATGCCCTGCAGCACTTTTAAGG - Intronic
940498996 2:154470873-154470895 CAAGCCCAGCTCCAGTTCTAGGG + Intergenic
941064781 2:160889718-160889740 CAAGCCCAGATGAAAATTAAAGG + Intergenic
941659462 2:168180749-168180771 AAAGCACAGCTGAAATTTCAAGG + Intronic
944138609 2:196429736-196429758 CAAGCTCAGCAGAACTGCTATGG - Intronic
947537064 2:230946787-230946809 CCAGCCCATCAGACCTTTTAGGG + Intronic
948366566 2:237458848-237458870 CCAGCCCAGCTGAGGTCTTAGGG - Intergenic
1172872028 20:38141942-38141964 CAAATACTGCTGAACTTTTAAGG + Intronic
1173203557 20:40972417-40972439 CATGCCCAGCTTATTTTTTAAGG + Intergenic
1174101807 20:48132347-48132369 CCAGGGCAGCTGATCTTTTAGGG + Intergenic
1181080199 22:20409089-20409111 CACGCCCAGCTAAATTTTTGGGG + Intergenic
1181774888 22:25152290-25152312 CAAGCCCATATGCAGTTTTAAGG + Intronic
1182241274 22:28918193-28918215 CCAGCCCAGCGGCCCTTTTAGGG + Intronic
1184609721 22:45595002-45595024 GAGGACCAGCTGAACTGTTAAGG + Intronic
1184878607 22:47291035-47291057 CCAGCGCAGATGAGCTTTTACGG + Intergenic
1185077158 22:48689706-48689728 CCAGCCCAGCTGTGCTTTCATGG + Intronic
950067860 3:10127628-10127650 CAAGTCCAGGAGAACTTTCAGGG - Intergenic
950971890 3:17197531-17197553 CAAGCCCAGCTAATTTTTTTTGG + Intronic
960598857 3:119434943-119434965 CAAGGCCAGCTGTATTTTTATGG + Intronic
961845881 3:129762623-129762645 CAAGCCCAGCTAATTTTTTTTGG - Intronic
963044606 3:141093546-141093568 CAAGCCCAGCTTAACCTCTCTGG - Intronic
966856968 3:184201051-184201073 CATGCCCATCTGTCCTTTTAAGG + Intronic
967800520 3:193653363-193653385 AAAGCCCAGCTGAACTTCTCTGG - Intronic
969845143 4:9914546-9914568 CAAGCCCAGCTAACCCTTCAAGG - Intronic
969914154 4:10473652-10473674 CAAGAGGAGCTGTACTTTTATGG - Intergenic
970216752 4:13766938-13766960 TCAGCTCAGCTGAACTGTTAGGG + Intergenic
970290187 4:14563518-14563540 CAAGTCCAGCTGAAGAATTATGG + Intergenic
974492060 4:62577676-62577698 CAGGCCCAGATTATCTTTTAGGG - Intergenic
976624928 4:87169568-87169590 CATGCCTAGCTGAATTGTTAAGG - Intronic
976767783 4:88616495-88616517 CTAGCCCAGCTGAAATCTTTGGG + Intronic
978284021 4:107053377-107053399 CATGCCCACCTCAACTCTTATGG - Intronic
983395010 4:167182736-167182758 CAAGACCAGCTTAACTAATATGG - Intronic
983435307 4:167707670-167707692 CAAGCCCAGTTTAAATTCTATGG + Intergenic
983992745 4:174141113-174141135 CAAGCCAAGCTGAACCTCAAAGG + Intergenic
985109997 4:186538921-186538943 CCAGCCCAGGTGGTCTTTTAAGG - Intronic
985316408 4:188662697-188662719 CAAGCCTCGCTGAATCTTTAAGG - Intergenic
986562691 5:9078563-9078585 CATACCCAGCTGAAATTTTCTGG - Intronic
988132498 5:27122363-27122385 TAATCCCAGCTGAAAGTTTATGG - Intergenic
992034379 5:72757899-72757921 CAAGCACAGCTCAAATTTCAAGG + Intergenic
995376868 5:111483943-111483965 CAACCCCAGCTTTGCTTTTAGGG - Intronic
996397722 5:123030233-123030255 CAAGTCCAAGAGAACTTTTATGG - Intronic
999563350 5:152829377-152829399 CATGACCAGCTGAACATATAAGG + Intergenic
1002845959 6:944439-944461 AAAGCACAGCTGAGCTTTTAAGG - Intergenic
1006966299 6:37989202-37989224 CCAGCCTAGCTGAACATTTAAGG + Intronic
1007654227 6:43442571-43442593 CAAGCCCAGCTAAATTTTTTTGG - Intronic
1008004149 6:46392189-46392211 CAAGCCCATCTTTAGTTTTAGGG + Intronic
1013853854 6:114548023-114548045 AAAGCCAAGCTGAAATTGTAAGG - Intergenic
1013888112 6:114995840-114995862 CAAGCCAAGGGGAACTTTTAAGG + Intergenic
1014986705 6:128020249-128020271 CAAGCTGAGCTGAACATTAATGG + Intronic
1018219599 6:161565077-161565099 CTTGCCCAGCTGAAATTTCATGG + Intronic
1019923797 7:4179509-4179531 CAAGCCCAGCGGATTTTTTCCGG + Intronic
1022658816 7:32346952-32346974 CAAGCCCAAGGGAACTTTTAGGG + Intergenic
1022732603 7:33044183-33044205 CAAGCCCAGCTAATTTTGTATGG + Intronic
1025023218 7:55496085-55496107 AAAGTCCAGCTGAACTTTTAGGG - Intronic
1026335643 7:69392320-69392342 CATGCCCAGCTGCACGTTTAAGG - Intergenic
1027460167 7:78441973-78441995 CTAGCCCAGCTGCAGTTTCAGGG + Intronic
1029513660 7:101012669-101012691 CAAGCCCAGCTGCATGTCTAGGG + Intronic
1031775693 7:125906493-125906515 AAAGCTCAGGTGAGCTTTTATGG + Intergenic
1033472436 7:141662215-141662237 CTAGACCAGATGATCTTTTAAGG - Exonic
1034433064 7:151050538-151050560 CAAGCCCAGCTGATCGATGATGG - Exonic
1034981894 7:155484523-155484545 CAAGGCCAGCAGAGCTCTTAGGG + Intronic
1039196361 8:35035901-35035923 CAAGACCACCTGAAGTTTTCAGG + Intergenic
1039853400 8:41391780-41391802 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1040529525 8:48255099-48255121 CAAGCCCAGCTGTACCATTATGG + Intergenic
1041311070 8:56517022-56517044 CAAGCCAAGATGACTTTTTAGGG + Intergenic
1041573046 8:59359305-59359327 AAAATCCAGCTGAACTTTTGTGG + Intergenic
1043463355 8:80482684-80482706 CTGGCCCAGCTGATCTTTGAGGG - Intergenic
1043913880 8:85897736-85897758 CATGCTCAACTGAATTTTTAAGG - Intergenic
1045825857 8:106397254-106397276 AAAGCCCAGCTAATCTCTTAGGG + Intronic
1046218287 8:111179136-111179158 CATGCCCAGCTGAACTCCCAGGG - Intergenic
1047326117 8:123837456-123837478 CCAGCCCCGCTGAGCTTTTCTGG + Intergenic
1048652794 8:136498011-136498033 CACACCCAGCTAAATTTTTAGGG - Intergenic
1049255354 8:141610776-141610798 AGAGCCCAGCTGAACTCATATGG + Intergenic
1050567586 9:6902277-6902299 CATGCCCAGTAGTACTTTTAAGG + Intronic
1051252900 9:15180117-15180139 AAAGATCCGCTGAACTTTTATGG + Intronic
1052494312 9:29208362-29208384 AATGCCCAAATGAACTTTTATGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055797570 9:79992023-79992045 CAAGCCCAGCTGAGCTGCTTTGG - Intergenic
1058138434 9:101333621-101333643 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1187249073 X:17580892-17580914 GAAGTCCAGTTGAACTTTAATGG + Intronic
1188190473 X:27166154-27166176 CTAACCCAGAGGAACTTTTATGG + Intergenic
1189275476 X:39782130-39782152 CAAGCCCAGCTAATGTTTTTTGG + Intergenic
1189349429 X:40265888-40265910 CACGCCCAGCTAAATTTTTTTGG - Intergenic
1193207119 X:78762194-78762216 AAAGCACAGCTGAAATTTCAAGG + Intergenic
1193730563 X:85097492-85097514 CATGCCCAGCTAATTTTTTAAGG + Intronic
1195942538 X:110177887-110177909 AAAGCCCAGCTGTCCTTTGAGGG - Intronic
1197280389 X:124528725-124528747 CAAGCTCAGCAGAACTATTTTGG - Intronic
1199218803 X:145292781-145292803 CAAGCCGTGCTATACTTTTAAGG + Intergenic
1199255126 X:145710708-145710730 CACACCCAGCTGAATTTTTTTGG - Intergenic