ID: 1125465819

View in Genome Browser
Species Human (GRCh38)
Location 15:39951382-39951404
Sequence CATGTATGTGTCATGCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125465814_1125465819 10 Left 1125465814 15:39951349-39951371 CCCGACCCACAGTGGATTCTTAA 0: 1
1: 0
2: 3
3: 43
4: 345
Right 1125465819 15:39951382-39951404 CATGTATGTGTCATGCTAGCTGG 0: 1
1: 0
2: 2
3: 10
4: 104
1125465816_1125465819 5 Left 1125465816 15:39951354-39951376 CCCACAGTGGATTCTTAAGCACG 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1125465819 15:39951382-39951404 CATGTATGTGTCATGCTAGCTGG 0: 1
1: 0
2: 2
3: 10
4: 104
1125465815_1125465819 9 Left 1125465815 15:39951350-39951372 CCGACCCACAGTGGATTCTTAAG 0: 1
1: 0
2: 0
3: 10
4: 179
Right 1125465819 15:39951382-39951404 CATGTATGTGTCATGCTAGCTGG 0: 1
1: 0
2: 2
3: 10
4: 104
1125465813_1125465819 15 Left 1125465813 15:39951344-39951366 CCACGCCCGACCCACAGTGGATT 0: 1
1: 0
2: 1
3: 35
4: 372
Right 1125465819 15:39951382-39951404 CATGTATGTGTCATGCTAGCTGG 0: 1
1: 0
2: 2
3: 10
4: 104
1125465811_1125465819 18 Left 1125465811 15:39951341-39951363 CCACCACGCCCGACCCACAGTGG 0: 1
1: 0
2: 17
3: 169
4: 1166
Right 1125465819 15:39951382-39951404 CATGTATGTGTCATGCTAGCTGG 0: 1
1: 0
2: 2
3: 10
4: 104
1125465817_1125465819 4 Left 1125465817 15:39951355-39951377 CCACAGTGGATTCTTAAGCACGC 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1125465819 15:39951382-39951404 CATGTATGTGTCATGCTAGCTGG 0: 1
1: 0
2: 2
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125465819 Original CRISPR CATGTATGTGTCATGCTAGC TGG Intronic