ID: 1125462469

View in Genome Browser
Species Human (GRCh38)
Location 15:39920179-39920201
Sequence AACCCCGGCGCCCGGGAGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125462461_1125462469 -3 Left 1125462461 15:39920159-39920181 CCTCACGTCTCCACATCGCCAAC 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1125462469 15:39920179-39920201 AACCCCGGCGCCCGGGAGGCGGG 0: 1
1: 0
2: 2
3: 11
4: 189
1125462458_1125462469 8 Left 1125462458 15:39920148-39920170 CCGACGGGTCCCCTCACGTCTCC 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1125462469 15:39920179-39920201 AACCCCGGCGCCCGGGAGGCGGG 0: 1
1: 0
2: 2
3: 11
4: 189
1125462460_1125462469 -2 Left 1125462460 15:39920158-39920180 CCCTCACGTCTCCACATCGCCAA 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1125462469 15:39920179-39920201 AACCCCGGCGCCCGGGAGGCGGG 0: 1
1: 0
2: 2
3: 11
4: 189
1125462457_1125462469 17 Left 1125462457 15:39920139-39920161 CCGGAGCAGCCGACGGGTCCCCT 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1125462469 15:39920179-39920201 AACCCCGGCGCCCGGGAGGCGGG 0: 1
1: 0
2: 2
3: 11
4: 189
1125462459_1125462469 -1 Left 1125462459 15:39920157-39920179 CCCCTCACGTCTCCACATCGCCA 0: 1
1: 0
2: 1
3: 6
4: 150
Right 1125462469 15:39920179-39920201 AACCCCGGCGCCCGGGAGGCGGG 0: 1
1: 0
2: 2
3: 11
4: 189
1125462454_1125462469 27 Left 1125462454 15:39920129-39920151 CCTGGAGAAGCCGGAGCAGCCGA 0: 1
1: 0
2: 4
3: 19
4: 166
Right 1125462469 15:39920179-39920201 AACCCCGGCGCCCGGGAGGCGGG 0: 1
1: 0
2: 2
3: 11
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125462469 Original CRISPR AACCCCGGCGCCCGGGAGGC GGG Exonic
900102223 1:966727-966749 AGCCTCGGGGCCCGGCAGGCCGG - Exonic
900180545 1:1309135-1309157 GACCCCGGCGTCCGTGCGGCTGG - Exonic
900942301 1:5807658-5807680 AACCCAGGCGTGAGGGAGGCAGG + Intergenic
900979324 1:6037373-6037395 AAACACGGCCCACGGGAGGCAGG - Intronic
902251023 1:15154159-15154181 AGGCGCGGTGCCCGGGAGGCGGG - Intronic
903628225 1:24745977-24745999 GGCCCCGGCGCCCGGGCGGGGGG - Intronic
903652492 1:24930306-24930328 ACCCCCGGGGCCCGCGGGGCGGG + Intronic
906197228 1:43936599-43936621 GGCCCCGGCGCCCAGTAGGCTGG - Exonic
912439482 1:109687667-109687689 AACCCTCGGGCCTGGGAGGCGGG + Intronic
912442789 1:109712107-109712129 AACCCTGGGGACTGGGAGGCGGG + Intergenic
913979636 1:143497651-143497673 AGCCCTGGCGCCGGGGCGGCGGG - Intergenic
915214115 1:154328816-154328838 AGCGCCGGCGGCCGGGAGGATGG + Intronic
915464672 1:156089903-156089925 GACCCAGGCGTCCAGGAGGCGGG + Intronic
920511747 1:206557083-206557105 CACCCAGGCGGCGGGGAGGCGGG + Intronic
922335843 1:224617499-224617521 CTCCCCGGCGCCCGGGACCCGGG - Intronic
922586322 1:226737234-226737256 AGCCCCGGAGCCCCGGGGGCTGG - Exonic
922645652 1:227283937-227283959 AATCCCAGCACTCGGGAGGCTGG + Intronic
922783306 1:228269937-228269959 AACCTCGGCTCCCGGGCGACAGG + Intronic
1063664849 10:8055105-8055127 AGCCCCGGCTCCCGCGAGCCGGG + Intronic
1064662141 10:17617173-17617195 AACGGCGGCGCCTCGGAGGCCGG - Exonic
1067694123 10:48523411-48523433 GGCCCCAGCCCCCGGGAGGCCGG + Intronic
1068396890 10:56473871-56473893 AACCCCAGAGCCTGGGAGCCAGG + Intergenic
1072637123 10:97185437-97185459 AACCTCGGAGCCAGGGAGCCAGG + Intronic
1074188302 10:111115369-111115391 AACCCAGGCACCCTGCAGGCAGG - Intergenic
1075719666 10:124577295-124577317 GACCCCTGTGCCCAGGAGGCTGG - Intronic
1076258377 10:129046341-129046363 TACCCCGGCCCCGGGGAGCCGGG - Intergenic
1077285497 11:1763606-1763628 GAGCCCGGCGCCCCGTAGGCGGG + Intronic
1077361893 11:2144518-2144540 AAACACGGGGCCCGGGAGGAGGG + Intronic
1078454850 11:11467088-11467110 GAACCTGGGGCCCGGGAGGCAGG + Intronic
1079182917 11:18209368-18209390 ATCCCAGTCTCCCGGGAGGCAGG - Exonic
1080007795 11:27428253-27428275 AATCCCAGCTCTCGGGAGGCTGG - Intronic
1080037299 11:27722647-27722669 CACCCCGGCACCCCGGCGGCGGG - Intergenic
1080496936 11:32829865-32829887 AGGCCCGGCCCCCGGGAGGTGGG + Intergenic
1083316338 11:61816860-61816882 AAACCCGGCGCGCAGGCGGCTGG - Exonic
1085444491 11:76591472-76591494 TCTCCCGGCACCCGGGAGGCAGG - Intergenic
1085708160 11:78805335-78805357 AAGCCCGGTGTCCGGGAGGAAGG + Exonic
1089242954 11:117097905-117097927 AGCACCGGCGCCCAGGAGCCGGG - Intronic
1089456715 11:118629997-118630019 AGCCTCGGCACCTGGGAGGCTGG - Intronic
1089800649 11:121024272-121024294 CACCCCTCAGCCCGGGAGGCGGG - Exonic
1096155092 12:49337164-49337186 ACCACCCGCGCCCGGGAGGGAGG - Exonic
1096773352 12:53950169-53950191 AACCCCGGGGCTCGCTAGGCTGG - Intergenic
1101997390 12:109534796-109534818 AGCCCAGGAGCCCTGGAGGCAGG - Exonic
1102305535 12:111801843-111801865 AAGCCCTGTGCCCAGGAGGCAGG - Intronic
1102933509 12:116879591-116879613 ACCCCCGGCGCCCGGGAGCCGGG + Intronic
1103649556 12:122422396-122422418 AAGCCCGGCGTCCGGGAGCGGGG - Intronic
1106247273 13:27960969-27960991 AACCCCGGCGGCTAGGGGGCGGG + Intergenic
1108484461 13:50910144-50910166 AACACGCGCGCCCGGGCGGCGGG + Intronic
1112507702 13:99985114-99985136 CACCGCGGCGGCCGGGAGGAGGG + Intronic
1117911540 14:60642284-60642306 AAGCGCGGGGCCTGGGAGGCAGG + Intergenic
1119519745 14:75277271-75277293 AGCCGCCGCGCCCGGGAGCCAGG - Intergenic
1121127610 14:91417972-91417994 AGCCCGGGAGCCCGGGAGCCCGG + Intergenic
1121570880 14:94945654-94945676 AACCCGTTGGCCCGGGAGGCGGG + Intergenic
1122179811 14:99946820-99946842 GACCCCGGCGTGCGGGAAGCCGG + Intergenic
1122288661 14:100667813-100667835 AGCAGCGGCGCCCGGGAGGCCGG + Intergenic
1122428992 14:101628104-101628126 AACCCCGGCGCCCCAGACCCAGG - Intergenic
1125462469 15:39920179-39920201 AACCCCGGCGCCCGGGAGGCGGG + Exonic
1125508375 15:40280292-40280314 AACGGCGGCGCGCGGGAGTCGGG - Intronic
1126746425 15:51830093-51830115 AACCCGGGCGCCCGGGCCGCGGG - Intronic
1129246776 15:74283657-74283679 AACCCCCTCCCCCTGGAGGCGGG + Intronic
1130291489 15:82605918-82605940 ATCCCCGTTACCCGGGAGGCTGG + Intronic
1131073106 15:89478068-89478090 ATCCCCGGCTCCCAGGAGCCAGG - Intronic
1132586036 16:706073-706095 AACCCCGGCGCGCGGCGGGCGGG + Intronic
1132698492 16:1212355-1212377 ATCCCCAGCGCCCAAGAGGCAGG + Intronic
1132889241 16:2196080-2196102 ACGCCCGCGGCCCGGGAGGCGGG + Intronic
1133243368 16:4429714-4429736 AACCCGGGTACTCGGGAGGCTGG + Intronic
1134456674 16:14400261-14400283 TAACGCGGAGCCCGGGAGGCAGG + Intergenic
1135190281 16:20348825-20348847 AACCCCGGCCCGCAGGAGCCCGG + Exonic
1136480168 16:30536172-30536194 AATCCTGGCGCCTGGGAGGTCGG + Intronic
1136519555 16:30786943-30786965 AACAATGGGGCCCGGGAGGCGGG - Intronic
1137426389 16:48384866-48384888 CCCCCGCGCGCCCGGGAGGCGGG - Intronic
1138532355 16:57641316-57641338 TGCCCTGGCGCCCAGGAGGCTGG + Intronic
1139806224 16:69566696-69566718 CATCCCCGAGCCCGGGAGGCCGG - Intronic
1141429495 16:83964216-83964238 ATCACCTGAGCCCGGGAGGCAGG + Intronic
1142670586 17:1485858-1485880 AGCCCGGCCGCGCGGGAGGCGGG - Intronic
1143483360 17:7239308-7239330 ATCCCCGGCTCCGGGGAGGGGGG - Exonic
1143553086 17:7643454-7643476 AGCCACCGCGCCCGGCAGGCTGG + Intergenic
1148444742 17:47730790-47730812 AGCCCCAGGGCCCGGGAGGAGGG + Intergenic
1148747070 17:49924406-49924428 CCCCCCGGGGCCCGGGAGGAGGG + Intergenic
1149655104 17:58305801-58305823 TATCCCTGGGCCCGGGAGGCTGG - Intronic
1151559284 17:74861899-74861921 AACCCAGGCTCCGGGCAGGCTGG - Intergenic
1152208688 17:78991128-78991150 ACCACAGGCGCCAGGGAGGCAGG - Intergenic
1153688040 18:7566645-7566667 AGCACTGGCGCCCGGGAAGCAGG - Intergenic
1160024931 18:75209229-75209251 TGCGCCGGCGCCGGGGAGGCGGG - Exonic
1160802013 19:974580-974602 GACCCTGGTGCACGGGAGGCGGG - Exonic
1160919698 19:1513696-1513718 AGCCCCGGGGCCCGGCAGGGAGG - Intergenic
1161037970 19:2096100-2096122 AACCCTGGCGGCGGGGAAGCTGG - Intronic
1162728890 19:12705954-12705976 AACCCAGGCTCCCGGGGGGTGGG - Intronic
1162815964 19:13194743-13194765 AACCAAGGCCCCCGGGAGCCTGG + Intergenic
1163243059 19:16076217-16076239 AGCCCCGGGGCCGGGAAGGCGGG + Intronic
1165111558 19:33505415-33505437 AACAGCGCTGCCCGGGAGGCTGG + Intronic
1165845851 19:38817172-38817194 AACCCTGGCTCCCGGGAGGTGGG + Intronic
1166677559 19:44748858-44748880 CAGCGCGGCGCCCGGGAGTCCGG - Exonic
1166797993 19:45439722-45439744 CTCGCCGGCGCCCGGGAGCCCGG + Intronic
1166797998 19:45439730-45439752 CGCCCGGGAGCCCGGGAGGCGGG + Intronic
1167134293 19:47608239-47608261 CACGGCGGCGCCGGGGAGGCGGG - Exonic
1167642249 19:50688230-50688252 AACCCTGGGGCCAGGGAGGGTGG - Intronic
1168716721 19:58532951-58532973 AATCCCAGCTACCGGGAGGCTGG - Intronic
932424187 2:71618913-71618935 AGCCCCAGCGCCTGGGAGCCTGG - Intronic
934566990 2:95346623-95346645 CGCCCCGGCGCCCGCGGGGCTGG + Intronic
935590835 2:104844559-104844581 AGCCCCCGCGCCTGGGAGTCAGG - Intergenic
935653106 2:105398934-105398956 ACCCCCTGCGCCCCGGAGGGAGG - Intronic
936228363 2:110678576-110678598 AGCCGCAGCACCCGGGAGGCAGG + Intergenic
937318858 2:120948752-120948774 AACCCTGGTGCCAGGGAGGCTGG + Intronic
938073215 2:128318985-128319007 AACCCCGGCACTCCGGAGGCGGG - Intergenic
941096673 2:161245122-161245144 AACCTCGGCTCCCGGGCGACAGG + Intergenic
942278557 2:174340380-174340402 AACGCGGGCGCCCGGGCGTCGGG + Intergenic
942314136 2:174682716-174682738 TCCCCCGGCCCCCGGGAGCCCGG + Intronic
946727149 2:222671888-222671910 AGCCCCGCGGCCCGGGGGGCGGG - Intronic
948393137 2:237626972-237626994 GAAGCCGGCGCCCAGGAGGCTGG + Intergenic
949023960 2:241756321-241756343 AACCCCGGAGTCCGGGATGCGGG + Intronic
949065066 2:241985359-241985381 AACCACGGGGCACGTGAGGCCGG - Intergenic
949065077 2:241985413-241985435 AACCACGGGGCACGTGAGGCCGG - Intergenic
949065089 2:241985467-241985489 AACCACGGGGCACGTGAGGCCGG - Intergenic
949065100 2:241985521-241985543 AACCACGGGGCACGTGAGGCCGG - Intergenic
949065112 2:241985575-241985597 AACCACGGGGCACGTGAGGCCGG - Intergenic
949065135 2:241985683-241985705 AACCACGGGGCACGTGAGGCCGG - Intergenic
949065157 2:241985791-241985813 AACCACGGGGCACGTGAGGCCGG - Intergenic
1169198720 20:3697373-3697395 ACCCCCGGCCCCCAGGAGCCAGG + Intronic
1170159152 20:13295094-13295116 GACCCAGGAGCCTGGGAGGCTGG - Intronic
1172992599 20:39047613-39047635 CACCACGGCACCAGGGAGGCTGG - Intergenic
1172996214 20:39072218-39072240 AGCCCCGGCCCCCAGGAGTCAGG - Intergenic
1173166026 20:40687922-40687944 AACTCCGGCTTCAGGGAGGCGGG - Exonic
1174040288 20:47694513-47694535 GAACCCGGCGCCCAGGAGTCAGG + Intronic
1175678735 20:60968951-60968973 AAGCCCAGCCCCCGGGAGCCTGG - Intergenic
1176033273 20:63024054-63024076 GACCCCGGGGCCAGGGAGGGTGG - Intergenic
1176128765 20:63487480-63487502 AGCCCCCGAACCCGGGAGGCTGG - Intergenic
1176178673 20:63739888-63739910 AGCCTCGGCGCCCGGCCGGCCGG + Exonic
1176425938 21:6548218-6548240 AACCCCGGCGACCCGGGTGCCGG - Intergenic
1178561587 21:33643135-33643157 AACGCGGGTCCCCGGGAGGCCGG - Intronic
1179126480 21:38595503-38595525 AACCCCGGGGCCTGTGAGGTTGG + Intronic
1179701429 21:43156535-43156557 AACCCCGGCGACCCGGGTGCCGG - Intergenic
1179968181 21:44818554-44818576 AACCGCGGCGGCAGGGAGGCGGG - Intronic
1181026994 22:20132233-20132255 CACCCCGGTGCCCGGGACGCCGG - Intronic
1181442189 22:22942316-22942338 AACCCCGGGGCCGGGTAGACTGG - Intergenic
1181681031 22:24495795-24495817 AAGCCCGGCTCCGGGGAGGAGGG - Intronic
1183326721 22:37198649-37198671 AGCCCCCGCGCCCGGGAACCCGG + Intronic
1183948604 22:41340405-41340427 GACCCAGGGTCCCGGGAGGCTGG - Intronic
1184079869 22:42211824-42211846 GACCCCAGTGCCCAGGAGGCTGG - Exonic
1184743650 22:46443529-46443551 CACCCCGCCGCCCTGCAGGCGGG + Intronic
1184859627 22:47165755-47165777 ACCCCCGGGGTCCGGGGGGCAGG - Intronic
1185058140 22:48591875-48591897 GGCCCAGGCGCCCGGGATGCTGG - Intronic
950902230 3:16508270-16508292 AATCCCTGCACCCCGGAGGCAGG + Intronic
953214900 3:40908984-40909006 AACCCCAGCCCCAGGAAGGCTGG + Intergenic
961021928 3:123515132-123515154 AACCACGGGGCCTGGGAGACTGG + Intronic
964041819 3:152269501-152269523 AGCCCCGGGGCCAGGGATGCGGG - Intronic
965668432 3:171120912-171120934 GACCCCTGCGCCCTGGAGTCAGG + Intronic
969379044 4:6782585-6782607 AATCCCGGCACCCGGGCGGAAGG + Intronic
975779166 4:77820353-77820375 AAACGCGGCGCACGGGGGGCGGG - Intergenic
976733134 4:88284133-88284155 AAACCCGCCGCCCGGGGCGCAGG + Intronic
981128406 4:141132627-141132649 GACCCCGGGGCCGGGGCGGCGGG - Exonic
983904566 4:173169586-173169608 AACTCCGGCGGCGGGGAGCCGGG + Intronic
985588015 5:750933-750955 GCCCCCAGCGCGCGGGAGGCAGG - Intronic
985602684 5:843400-843422 GCCCCCAGCGCGCGGGAGGCAGG - Intronic
985643723 5:1075324-1075346 AGACCCGGCGCACGGGAGGGCGG - Intronic
986000845 5:3629512-3629534 AGCCCAGGCTCCCGTGAGGCTGG - Intergenic
986065323 5:4229312-4229334 AACCTGGGAGCCCGGGTGGCTGG + Intergenic
986315302 5:6583030-6583052 AGCCCCGACGCCCGAGAAGCGGG - Intergenic
990955823 5:61337159-61337181 AATCCCGCCGCTCGGGAGGCTGG + Intronic
996089889 5:119340408-119340430 ATGCCCTGCTCCCGGGAGGCTGG + Intronic
999188893 5:149731855-149731877 AAGCCCGCCACGCGGGAGGCAGG + Intronic
1001809018 5:174612900-174612922 AACCCTGTCTCCAGGGAGGCTGG + Intergenic
1002281241 5:178131147-178131169 AAGGCTGGGGCCCGGGAGGCCGG - Intronic
1003552187 6:7109011-7109033 ACCCCCCCCGCCCGCGAGGCAGG - Intronic
1006950880 6:37820085-37820107 GGCCTCGGGGCCCGGGAGGCCGG + Intronic
1011470226 6:87701420-87701442 TACCCCGGCGGCCGCGGGGCCGG + Intronic
1013007390 6:106086427-106086449 GACGCGGGCGCCCGGGCGGCCGG + Exonic
1013236323 6:108200241-108200263 ACCCCCGGGGCCCGGGAGGCTGG + Intergenic
1016428533 6:143959088-143959110 CTCCCCGTCGCCCCGGAGGCCGG + Intronic
1019305486 7:332580-332602 GACCCCGGCGCCCGGTGGGAGGG - Intergenic
1019662119 7:2230406-2230428 ACAGCTGGCGCCCGGGAGGCGGG + Intronic
1020035930 7:4963104-4963126 AACCACAGCTCCCAGGAGGCTGG + Intergenic
1020281537 7:6652604-6652626 GGCCCCGCCGGCCGGGAGGCCGG + Exonic
1021231059 7:18086740-18086762 AGCCCCAGCGCCGCGGAGGCTGG - Intergenic
1023876864 7:44291186-44291208 AACCCCAGGGCCAGAGAGGCTGG - Intronic
1027121795 7:75527589-75527611 CCCCCCGGCTCCCGAGAGGCCGG + Intergenic
1029169731 7:98621997-98622019 AACCCTGGGCCCCGGGTGGCAGG - Intronic
1029547391 7:101217488-101217510 GTCCCGGGCGCACGGGAGGCGGG + Exonic
1032165824 7:129543909-129543931 ACACCCAGCTCCCGGGAGGCTGG + Intergenic
1034944525 7:155253368-155253390 AACCCACGCTCCAGGGAGGCTGG - Intergenic
1036770118 8:11572859-11572881 ATGCCCGGCGCCTTGGAGGCTGG + Intergenic
1037882326 8:22579258-22579280 GAGCCCGGCGCCGGGGAGGGCGG - Exonic
1039595479 8:38787214-38787236 CGCCCCGCCGGCCGGGAGGCGGG + Exonic
1039893108 8:41697627-41697649 GGCCCCGGCTCCCAGGAGGCAGG + Intronic
1041240691 8:55846631-55846653 ATCCCCTGAGCCCGGGAGGTTGG + Intergenic
1042253066 8:66775400-66775422 ACCCCGGGGGCGCGGGAGGCAGG + Intronic
1045468392 8:102489672-102489694 CAGCCCTGGGCCCGGGAGGCAGG + Intergenic
1053593179 9:39533856-39533878 GACCCTGGTGCACGGGAGGCGGG + Intergenic
1053850913 9:42288564-42288586 GACCCTGGTGCACGGGAGGCGGG + Intergenic
1054407333 9:64773765-64773787 AACCGCGGCACCGGGGAGGGGGG + Intergenic
1054573128 9:66831421-66831443 GACCCTGGTGCACGGGAGGCGGG - Intergenic
1061666716 9:132164314-132164336 AGGCCCGGAGGCCGGGAGGCTGG - Intronic
1062234167 9:135500153-135500175 AACCCCGTCACCCGGCTGGCGGG - Intronic
1062256687 9:135626465-135626487 AACCCAGGAGCCAGGTAGGCTGG - Intronic
1186496430 X:10015494-10015516 AGGCCCGGCGCCCGGGGCGCGGG - Intergenic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic
1186669820 X:11757803-11757825 GCACCCGGCGGCCGGGAGGCTGG - Intergenic
1187279702 X:17848630-17848652 TACCCCTGCCCCAGGGAGGCTGG + Intronic
1187363763 X:18650358-18650380 AAGCTTGGGGCCCGGGAGGCAGG - Intronic
1187443796 X:19343690-19343712 TCCCGCGGCGCCCTGGAGGCGGG + Intergenic
1187781653 X:22833214-22833236 ATCCCTTGAGCCCGGGAGGCGGG + Intergenic
1187825910 X:23333741-23333763 AGCCCCGGAGCTCGGGAGCCCGG + Intergenic
1189239862 X:39516760-39516782 AGCCCCGGCCCCCGAGAGGCTGG - Intergenic
1200121305 X:153792175-153792197 AACCCCTGAGCCCGAGAGGAGGG + Intronic