ID: 1125465816

View in Genome Browser
Species Human (GRCh38)
Location 15:39951354-39951376
Sequence CGTGCTTAAGAATCCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125465816_1125465819 5 Left 1125465816 15:39951354-39951376 CCCACAGTGGATTCTTAAGCACG 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1125465819 15:39951382-39951404 CATGTATGTGTCATGCTAGCTGG 0: 1
1: 0
2: 2
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125465816 Original CRISPR CGTGCTTAAGAATCCACTGT GGG (reversed) Intronic
904550092 1:31308874-31308896 CGTACCTAATAATCCATTGTTGG - Intronic
905718800 1:40177590-40177612 CGTTCTTAGAAATACACTGTTGG - Intronic
905753542 1:40487221-40487243 GCTGCTCAAGAATCAACTGTAGG - Intronic
907225623 1:52943520-52943542 TGTGCTTAAGAACCCACTATGGG - Intronic
908064734 1:60390449-60390471 GGTGCTTAAGTGTCCACTGGTGG + Intergenic
914371223 1:147025965-147025987 CATGCTTAAGAATCACCCGTGGG - Intergenic
917355393 1:174121819-174121841 TGTGCATAAGCATGCACTGTGGG + Intergenic
1073659729 10:105461603-105461625 CCTGCTCAGGAACCCACTGTGGG - Intergenic
1078656765 11:13247708-13247730 CATGTTTAAGAATCCACTGCAGG + Intergenic
1083573112 11:63770254-63770276 CGTGCTTGAGACTCCACCTTGGG + Intergenic
1089131297 11:116214390-116214412 CATGGTTTAGAATCCATTGTAGG - Intergenic
1089947372 11:122490868-122490890 CGTGCATAAGAATCATCTGGAGG + Intergenic
1095251990 12:39989720-39989742 CTTGCATAAGAATACACTGTAGG + Intronic
1095624225 12:44296165-44296187 TGTGCTTTAGATTCCACAGTTGG + Intronic
1096002351 12:48140393-48140415 CCTGCATCAGAATCCACTGGGGG - Intronic
1099153327 12:79143127-79143149 TGTTCTTAAGAATCCATTTTTGG - Intronic
1101786631 12:107889763-107889785 TGTGCTTCTGAATGCACTGTGGG + Intergenic
1102685400 12:114720944-114720966 AGTGCTTAAGCATCCCTTGTTGG - Intergenic
1108667239 13:52644946-52644968 GGTGCTTAATAATCTAGTGTTGG - Intergenic
1113546799 13:111158233-111158255 TTTGCTTAAGAATTGACTGTGGG + Intronic
1113892571 13:113744084-113744106 CATGCTGGAGAATCTACTGTGGG + Intergenic
1113982705 13:114289591-114289613 TGTGCAGAAGAATCCACTGGAGG - Intronic
1116994630 14:51309869-51309891 CTTTCTTAAGAAACCACAGTGGG + Intergenic
1120772469 14:88396001-88396023 CTTGATTAAAAATACACTGTTGG - Intronic
1125465816 15:39951354-39951376 CGTGCTTAAGAATCCACTGTGGG - Intronic
1125891355 15:43269315-43269337 CCTGCTTAAGATCCCACAGTGGG + Intergenic
1126657754 15:50998328-50998350 TGTGCTTTAGAATCACCTGTGGG + Intronic
1130651150 15:85762885-85762907 CGAGCTCATTAATCCACTGTGGG - Intronic
1132177295 15:99725815-99725837 CCTGCTTGACAGTCCACTGTGGG - Intronic
1139615380 16:68085440-68085462 GGTGCCTAAGCCTCCACTGTCGG - Intronic
1140207986 16:72949073-72949095 AGTGCTTAAGAAAGCACTTTAGG - Intronic
1141721038 16:85755411-85755433 GCTGCTTAAGAAACCATTGTTGG - Intergenic
1144302195 17:13931973-13931995 CTTGCGTAAGAATCCCCTGGAGG - Intergenic
1153375880 18:4378593-4378615 AGTGCTTAAGAATCCATGGTGGG + Intronic
1153903464 18:9639385-9639407 CATGCTTTAGAATCCCCTGGAGG + Intergenic
1156797826 18:41069721-41069743 TTTTCTTAAGAATCCCCTGTCGG + Intergenic
1163695054 19:18759867-18759889 TGTGCTTGGGAAACCACTGTTGG - Intronic
1165488146 19:36107840-36107862 CCTGGTTAAGAAGCCACTGCTGG + Intergenic
933503938 2:83153806-83153828 TGTGCATTAGAATCAACTGTAGG + Intergenic
941072765 2:160972836-160972858 TGGGCTTAATAATACACTGTTGG - Intergenic
946994247 2:225373004-225373026 CTTGGTTAAGAAAACACTGTGGG + Intergenic
1170321329 20:15101651-15101673 CATGCTTAAAAATCCAGAGTTGG - Intronic
1173183142 20:40819685-40819707 AGTGCGTAAGACTCCATTGTGGG - Intergenic
1173837523 20:46135712-46135734 GGTGCATAGGATTCCACTGTAGG + Intergenic
1175700074 20:61130572-61130594 GGGGCTGAAGAATCCACTGTGGG - Intergenic
1177273347 21:18876536-18876558 CCTGGTTAAGAATCCTCTTTGGG + Intergenic
952246245 3:31595781-31595803 CCTGCTACTGAATCCACTGTGGG + Intronic
953323991 3:41996961-41996983 CTTACTTAAGAATACACAGTAGG - Intergenic
954426357 3:50445275-50445297 CCTGGTTCAGAGTCCACTGTGGG - Intronic
954992649 3:54854546-54854568 TGTGCTTATGAATCCCCTTTGGG + Intronic
980972110 4:139576540-139576562 CGTGCTTCAGAATCACCTGGGGG + Intronic
983327642 4:166278643-166278665 CCCACTTAAGATTCCACTGTGGG - Intergenic
987269483 5:16291529-16291551 TTTGCTTCAGGATCCACTGTGGG + Intergenic
988772983 5:34450431-34450453 CATGCATCAGAATCCCCTGTGGG + Intergenic
989598009 5:43175065-43175087 TCTGCTTCAGAATCCACTGTTGG - Exonic
999722304 5:154407806-154407828 AGTGCTGAAGAGTCCACAGTGGG - Intronic
1002643578 5:180641906-180641928 CATGGTTAAGAATAAACTGTCGG + Intronic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1012257549 6:97051086-97051108 TGTGCTGAGGAACCCACTGTGGG + Intronic
1015217560 6:130767641-130767663 CCTTCCAAAGAATCCACTGTGGG + Intergenic
1016568761 6:145489676-145489698 TCAGCTTCAGAATCCACTGTTGG + Intergenic
1021694356 7:23261881-23261903 AGTCCTTAAGAGTCCACTTTGGG + Intronic
1041159660 8:55026578-55026600 CCTGCTTAAGAACACCCTGTAGG - Intergenic
1044426122 8:92052654-92052676 TATGCTTAAGAATCCTCTGAGGG + Intronic
1050250723 9:3741619-3741641 CGTGCTTCAGAATCCTCTGCAGG + Intergenic
1057062211 9:92015937-92015959 CTTGCTTAAGAAAGCAGTGTGGG + Intergenic
1058905680 9:109480869-109480891 GGTGCTCAATAATTCACTGTGGG + Intronic
1059294904 9:113261666-113261688 CGTGCATCAGAATCACCTGTAGG + Exonic
1187562487 X:20415639-20415661 CGTGCATCAGAATCCCCTGGAGG - Intergenic
1189380138 X:40496874-40496896 TGTGCTTAAAAACCCACTGCCGG - Intergenic