ID: 1125465816

View in Genome Browser
Species Human (GRCh38)
Location 15:39951354-39951376
Sequence CGTGCTTAAGAATCCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125465816_1125465819 5 Left 1125465816 15:39951354-39951376 CCCACAGTGGATTCTTAAGCACG 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1125465819 15:39951382-39951404 CATGTATGTGTCATGCTAGCTGG 0: 1
1: 0
2: 2
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125465816 Original CRISPR CGTGCTTAAGAATCCACTGT GGG (reversed) Intronic