ID: 1125466288

View in Genome Browser
Species Human (GRCh38)
Location 15:39956298-39956320
Sequence GTTATAAAGGGGAATGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 353}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125466288 Original CRISPR GTTATAAAGGGGAATGAGGC TGG (reversed) Intronic
901971706 1:12913677-12913699 GAAATAAAGGGGAAGGAGGGAGG - Intronic
902013462 1:13288063-13288085 GAAATAAAGGGGAAGGAGGGAGG + Intergenic
903751199 1:25621982-25622004 TTTATAAAAGGGAATTAGGCTGG + Intronic
904910747 1:33932376-33932398 GTATTTAAGGGGAATGAGGGTGG + Intronic
905676087 1:39826171-39826193 GATATAAAAAGGAAAGAGGCCGG + Intergenic
905768045 1:40619610-40619632 GTTATTAAGGGAAATGATCCTGG - Intergenic
905991101 1:42337432-42337454 GTTATTAAGGAGGCTGAGGCAGG + Intergenic
906606734 1:47178010-47178032 GAGAAAAAGGGGAATGAGACAGG - Intergenic
906730366 1:48075690-48075712 ATTATAAAAGGGCGTGAGGCTGG - Intergenic
908143819 1:61216701-61216723 TCTAAAAAGGGGATTGAGGCTGG + Intronic
908344750 1:63220783-63220805 GCTATAAAAAAGAATGAGGCCGG + Intergenic
908933191 1:69341305-69341327 TTTATAAAGGGGAGTTCGGCCGG + Intergenic
909206409 1:72763373-72763395 GTTGTAAAGAAGAAAGAGGCAGG + Intergenic
909752889 1:79185791-79185813 GTCTTAAAGGGGAAAGAGGAGGG - Intergenic
910859539 1:91730424-91730446 GATAGAAAGGGGATTGAGGAAGG - Intronic
911187885 1:94921541-94921563 GTTAAAGAGGGAAAGGAGGCAGG + Intronic
912032488 1:105265877-105265899 GTTAGAAAGGAGAAGGAGGTGGG - Intergenic
912792188 1:112663257-112663279 ATTCAAAAGGGGAATGAGCCGGG - Intronic
912889875 1:113518584-113518606 CTAATAAATGGGAATGAGGATGG - Intronic
914262721 1:146012365-146012387 CTTACAAAGGGGTATGAAGCAGG - Intergenic
914868994 1:151458347-151458369 TTTATAAAATGGAATGAGGCGGG - Intronic
915524915 1:156469772-156469794 GTTATTCAGGGGGCTGAGGCAGG + Intronic
915803066 1:158815321-158815343 GTTGTATAGGGCAATGAGCCTGG - Intergenic
916483132 1:165233341-165233363 GTTATTCAGGAGTATGAGGCAGG + Intronic
917150564 1:171939603-171939625 TTTCTAAATGGGAATGAGGAAGG - Intronic
918615348 1:186537966-186537988 GATATAAAAGGGTATTAGGCTGG + Intergenic
920553833 1:206889246-206889268 ATTTTAAAGGGGAATGAAACTGG + Intergenic
920726309 1:208438388-208438410 GGTATTAATGGGAATGAGACAGG + Intergenic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
922093153 1:222416857-222416879 GTCATGAAGGGGAAAGAGACAGG + Intergenic
922605871 1:226889569-226889591 GTAATAATGGAAAATGAGGCTGG - Intronic
922994681 1:229946136-229946158 CCTAGAAAGAGGAATGAGGCCGG + Intergenic
923037614 1:230295564-230295586 GGTATAAAGCCGAGTGAGGCAGG + Intergenic
923547888 1:234937485-234937507 GCTACAAAGGAGGATGAGGCAGG - Intergenic
923660030 1:235949937-235949959 GCTATTCAGGGGGATGAGGCAGG - Intergenic
923924622 1:238610652-238610674 GTTCTAAAGGAGAATGAGAGTGG + Intergenic
1063475333 10:6323477-6323499 GTGAGAAAGGGGCATGAGGCTGG - Intergenic
1064552084 10:16512671-16512693 GTAACAAAGAGGAATGAGCCAGG + Exonic
1064759233 10:18601684-18601706 CTTATAAAAGGAAATAAGGCTGG + Intronic
1065539558 10:26748652-26748674 GTTATAAAGAAGAATGATGATGG - Exonic
1066626313 10:37409443-37409465 GCTACAAAGAGGACTGAGGCAGG - Intergenic
1069550163 10:69358563-69358585 GTCTTAAAAAGGAATGAGGCTGG + Intronic
1069937867 10:71931178-71931200 TTTATAAAGTAAAATGAGGCTGG + Intergenic
1070738514 10:78884893-78884915 GCAATAAAGAGGGATGAGGCTGG + Intergenic
1071040416 10:81302172-81302194 GTTTTCAAGGGGAATGTTGCTGG - Intergenic
1071245873 10:83762063-83762085 TTTATAAAGTGAATTGAGGCGGG - Intergenic
1071541128 10:86485094-86485116 GTTATAGATGGGAAGGAGGGGGG - Intronic
1073610481 10:104938216-104938238 TTTATAACCTGGAATGAGGCTGG + Intronic
1073649755 10:105345587-105345609 GTTAGAAGGGGGCATGAGGGAGG - Intergenic
1075301243 10:121326397-121326419 TTTATAAAGGGGCATTAAGCAGG + Intergenic
1075344951 10:121675149-121675171 GATATAAATGGGAAGTAGGCAGG - Intergenic
1076088128 10:127653785-127653807 GTTTGAAATGGGAATGAGGATGG - Intergenic
1076398097 10:130156290-130156312 ATTATAAAAGGGTTTGAGGCTGG - Intronic
1076710406 10:132330904-132330926 TTTAAAAAGTGGAATCAGGCCGG + Intronic
1076822800 10:132948764-132948786 CTTATCAAGGGGAAGGAGGTAGG - Intergenic
1077764366 11:5142105-5142127 GTTATAAGGGGAGCTGAGGCAGG - Intergenic
1078169667 11:8919931-8919953 GTTAAAAAAGGCACTGAGGCCGG - Exonic
1078710422 11:13785741-13785763 GCTACACAGGGGACTGAGGCGGG + Intergenic
1079010912 11:16827507-16827529 GCTATAAAGGAGAATGGGGAGGG + Intronic
1081208814 11:40306786-40306808 GTTATAAAGGGTAATGAATGGGG - Intronic
1081859169 11:46322554-46322576 ATTAAAAAGGGAGATGAGGCCGG + Intergenic
1081916012 11:46730615-46730637 GTTATTGAGGGGCTTGAGGCAGG + Intronic
1082961831 11:58925355-58925377 GTTATAAAAGGGATTCATGCAGG - Intronic
1084607699 11:70182092-70182114 GTTGGAGAAGGGAATGAGGCAGG - Intronic
1087660700 11:100984647-100984669 TTTAGAATGAGGAATGAGGCTGG + Intronic
1088105140 11:106198370-106198392 GTTATAAAGGAATATGAAGCTGG - Intergenic
1090091269 11:123700603-123700625 GTTTTCAAGGGGAATGAGGGAGG + Intergenic
1090445765 11:126763461-126763483 GTTAAAAAGGGGACTGATGGTGG + Intronic
1092034005 12:5315006-5315028 TTTAAAAAGGGGAAAGAGGAAGG - Intergenic
1092756775 12:11770786-11770808 GTTATTCAGGAGACTGAGGCAGG + Intronic
1093582868 12:20804270-20804292 TTTACACAGGGGAATGAGGTTGG + Intergenic
1095445219 12:42275894-42275916 GTTATAAAGGAACCTGAGGCTGG - Intronic
1096687383 12:53297489-53297511 GGCATTAAGGGAAATGAGGCTGG + Intronic
1096764344 12:53871128-53871150 GTTTTAAAGAGTAAGGAGGCTGG + Intergenic
1097236409 12:57543051-57543073 GTTAAGAAGGTGACTGAGGCTGG + Intronic
1097420505 12:59372804-59372826 GTTAAAAAGGAAAAGGAGGCCGG - Intergenic
1097759783 12:63449784-63449806 TTTAAAAAGTGGAAAGAGGCTGG + Intergenic
1099300993 12:80893992-80894014 GTGATAAATGGATATGAGGCTGG + Intronic
1099875290 12:88397108-88397130 GTTGTAAATGGGATTGAGTCTGG - Intergenic
1100208936 12:92381313-92381335 GCTATTCAGGGGACTGAGGCGGG - Intergenic
1102501285 12:113354364-113354386 GCTATAAAAAAGAATGAGGCCGG - Intronic
1102698643 12:114819543-114819565 GTTAAAAAAGTAAATGAGGCCGG + Intergenic
1102768045 12:115450613-115450635 AGGATAAAGGGGAATGAAGCAGG + Intergenic
1102808499 12:115803207-115803229 GTAATGAAGGGGAAGAAGGCAGG - Intergenic
1102841799 12:116132806-116132828 GTTATTCAGGAGACTGAGGCAGG + Intronic
1104449449 12:128857272-128857294 GCTACAAAGGGGAAGGAGGCGGG + Intronic
1104532339 12:129583699-129583721 CTTAGACAGAGGAATGAGGCGGG + Intronic
1104737896 12:131150434-131150456 TCTATAAAGGTGAATGAGGTTGG - Intergenic
1105325588 13:19367974-19367996 GATAAAAAAGGAAATGAGGCTGG - Intergenic
1105867914 13:24477181-24477203 GATAAAAAAGGAAATGAGGCTGG + Intronic
1106813767 13:33385521-33385543 GAGATAAAGGGGAATGAGAAGGG + Intergenic
1107311795 13:39086381-39086403 TTTATAAAGGGGAGTGGGGGTGG + Intergenic
1108751112 13:53449388-53449410 GTAATAAAGGGGAATGAAAAGGG + Intergenic
1108898073 13:55360442-55360464 GCTATTCAGGGGACTGAGGCAGG - Intergenic
1109259829 13:60131131-60131153 GCAATAAAAGTGAATGAGGCTGG + Intronic
1109697957 13:65985640-65985662 GATTAAAAAGGGAATGAGGCCGG + Intergenic
1109953470 13:69533830-69533852 CTTATAAATGGGAGTGAGGTAGG + Intergenic
1114212503 14:20627038-20627060 GTCAAAAAGTGGCATGAGGCTGG - Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1116449822 14:45051669-45051691 GTTATTCAGGAGACTGAGGCAGG - Intronic
1117241185 14:53835546-53835568 GTTATAAAGTGAAATGATGATGG + Intergenic
1117324642 14:54658010-54658032 GTTTTAAAAGAGAATGTGGCCGG + Intronic
1117370883 14:55077470-55077492 GTGATAAAGGGGAAAGAGCATGG - Intergenic
1118280670 14:64425505-64425527 GTTAGAAAGGGAAAACAGGCCGG - Intronic
1118362975 14:65071438-65071460 GTTAAAATGTGGAATGAAGCTGG - Intronic
1118571673 14:67200439-67200461 ATTAAAAAGGGGAATGGGGTGGG - Intronic
1118824316 14:69366672-69366694 ATTATAAAGGAGTATGAGGCAGG - Intergenic
1119673028 14:76533958-76533980 GGTATAAATGGGAATCAGACAGG - Intergenic
1121059685 14:90895208-90895230 TTTTAAAAGGGTAATGAGGCTGG + Intronic
1121118755 14:91362311-91362333 GTTGGAAAGGGGATTGTGGCTGG - Intronic
1121161075 14:91741450-91741472 GTTACTCAGGAGAATGAGGCAGG + Intronic
1122128803 14:99593379-99593401 GTTTTGAAGGGGACAGAGGCAGG - Intronic
1122356228 14:101124516-101124538 GACATAAAGGGGACTGGGGCTGG - Intergenic
1125466288 15:39956298-39956320 GTTATAAAGGGGAATGAGGCTGG - Intronic
1127054680 15:55119334-55119356 ATTAAAAAGGGTAATCAGGCTGG - Intergenic
1127421725 15:58812925-58812947 GATATAAAAGGGCATCAGGCGGG - Intronic
1129310497 15:74705023-74705045 GTCATGAAAAGGAATGAGGCTGG + Intergenic
1129442178 15:75589268-75589290 GTCATAAAAAAGAATGAGGCCGG + Intergenic
1129744290 15:78007454-78007476 GGGATACAGGGGAAGGAGGCAGG + Intronic
1129858005 15:78838755-78838777 GACATAAAGGGGAATGTGGCAGG - Intronic
1130096173 15:80857821-80857843 GCTACAAAGGGTATTGAGGCAGG + Intronic
1130789754 15:87141381-87141403 GTTAGAAATAGGAAAGAGGCAGG - Intergenic
1131650258 15:94390839-94390861 GTTATTCAGGAGACTGAGGCAGG - Intronic
1132058477 15:98670412-98670434 GTTGTAGTGGGGGATGAGGCTGG + Intronic
1132191434 15:99865593-99865615 GCTATTAAGGGGACTGAGGCAGG + Intergenic
1135350016 16:21721024-21721046 GTTAGACAGGAGACTGAGGCAGG - Intronic
1137230513 16:46561493-46561515 GCTATTCAGGAGAATGAGGCAGG + Intergenic
1137498888 16:48995354-48995376 TTAATAAAGAGGAATGAGGAGGG + Intergenic
1138256086 16:55562653-55562675 GTTACAAAGGTGAATAAAGCAGG - Intronic
1138652729 16:58470793-58470815 GCTATGAAGGGGGCTGAGGCAGG + Intronic
1138826897 16:60331830-60331852 CTTCTAAAGGGGCCTGAGGCAGG + Intergenic
1139260159 16:65584207-65584229 CTTATAAAGGGGCTTGAGGGAGG - Intergenic
1142579139 17:930135-930157 GTTAAAAAGGGGACTCAGGCTGG + Intronic
1142834449 17:2574419-2574441 GTCATAAAAAGGAATAAGGCCGG - Intergenic
1143907805 17:10223534-10223556 CTTATAAAAGGGAAGCAGGCTGG - Intergenic
1146526504 17:33571499-33571521 GTTATCAATGGGTTTGAGGCTGG - Intronic
1146757693 17:35448178-35448200 GTTAAAAAGCAGAATTAGGCCGG - Intronic
1146860697 17:36295580-36295602 GTGATAGAGGGGAAATAGGCAGG - Intronic
1147091025 17:38099675-38099697 GTGATAGAGGGGAAATAGGCAGG - Intergenic
1147106186 17:38220829-38220851 GTGATAGAGGGGAAATAGGCAGG + Intergenic
1147467078 17:40618500-40618522 GTTACTAGGGAGAATGAGGCAGG + Intergenic
1147546049 17:41402630-41402652 AATAGAAAGGGGAATAAGGCTGG + Intergenic
1148423320 17:47567687-47567709 GTGATAGAGGGGAAATAGGCAGG - Intronic
1149345668 17:55732636-55732658 GTTTTAAAGAGGGGTGAGGCCGG - Intergenic
1149466385 17:56883225-56883247 GTGTTCAAGGGGAATCAGGCTGG + Intergenic
1149556191 17:57575124-57575146 GTTAAAAAAGAGAATGCGGCCGG - Intronic
1150579710 17:66461092-66461114 GCTACTCAGGGGAATGAGGCAGG + Intronic
1150691054 17:67367270-67367292 CTTGAAAATGGGAATGAGGCCGG + Intergenic
1151508749 17:74545619-74545641 GTCATAGAGGGGAGTGGGGCAGG - Intronic
1152622306 17:81371279-81371301 GTTATTCAGGGGGCTGAGGCAGG + Intergenic
1152790979 17:82279520-82279542 GTCATAAAAAAGAATGAGGCCGG + Intergenic
1153201128 18:2648854-2648876 GTTAAAACTGGGAATGAGTCTGG + Intergenic
1153589458 18:6658201-6658223 GCTATACAGGAGACTGAGGCAGG + Intergenic
1154406176 18:14093295-14093317 GTTTTAAAGGAGAAAGCGGCAGG - Intronic
1156426241 18:37016077-37016099 GTTATCAAGGGGAATGCTTCCGG + Intronic
1156976499 18:43227845-43227867 CTCATAAAGGGTAGTGAGGCAGG - Intergenic
1157131991 18:45015711-45015733 GTGATAAAAGGCAATGAGGGAGG + Intronic
1157892967 18:51436368-51436390 TTAATAATGGGGAATGAGGGCGG + Intergenic
1158283199 18:55850343-55850365 GTTGAAGACGGGAATGAGGCAGG + Intergenic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1161143959 19:2665975-2665997 GCTATATGGGGGACTGAGGCAGG - Intronic
1161427507 19:4211902-4211924 CTAATAAATAGGAATGAGGCCGG + Intronic
1162991423 19:14305062-14305084 GTCATTAAGCAGAATGAGGCAGG - Intergenic
1163142017 19:15356102-15356124 TTTAAAAAAGGGCATGAGGCCGG + Intronic
1163929216 19:20372716-20372738 GTTATAAAGGGAATTTATGCAGG + Intergenic
1164008256 19:21172314-21172336 GCTATACAGGAGACTGAGGCAGG + Intronic
1166550606 19:43663483-43663505 ATTAGAAATGGGGATGAGGCCGG + Intronic
1166702333 19:44889267-44889289 GACATGAAGGGGAATGAGGAAGG + Intergenic
1167326951 19:48832546-48832568 GCTAGAAAGAGGTATGAGGCAGG + Intronic
1167691926 19:50990683-50990705 GTTAGAAAGAGGAAGGAGCCAGG + Intergenic
1168294154 19:55370487-55370509 GTTATATAGGGGGCTGGGGCGGG + Intergenic
1168568686 19:57445815-57445837 GCTATTCAGGGGACTGAGGCAGG + Intronic
925356498 2:3245507-3245529 TTTAAAATGGGGAATGAGGCTGG - Intronic
925374890 2:3377423-3377445 GATGTGAAGGGGAAGGAGGCAGG + Intronic
926907890 2:17823020-17823042 GTTATTCAGGGGACTGAAGCAGG - Intergenic
927495702 2:23550166-23550188 GGTATAATGGGGAAGGAGGTGGG + Intronic
928438883 2:31274903-31274925 GTTATAAGGTGGCATCAGGCAGG - Intergenic
929651031 2:43679605-43679627 GTTATTCAGGAGATTGAGGCAGG - Intronic
929934312 2:46283288-46283310 GTTATAAAAGGGAATGACACTGG + Intergenic
930206257 2:48589056-48589078 ATTATTAAGGGGAATGAGAGTGG + Intronic
930668776 2:54125783-54125805 ATTAAAAAGGGGATTCAGGCTGG + Intronic
931003800 2:57824014-57824036 GTTAAAAAGGTGAATTAGACTGG - Intergenic
931378212 2:61727231-61727253 TTTAAAAATGGGAATGAGGCCGG + Intergenic
931811687 2:65860360-65860382 GTTATAAAGAGGAAAGAGTTGGG - Intergenic
932010257 2:67970451-67970473 CTTTTAAAGGGAAAGGAGGCTGG + Intergenic
933595794 2:84282255-84282277 GGTGTGACGGGGAATGAGGCCGG + Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
934481380 2:94649253-94649275 GTTACCAAGGAGACTGAGGCAGG - Intergenic
935642170 2:105301108-105301130 GCTACTAAGGGGAATGAGGCAGG + Intronic
935980341 2:108620295-108620317 GTTCTAAAAGGAAAAGAGGCTGG + Intronic
936282617 2:111155557-111155579 GTTATGGAGGGGAAAGAGGGAGG - Intronic
936911565 2:117598974-117598996 GTTTTGAAGGGGAAAGAGTCAGG - Intergenic
937424199 2:121784640-121784662 GTTATTCAGGGGACTGAGGCAGG - Intergenic
937444614 2:121947126-121947148 GTTAGAAAGGGGGATGGGGCAGG + Intergenic
939706892 2:145465915-145465937 GCTATGCAGGAGAATGAGGCAGG + Intergenic
939802179 2:146722928-146722950 GTTACTAGGGGGACTGAGGCAGG + Intergenic
940145393 2:150540556-150540578 GCTATTCAGGGGACTGAGGCAGG - Intergenic
940868171 2:158837592-158837614 GTTACACAGGAGAGTGAGGCTGG + Intronic
941368312 2:164633869-164633891 GTTATTTGGGGGACTGAGGCAGG - Intergenic
941420817 2:165281249-165281271 GTTATAGAGGGAAATAAGGAAGG + Intronic
942081464 2:172403253-172403275 GTAATACAAGGGAATGGGGCTGG + Intergenic
945568398 2:211433283-211433305 TTTAAAAAGGGGAGTGAGGCCGG + Intronic
946111671 2:217425127-217425149 ATGAAAAAGGGGAATGAGCCAGG - Intronic
946654918 2:221936110-221936132 GATATAAAGGGAAGTGTGGCAGG + Intergenic
947531665 2:230912539-230912561 GCTATGAAGGAGACTGAGGCAGG - Intronic
948856503 2:240732749-240732771 GGGATAAGGGGGAATGAGGGAGG + Intronic
949007894 2:241660409-241660431 TTTATAAGGGAGAGTGAGGCTGG + Intronic
1171106888 20:22442177-22442199 TTAACAAAGGGAAATGAGGCGGG + Intergenic
1171478100 20:25429283-25429305 TTTAAAAAGAGGAATGGGGCCGG - Intronic
1172315662 20:33952201-33952223 GTTATAAAAAGAAATGAGGCTGG + Intergenic
1172441915 20:34971905-34971927 GGCATAAAGGGGAGTGGGGCAGG - Intergenic
1173846527 20:46192068-46192090 GCTACAAAGAGGAATAAGGCAGG - Intronic
1173895630 20:46548676-46548698 GTTATAAAGGGCAGGGAGGGTGG + Intronic
1174980475 20:55388719-55388741 TTTATAAAGGAGAATCAGGACGG - Intergenic
1175622708 20:60463550-60463572 GTTAGGAGGGGGAATGAGCCAGG + Intergenic
1178378393 21:32087723-32087745 GTTACAAGGGGAAAAGAGGCAGG - Intergenic
1182275252 22:29184260-29184282 GTCGTAAAAAGGAATGAGGCAGG - Intergenic
1182608096 22:31522948-31522970 GCTATAAAAAGGAATAAGGCCGG - Intronic
1183110316 22:35643966-35643988 ATAATAAAGGGAAATGAGGTTGG - Intergenic
1183224675 22:36541448-36541470 GTTATAAAGCACATTGAGGCCGG + Intergenic
1183273392 22:36875949-36875971 GGGGGAAAGGGGAATGAGGCTGG - Exonic
1183375863 22:37464680-37464702 GTTAAAAAGGGGCTTGAGGGAGG - Intergenic
1183766389 22:39879929-39879951 GTGCTAAAAGGAAATGAGGCTGG + Intronic
1184126532 22:42491297-42491319 GTTATTCAGGAGACTGAGGCAGG + Intergenic
949961062 3:9312878-9312900 GCTATTAAGGAGACTGAGGCAGG + Intronic
950053599 3:10009394-10009416 TTTGTGAAGGGGTATGAGGCGGG + Intronic
950305245 3:11911682-11911704 TTTGTGAAGGGGTATGAGGCGGG + Intergenic
951036390 3:17937371-17937393 GTTATAAAAGGGACTTAGGACGG - Intronic
951439079 3:22702073-22702095 GTTATAAAGGGGGATGATGGTGG - Intergenic
951475259 3:23098548-23098570 GTTACTCAGGAGAATGAGGCAGG + Intergenic
951932390 3:27982811-27982833 GTTATAAGGAGGAATGAGACTGG - Intergenic
952052293 3:29399095-29399117 GCAAGAAAGGGAAATGAGGCAGG - Intronic
954741008 3:52750629-52750651 GCAATAAAAAGGAATGAGGCAGG + Intronic
954783469 3:53076655-53076677 GTTCTAAAGGTGAAAGAGGCAGG + Intronic
955138924 3:56249620-56249642 GTTAAACAGGTGAATTAGGCCGG - Intronic
955242487 3:57190750-57190772 GCTATAAAGGAGGGTGAGGCAGG - Intergenic
955801674 3:62693216-62693238 GTTACAAAGAGCAATGAGGTGGG - Intronic
956054461 3:65283917-65283939 GTGGTAAAGAGGAAGGAGGCAGG - Intergenic
957287928 3:78241028-78241050 GTTTTTAAGGGGAATGATGATGG - Intergenic
958909662 3:99979763-99979785 GATATAAAGAGGAATGGGACAGG + Intronic
960258133 3:115533229-115533251 GGTAGGAAGGGGAATGGGGCAGG + Intergenic
960927510 3:122809625-122809647 GATATAAAGGGATATGAGACTGG - Intronic
962076836 3:132091001-132091023 GGAATAAAAGGGAAAGAGGCTGG - Intronic
962779873 3:138702560-138702582 CTTATAAAGGGTAATGAGACAGG + Intronic
963037598 3:141045992-141046014 GAAGTAAAGGGGAATGGGGCAGG + Intergenic
963299668 3:143584415-143584437 GTTAACAAAGGGAGTGAGGCTGG - Intronic
963443061 3:145365720-145365742 ATTCTAAAGGGGAATGCTGCTGG + Intergenic
964388285 3:156172592-156172614 TTTAAAAAAGGGAATGAGGATGG + Intronic
967349031 3:188491267-188491289 GTGATAAAGGAGGAGGAGGCTGG + Intronic
967428483 3:189354736-189354758 GTTATAATAGGGAAACAGGCGGG - Intergenic
967626660 3:191693893-191693915 ATCATAAAGGGGAATGGAGCAGG + Intergenic
968248326 3:197178669-197178691 ACTATAAAGGAAAATGAGGCTGG + Intronic
968875779 4:3267210-3267232 TTTAAAAAGGTGAAAGAGGCCGG + Intronic
969865561 4:10074998-10075020 GTTGTACAGGTGAATGAGCCGGG - Exonic
970133346 4:12894975-12894997 ATGATGAAGGGGAATGAGGGTGG - Intergenic
970659303 4:18265831-18265853 GTTACTCAGGAGAATGAGGCAGG + Intergenic
970880544 4:20924440-20924462 TATATAAAGGGGAATGAAACTGG - Intronic
971168146 4:24205119-24205141 GTTATAAACTTGCATGAGGCTGG - Intergenic
972590869 4:40485761-40485783 GTTATAAAGAGAAAATAGGCCGG + Intronic
974061670 4:57041443-57041465 GTTGAAAAGGGTGATGAGGCAGG + Intronic
976221630 4:82760869-82760891 GTTATAAAAAGGAATGAACCAGG - Intronic
977890835 4:102309426-102309448 GTAATAAATGGGAATGAAGTGGG - Intronic
978660336 4:111118937-111118959 GTTATAAAAGGGTACTAGGCTGG - Intergenic
978715620 4:111839309-111839331 TGTATAAAGGGGAATGAGACAGG - Intergenic
979078227 4:116302002-116302024 ATCCTAAAAGGGAATGAGGCTGG - Intergenic
980265863 4:130514884-130514906 ATTAGAAAGGGGAAAGAGGCCGG + Intergenic
983018192 4:162640638-162640660 GTTATAAAGAGTAGTGAAGCAGG - Intergenic
983617048 4:169719167-169719189 GTTAAAAAAGGGAAAGTGGCTGG + Intronic
984181166 4:176484253-176484275 AGAATAAAGGGGAATGAGGCAGG + Intergenic
984555620 4:181211063-181211085 GTTATAGAGGGGAGTGGGGCTGG + Intergenic
987339368 5:16925706-16925728 GTTATAAAGAAAACTGAGGCCGG - Intronic
987632803 5:20497125-20497147 GTCATAAAGGCCAATGAAGCTGG + Intronic
992457321 5:76927758-76927780 GTAAAACATGGGAATGAGGCTGG - Intergenic
993212490 5:84970692-84970714 GTTACAAAGGGGACTGATGGAGG + Intergenic
993324625 5:86517438-86517460 TTTAAAAAAGGAAATGAGGCCGG - Intergenic
995002778 5:107155284-107155306 GTTAAATAGAGGAATGAGGTAGG - Intergenic
995395639 5:111683703-111683725 GGTACATAGGAGAATGAGGCGGG - Intronic
995849316 5:116528387-116528409 ATTGTAAAGGCGAATGAGGATGG - Intronic
996063629 5:119058088-119058110 ATTAAGACGGGGAATGAGGCTGG + Intronic
996113338 5:119591389-119591411 GTTAAAAAGCCAAATGAGGCCGG + Intronic
998475644 5:142419168-142419190 GCTATAAAAGAGACTGAGGCAGG + Intergenic
999514507 5:152287470-152287492 ATTATAAAAGGGCTTGAGGCTGG + Intergenic
999704571 5:154260499-154260521 GTCATAAAGGGAAAAGAGACAGG - Intronic
1001421511 5:171590848-171590870 GTTAGAAAGGGGAACAAGGAGGG + Intergenic
1001741221 5:174054492-174054514 GTTACTTAGGGGACTGAGGCAGG - Intronic
1002606081 5:180383534-180383556 GATAGAAAGAGGAAGGAGGCCGG + Intergenic
1002884342 6:1280720-1280742 GTTTAAAGGGGGAATGAGGGAGG + Intergenic
1003968277 6:11274216-11274238 GTTATAAAGGGGTATGGGATAGG + Intronic
1004780596 6:18904229-18904251 TTTAAAAAGAGGAATGTGGCAGG + Intergenic
1004891501 6:20105401-20105423 GATATAAAGATGAATTAGGCAGG + Intronic
1006194883 6:32233661-32233683 GATATAAAGAAGAATCAGGCCGG - Intergenic
1006852945 6:37112542-37112564 AACATAGAGGGGAATGAGGCGGG + Intergenic
1006977294 6:38115095-38115117 GATATCAAAGGGAATGATGCAGG + Intronic
1007502735 6:42311217-42311239 GTTATGAAGGGAAATAAAGCAGG + Intronic
1007913537 6:45539110-45539132 TTTATAAAGGGAAAGGGGGCAGG - Intronic
1008045886 6:46850782-46850804 GTTATTGAGGTGAATGAAGCAGG - Intergenic
1008138658 6:47806714-47806736 GCAACAAAGGGAAATGAGGCAGG - Intronic
1009532244 6:64833007-64833029 GTTGGAATGGGGAATGTGGCAGG - Intronic
1012390002 6:98727797-98727819 GTTGGTAAGGGGAGTGAGGCGGG - Intergenic
1012825567 6:104141950-104141972 GTTATTCAGGAGACTGAGGCAGG - Intergenic
1013634392 6:112015576-112015598 GCTATAAAGAGAAATGAAGCTGG + Intergenic
1014252819 6:119131777-119131799 GTTATAAAAGTGTATAAGGCTGG - Intronic
1015659563 6:135560026-135560048 TTTATAAAAGGGAATAAGGGAGG + Intergenic
1016837626 6:148494513-148494535 GTTATACAGGAGGCTGAGGCAGG + Intronic
1016907520 6:149166562-149166584 ATAGTAAATGGGAATGAGGCTGG + Intergenic
1017416752 6:154228976-154228998 CTTATCTAGGGGAATGAGGTAGG - Intronic
1017584714 6:155908109-155908131 GGTGTAAGGGGGCATGAGGCTGG + Intergenic
1017834735 6:158167424-158167446 GTTACTAGGGAGAATGAGGCAGG + Intronic
1018241629 6:161781392-161781414 GTTTTAATAGGGAGTGAGGCAGG - Intronic
1018305587 6:162451431-162451453 ATTATAAAAAGGAATCAGGCCGG + Intronic
1018313945 6:162538283-162538305 GCTACAAAGGAGACTGAGGCAGG + Intronic
1018616571 6:165692266-165692288 ATTATAAAGGAGCCTGAGGCTGG + Intronic
1019921510 7:4166314-4166336 GTTCCAGAGGGGACTGAGGCAGG + Intronic
1020208117 7:6135350-6135372 GTTAGAAAAGTAAATGAGGCTGG + Intronic
1021210669 7:17848250-17848272 GCTGAAAAGGGGAATGGGGCGGG - Intronic
1021802649 7:24323183-24323205 GTTTTAAAGGAAAATGAGCCTGG + Intergenic
1024092491 7:45956091-45956113 GTTATAAAAGGGCATCAGGAGGG + Intergenic
1024203462 7:47130505-47130527 GCTATAATGGGGACTGAGGCAGG - Intergenic
1024578704 7:50784537-50784559 GTAATAGAGGGGAGTGTGGCAGG - Intronic
1026063854 7:67051417-67051439 GCTATTCAGGGGGATGAGGCAGG - Intronic
1027437148 7:78176036-78176058 GTTATAGAGGGCAGGGAGGCTGG + Intronic
1028151417 7:87378045-87378067 TTTATAAAGGGGTTTGGGGCTGG + Intronic
1029482736 7:100822987-100823009 GTTATAAAGTACCATGAGGCCGG + Intronic
1030271321 7:107671272-107671294 GTTATTAAGGAGGCTGAGGCAGG - Intronic
1030354851 7:108530587-108530609 GTAATAAAAGGCAATAAGGCAGG + Intronic
1031298106 7:120030335-120030357 GTTTTAAACAGTAATGAGGCAGG - Intergenic
1032796183 7:135277969-135277991 GTTATTCAGGGGGCTGAGGCAGG - Intergenic
1033494238 7:141877505-141877527 GTTCTAAAGGGGAAGGAAGCTGG - Intergenic
1033533437 7:142289192-142289214 GTTATCACAGGGAATGAAGCAGG + Intergenic
1035541506 8:442764-442786 TTTATAAAGTGGAAATAGGCTGG - Intronic
1037473232 8:19231527-19231549 GTTATAAAATGGAATGAAACTGG - Intergenic
1037915370 8:22769653-22769675 GTGATAAAGGAGAAAGAGGCTGG - Intronic
1038899417 8:31825643-31825665 GTTATAAAAAGGAAAGAGACAGG + Intronic
1039052568 8:33508307-33508329 GATAAAAAGGGGGCTGAGGCCGG + Intronic
1039569975 8:38578965-38578987 GGAATGCAGGGGAATGAGGCTGG - Intergenic
1043274850 8:78380233-78380255 GTCATAAAAGAGAAAGAGGCGGG + Intergenic
1044333816 8:90952480-90952502 GTTATAAATGGGAGGAAGGCTGG + Intronic
1044561048 8:93612655-93612677 ATTATAAAAGGGCTTGAGGCTGG - Intergenic
1044740850 8:95324663-95324685 ATTGTAAAGGGGAAAGAGGGAGG - Intergenic
1046261234 8:111771140-111771162 TTGATCAAGGAGAATGAGGCAGG - Intergenic
1046936835 8:119892892-119892914 GCTACTAAGGGGACTGAGGCAGG - Intronic
1047071393 8:121347754-121347776 GATATAAAGGGGGTTGAGGTAGG - Intergenic
1047432424 8:124804572-124804594 GTGAGAAAGGGCACTGAGGCCGG + Intergenic
1048288905 8:133164674-133164696 GTGAGGAAGGGGAATTAGGCAGG - Intergenic
1048919830 8:139218166-139218188 TTTATTATGGGGAATGAAGCTGG - Intergenic
1049005306 8:139851657-139851679 GTTCAAAAGGGAAATGAGTCGGG + Intronic
1049033831 8:140059103-140059125 GTTGTAAAGGGGCAGGAGGAAGG - Intronic
1050428602 9:5538231-5538253 TTAAAAAAGGGGAATGAGACTGG - Intronic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1052813544 9:33082625-33082647 GATAAAATGGGGAACGAGGCTGG - Intergenic
1053095595 9:35325250-35325272 GTTGTGAAGAGGAATGAGGGGGG + Intronic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054735270 9:68744505-68744527 GTTATAAATATGAATGAAGCTGG - Intronic
1055633367 9:78247680-78247702 GCTATAAAAGGGAAAGAGGGAGG + Intronic
1056161228 9:83896129-83896151 GCTATACAGGAGACTGAGGCAGG + Intronic
1056187088 9:84145968-84145990 TTTATAAAGTGGAATCATGCAGG - Intergenic
1056335995 9:85569565-85569587 GTAAATAAGGGGAATGAGGGAGG - Intronic
1056851103 9:90084918-90084940 GTTATAAAGCAGCAGGAGGCAGG - Intergenic
1057014294 9:91637322-91637344 GTTTTACAGGGGAGTGAGACTGG - Intronic
1057972051 9:99567830-99567852 TTTAAAAAGGGGAAGAAGGCTGG + Intergenic
1059264165 9:113010689-113010711 GTTATAAAGAAAAATTAGGCCGG + Intergenic
1060070378 9:120541971-120541993 ATTAAAAAGGGTAGTGAGGCTGG - Intronic
1060979757 9:127785524-127785546 GTTATAAAGGGGGAGGTGCCCGG - Intergenic
1186559722 X:10598493-10598515 GTTAGAAAGGGAGATGATGCAGG + Intronic
1186593594 X:10956982-10957004 GTTTTCAAGGGGAATGATTCTGG - Intergenic
1187405793 X:19002443-19002465 GGTACAAAGTAGAATGAGGCTGG + Intronic
1188345367 X:29058077-29058099 GTTAAAAATAGGAAAGAGGCCGG + Intronic
1188522401 X:31053414-31053436 GTTACCAAGGGAAATGAAGCAGG + Intergenic
1192093346 X:68184223-68184245 GTCAAAAAGAGGAATGGGGCCGG + Intronic
1192115407 X:68405845-68405867 TATATAAAGGGCAATGAGGCTGG + Intronic
1196397344 X:115279056-115279078 GTTATACAGGGGATTGAACCAGG - Intergenic
1197045684 X:121995083-121995105 GCTATTAAGGGGTCTGAGGCAGG + Intergenic
1197288335 X:124623727-124623749 TTTTTAAAGGGCAATGAGGAAGG - Intronic
1197419198 X:126217138-126217160 GTAATAAAAGGGAATTTGGCAGG + Intergenic
1197618620 X:128721617-128721639 GATATAAAGATGAATGAGCCGGG - Intergenic
1198077680 X:133210311-133210333 GTTATAAAAAGGAATGAAGCAGG + Intergenic
1198094172 X:133362100-133362122 GTTACATAGGAGACTGAGGCAGG + Intronic
1199766589 X:150945928-150945950 GTCATACAGGGGTAGGAGGCAGG - Intergenic