ID: 1125466549

View in Genome Browser
Species Human (GRCh38)
Location 15:39958787-39958809
Sequence GTGTAGATGTTGGGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 337}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125466549_1125466557 11 Left 1125466549 15:39958787-39958809 CCCTCCTGCCCCAACATCTACAC 0: 1
1: 0
2: 3
3: 30
4: 337
Right 1125466557 15:39958821-39958843 TGGTAGAGCAATCTTTTGGATGG 0: 1
1: 0
2: 2
3: 9
4: 127
1125466549_1125466556 7 Left 1125466549 15:39958787-39958809 CCCTCCTGCCCCAACATCTACAC 0: 1
1: 0
2: 3
3: 30
4: 337
Right 1125466556 15:39958817-39958839 ATAATGGTAGAGCAATCTTTTGG 0: 1
1: 0
2: 0
3: 8
4: 125
1125466549_1125466555 -9 Left 1125466549 15:39958787-39958809 CCCTCCTGCCCCAACATCTACAC 0: 1
1: 0
2: 3
3: 30
4: 337
Right 1125466555 15:39958801-39958823 CATCTACACATTGATCATAATGG 0: 1
1: 0
2: 2
3: 23
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125466549 Original CRISPR GTGTAGATGTTGGGGCAGGA GGG (reversed) Intronic
900241804 1:1620817-1620839 GGGGAGCTGCTGGGGCAGGAGGG + Intronic
900926453 1:5709286-5709308 TTGGAGATGGTGGGGCAGGCAGG - Intergenic
901050505 1:6423824-6423846 GGGTGGGTGTTGGGACAGGAAGG + Intronic
902332893 1:15739257-15739279 GTGAAGATCTGGCGGCAGGAGGG + Exonic
902817344 1:18923888-18923910 GTGCAGAACTCGGGGCAGGAAGG - Intronic
903302725 1:22390705-22390727 GTGTGTGTGTTGGGGCAGGAAGG - Intergenic
903329922 1:22592131-22592153 GTGGTGATGGTGAGGCAGGAGGG - Intronic
903700400 1:25243167-25243189 GTGAAGATACTGGGGCAGCAGGG + Intronic
906643077 1:47453051-47453073 GTGTAGGTTTGGGGACAGGAAGG + Intergenic
908177139 1:61566722-61566744 GTGTTGAAGGTGGGGCAGGTGGG - Intergenic
909611610 1:77557058-77557080 GTGTATATGTGGGGGGAGGTAGG - Intronic
910224288 1:84920376-84920398 GTGCACATGTGTGGGCAGGAGGG + Intergenic
911133362 1:94413982-94414004 GTGAGGATGTTAGGGTAGGAAGG + Intergenic
911161215 1:94684693-94684715 GTGTAACTTTTGGGGAAGGAAGG - Intergenic
912610962 1:111043449-111043471 GTGTTGAAGATGGGGCAAGATGG - Intergenic
913199423 1:116484052-116484074 GCTTGGATGTGGGGGCAGGAGGG + Intergenic
915360428 1:155283059-155283081 GTGAAGATGGTGGCACAGGAGGG + Intronic
915876942 1:159620939-159620961 GTGTATATATTTGGGCAGTAGGG - Intergenic
916695516 1:167231993-167232015 GTGTGTGTGTTGGGGGAGGAGGG - Intronic
917526746 1:175795066-175795088 GTGTAGATGAAGAGGAAGGAAGG + Intergenic
918116944 1:181505965-181505987 ATGGAGATGATGGGGCAGTAAGG - Intronic
918123063 1:181556703-181556725 GGGAAGAAGTTGGGGCAGGAGGG + Intronic
918438720 1:184544276-184544298 GTTTAGAAGTTGAGGCAGGGTGG + Intronic
919113104 1:193244472-193244494 CTGGAGAGGTTGGGCCAGGAGGG + Intronic
919137094 1:193523189-193523211 GTGTAGGTTTTGGGGCAGATGGG + Intergenic
919484259 1:198127613-198127635 GTGTTGGAGTTGGGGCAGGGTGG + Intergenic
919640123 1:200038840-200038862 GTGAAGAGGTTGGGGCAGGCCGG + Intronic
920149626 1:203894188-203894210 GTGTAGGGGTCGGGGCAGGGGGG + Intergenic
920233766 1:204488705-204488727 GAGTAGGAATTGGGGCAGGATGG - Intronic
920349905 1:205331072-205331094 GTGTGTGTGTTGGGGCAGGCAGG + Intergenic
920847972 1:209609342-209609364 GTTTAGAAGATGGGCCAGGAGGG + Intronic
921486276 1:215719307-215719329 GTGATGTTGTTGGGGCAGGGGGG + Intronic
922079074 1:222277063-222277085 GTGGGGATGCTGAGGCAGGAGGG + Intergenic
922538610 1:226402189-226402211 GTGTACATACTGGGGCAGCATGG - Intronic
923136184 1:231121716-231121738 CTGGGGATGCTGGGGCAGGAGGG + Intergenic
923831105 1:237558313-237558335 GAGTAGAAGTTAGGGCAGGCTGG + Intronic
1064155571 10:12900716-12900738 GTGTAGATAGTGGGGCTCGATGG - Intronic
1064182992 10:13135467-13135489 GTTTAGATCTTGGTGCAGAAAGG - Intronic
1065133300 10:22643943-22643965 CTGCAGATGGTGGGGCAGGCTGG - Intronic
1066440199 10:35431334-35431356 GGGAAGATGTGGGGGGAGGAGGG - Intronic
1067466527 10:46503244-46503266 GTGTGGTTGTTGGAGCTGGAAGG - Intergenic
1067620661 10:47881361-47881383 GTGTGGTTGTTGGAGCTGGAAGG + Intergenic
1070925818 10:80220856-80220878 GTGTCTATGGTGGGGGAGGAAGG - Intergenic
1071755021 10:88527665-88527687 GTGTATATGTGGGGGGAAGAGGG - Intronic
1073448026 10:103592600-103592622 GTGCACATGTGGGGGCAGGCTGG + Intergenic
1074364224 10:112845252-112845274 CTGCACAAGTTGGGGCAGGACGG + Intergenic
1076539350 10:131204403-131204425 ATGTAGATGCGGGGGCAGGGTGG - Intronic
1076940518 10:133603940-133603962 GTGCAGATGTGGGGGTAGAAAGG - Intergenic
1076996116 11:298341-298363 GTGCCCATGTTGGGGCTGGAGGG + Exonic
1077176456 11:1193338-1193360 GTGCTGAGGGTGGGGCAGGAAGG + Intronic
1077411963 11:2407843-2407865 GCATAGAGGCTGGGGCAGGATGG + Exonic
1077458422 11:2694928-2694950 GTGAAGGCCTTGGGGCAGGAGGG + Intronic
1079329255 11:19520551-19520573 GCATAGAGCTTGGGGCAGGAAGG - Intronic
1080056505 11:27912111-27912133 ATGTTGATGTTGGGGGAGGATGG + Intergenic
1080106750 11:28519187-28519209 GTGTAGAGGTAGGCTCAGGAAGG - Intergenic
1080407252 11:31990537-31990559 GTGTAGCTGGGGAGGCAGGATGG - Intronic
1081199511 11:40199389-40199411 TTGTGGTTGTTGGGGAAGGAGGG + Intronic
1081858952 11:46321029-46321051 GTGCAGGTGTGGGGGCAGGGAGG - Exonic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1083303124 11:61749091-61749113 GGGCAGAGGCTGGGGCAGGAAGG - Intergenic
1083371993 11:62189691-62189713 GTGAAGATGGTGGGGATGGAAGG + Intergenic
1083774660 11:64888570-64888592 GTGTGGGTGATGGGGCATGATGG + Intergenic
1084956325 11:72693549-72693571 ATGGAGAGGCTGGGGCAGGATGG - Intronic
1085026909 11:73241704-73241726 CTCTAGGTGTTGGGGCAGGGTGG + Intergenic
1085920969 11:80956825-80956847 GGTTAGAGGTTGGGACAGGAAGG - Intergenic
1089470255 11:118715024-118715046 GTGTTGATGTTGATGCTGGAGGG + Intergenic
1090204122 11:124875488-124875510 GGGGGAATGTTGGGGCAGGAGGG + Intronic
1090282193 11:125465745-125465767 GTGAAGAGGCTGGGGCACGATGG - Intronic
1091056125 11:132420699-132420721 GAGCAGATGGTGGGGTAGGAAGG + Intronic
1092388401 12:8053478-8053500 GTGATGATGGTGGTGCAGGAGGG + Exonic
1092675859 12:10918207-10918229 GCGGGCATGTTGGGGCAGGACGG + Intronic
1092892411 12:12981092-12981114 GTGTAGATGGAAGGGAAGGAAGG + Intronic
1093134808 12:15437643-15437665 TCGTAGATATTGGTGCAGGAAGG + Intronic
1093764129 12:22942891-22942913 GTGGACCTGTTGGGGCACGAAGG + Intergenic
1094177692 12:27558572-27558594 GTGGAGAGGTGGGGGCAGGAAGG - Intronic
1095115186 12:38344350-38344372 GTGCAGATGTAGGGGTAGGCAGG - Intergenic
1095970080 12:47895679-47895701 CTGTTGGTGTTGGGGAAGGACGG - Intronic
1096316418 12:50571101-50571123 GTGGAGGGGTTGGGGAAGGATGG + Intronic
1096873508 12:54609748-54609770 TTGAAAATGCTGGGGCAGGAGGG - Intergenic
1097186883 12:57200839-57200861 GGGAAGATGCTGGGGAAGGAGGG - Intronic
1098322359 12:69258810-69258832 GTGGAGGTGGTGGGCCAGGAGGG - Exonic
1098861972 12:75720476-75720498 GTGGTGATCTTGGGGCAGGGTGG + Intergenic
1099839939 12:87952961-87952983 GTGTAGCTGTTGGGGCCAGCAGG - Intergenic
1100391648 12:94149710-94149732 GTGTAGTTGTAGGGGTAGTAGGG - Exonic
1101038631 12:100731420-100731442 GAGTATATGTGGGGACAGGAGGG - Intronic
1101950272 12:109169276-109169298 GTGAAGAGCTTGGGGCAGGAAGG - Intronic
1102574834 12:113849821-113849843 GCGTAGAGGATGGGGGAGGAGGG - Intronic
1103440949 12:120962586-120962608 CTGAAGATGGTAGGGCAGGAAGG + Intergenic
1105396914 13:20044556-20044578 AAGTAGATGTTGGGGCAAGATGG - Intronic
1106144118 13:27036594-27036616 TTGAAGATGTGCGGGCAGGAGGG - Intergenic
1107534530 13:41315133-41315155 GAGAATATGTTGGGGAAGGAAGG + Intronic
1107898286 13:44987904-44987926 TTGTAGAAGATGGGGGAGGAGGG - Intronic
1107996785 13:45869065-45869087 GTGTCCAGGTGGGGGCAGGAGGG + Intergenic
1109894062 13:68659046-68659068 GTGTATTTGTTGGGGGAAGAAGG - Intergenic
1110125048 13:71932267-71932289 GAGTAGATGTTGGGGGTGGGGGG + Intergenic
1110794855 13:79624332-79624354 GTGAACATCATGGGGCAGGAAGG + Intergenic
1113037764 13:106070087-106070109 GAGGAGATGTGGGGGCAGGAGGG - Intergenic
1113086061 13:106570547-106570569 GTGGAGCTGCTGGGACAGGATGG - Intergenic
1113966155 13:114155127-114155149 GTGTAGGTGTGGGGGCATGATGG + Intergenic
1114494096 14:23120745-23120767 GGGTAGGTGTTGGGGTAGGGAGG - Intergenic
1116504934 14:45666155-45666177 ATGTAGAAGGTGGGGCAAGATGG - Intergenic
1117687223 14:58266376-58266398 GTGGATATGTTGGGGGATGATGG - Intronic
1117911032 14:60638105-60638127 GGGGAGATGTGGGCGCAGGAGGG + Intergenic
1118880167 14:69818981-69819003 GTGCAGATGCGGGGGAAGGAAGG + Intergenic
1119871975 14:78025829-78025851 GTGTGTGTGTTGGGGGAGGAGGG + Intergenic
1120446973 14:84611036-84611058 TTGTTGTTGTTGGGGCAGGTTGG + Intergenic
1120713554 14:87817361-87817383 GTCTGGGTGTTGGGGCAGGGTGG + Intergenic
1121116950 14:91350571-91350593 GTGTGCAGTTTGGGGCAGGAAGG - Intronic
1122160745 14:99782139-99782161 GTGGAGGGGTTGGGGAAGGAAGG - Intronic
1124167384 15:27339953-27339975 GAGGAGGCGTTGGGGCAGGAAGG + Intronic
1124478707 15:30059223-30059245 GTGTGTATGTCGGGGTAGGAGGG + Intergenic
1124786088 15:32681944-32681966 GTGTGGCTGCTGGGCCAGGAAGG + Intronic
1125101106 15:35913726-35913748 GTTTACATGCTGGGGCATGAGGG + Intergenic
1125466549 15:39958787-39958809 GTGTAGATGTTGGGGCAGGAGGG - Intronic
1127082042 15:55390268-55390290 GTGTTAAAGTTGGGGCAGGGGGG + Intronic
1127604829 15:60576035-60576057 GTGGTGATGTGGGGGAAGGATGG - Intronic
1127691244 15:61399552-61399574 GTGTGTTTGTTGGGGCTGGAGGG - Intergenic
1128743922 15:70100665-70100687 GCGTGGACGTCGGGGCAGGAGGG - Intergenic
1128765095 15:70246511-70246533 CTGTGGGTGTTGGAGCAGGACGG + Intergenic
1129314212 15:74731423-74731445 GTGAGGAGGCTGGGGCAGGAGGG + Intergenic
1129671066 15:77607895-77607917 TTGTGGAAGTTGGGGGAGGAGGG - Intergenic
1130388557 15:83434551-83434573 GTGGAGATGAGGGGGCTGGAGGG + Intergenic
1130659375 15:85818142-85818164 GTGTGGGTGGTGGGGAAGGAGGG - Intergenic
1130874953 15:88005745-88005767 GTGTAGTTGTTGGGGTAGATGGG - Intronic
1131391547 15:92053137-92053159 GTGTAGATGCTGAGGTGGGATGG + Intronic
1132587181 16:710681-710703 GAGTTGATGGGGGGGCAGGAAGG - Intronic
1133148818 16:3811033-3811055 GTGCCATTGTTGGGGCAGGAGGG - Intronic
1133229663 16:4360541-4360563 CTGAAGATCTGGGGGCAGGAAGG + Exonic
1133803406 16:9103710-9103732 CTGTAGATGGTGGGAGAGGATGG + Intronic
1136105635 16:28028219-28028241 GTGTAGTTGATGGGCCATGAAGG + Intronic
1136567763 16:31080309-31080331 GAGTAGGTCTTGGGGCAGGTGGG - Exonic
1138897142 16:61220513-61220535 CTGTACATGTTGGGGGAGGAGGG + Intergenic
1141611356 16:85182811-85182833 CTGTGGATGCTGGGGCAGGAGGG - Intronic
1142426767 16:90005752-90005774 GAGTAGAAGAAGGGGCAGGATGG + Exonic
1142548318 17:720983-721005 GTGTAGGAGTTGGGGGAGCATGG + Intronic
1143115157 17:4577770-4577792 GTCAAGAGGTTGGTGCAGGAGGG + Intergenic
1143245649 17:5483514-5483536 GTGGAGATGTTGGGTAGGGAAGG - Intronic
1143625624 17:8108956-8108978 GTGTGGATGCAGGGGAAGGAGGG - Intronic
1144539631 17:16128188-16128210 GCGAAGATGATGTGGCAGGATGG - Intronic
1144752712 17:17660735-17660757 GTGCACATGTGGGGGCAGCAAGG + Intergenic
1144890479 17:18491364-18491386 GTTTAGTTCTTGGGGAAGGAGGG - Intronic
1145094280 17:20010457-20010479 GTGTTGAAGATGGGGGAGGAGGG + Intronic
1145141738 17:20452954-20452976 GTTTAGTTCTTGGGGAAGGAGGG + Intronic
1145977995 17:28995452-28995474 GTGTAGATGATGGGGCAGCATGG - Intronic
1147423718 17:40335199-40335221 GTGTTGGTGTTGGGGCTGGGAGG + Intronic
1147457212 17:40545356-40545378 GGGTAGGGGGTGGGGCAGGATGG + Intergenic
1147510946 17:41068487-41068509 CTGTAGATGATGGGCCAGGGTGG - Intergenic
1147613252 17:41813431-41813453 GTTTGGAAGTGGGGGCAGGAGGG - Intronic
1147970621 17:44217836-44217858 GTGTAGAGGAAGGGTCAGGAAGG - Intronic
1148802132 17:50235902-50235924 TTGAAGGTGGTGGGGCAGGATGG + Intergenic
1149013509 17:51882454-51882476 GTATGGGTGTTGGGGGAGGATGG + Intronic
1150782483 17:68134470-68134492 GTGTGGATGGAGGGGCAGGGCGG + Intergenic
1150861542 17:68806008-68806030 GTGAAGATATTTGGGCAGGGAGG - Intergenic
1151052678 17:70996207-70996229 GTGTAGACTTTGGGGGAGGCTGG - Intergenic
1152814416 17:82398989-82399011 TTGTAGAGGTTGGGGCGGGGTGG + Intronic
1153202035 18:2656291-2656313 GTGTAGACTTGGGGGCGGGAGGG + Intronic
1154298630 18:13173593-13173615 GTGTCCCTATTGGGGCAGGAGGG - Intergenic
1155186922 18:23395210-23395232 GTGTAAATGTTGGTGTAGAATGG - Intronic
1155798441 18:30070107-30070129 CGGTAGATTTTTGGGCAGGAGGG - Intergenic
1157404861 18:47414266-47414288 GTGTGGAGGTTGGAGAAGGAGGG + Intergenic
1158839911 18:61374112-61374134 GTGTGTATATTGGGGCAGGAAGG + Intronic
1158978989 18:62740144-62740166 GTGTATGTGTTTGGGCGGGAGGG + Intronic
1160952773 19:1675574-1675596 GTATGGATTCTGGGGCAGGAGGG + Intergenic
1161103417 19:2432395-2432417 CGGTAGGTGGTGGGGCAGGAGGG - Exonic
1161477824 19:4496163-4496185 TTGAAGGTGCTGGGGCAGGATGG - Intronic
1162009568 19:7804105-7804127 GCTTAGATGCTGGGGCAGCAGGG + Intergenic
1163158285 19:15450408-15450430 GTGTGGATGATTGGGAAGGAGGG - Intergenic
1164628470 19:29745365-29745387 GTCTAGAGGGTGGGGCAGGAGGG + Intergenic
1164912202 19:32022131-32022153 GAGTAGAGGTTGGGGAAGAAGGG - Intergenic
1165119788 19:33551744-33551766 GTGAAGAGCTTGGGGCAGAAGGG + Intergenic
1165257728 19:34589732-34589754 GTGTGGATGATGGAGGAGGAGGG + Intergenic
1165259440 19:34599275-34599297 GTGGAGGAGTTGGGGCAGGCAGG + Intronic
1166140783 19:40804023-40804045 GTGTATATGTGGGGGAAGGGTGG + Intronic
1167514364 19:49914497-49914519 GGGTAAATGTTGGGGCAGGCAGG - Intronic
1167618050 19:50547030-50547052 GTGTATAAGTGGGGGAAGGATGG + Intronic
1167785080 19:51629720-51629742 GTGTAGGACTTGGGGCAGGTCGG - Intronic
1167787181 19:51646144-51646166 GTGTAGGACTTGGGGCAGGTCGG - Intronic
1168241333 19:55090678-55090700 GGGAAGCTGATGGGGCAGGAGGG - Intergenic
925121810 2:1424364-1424386 GTGTTGATGTTGATGCTGGAGGG + Intronic
925570312 2:5303453-5303475 GTGTAGAGCTTGGGGAATGATGG + Intergenic
926181948 2:10652530-10652552 TTACAGAAGTTGGGGCAGGAAGG - Intronic
926582748 2:14649187-14649209 GTGTAGGGGTTGGGGGAGGGGGG + Intronic
927478533 2:23432729-23432751 GTGCAGGTGCTGAGGCAGGAGGG + Intronic
930018229 2:46985250-46985272 GTGGTGAGGTTGGGGCAGGGTGG - Intronic
930912484 2:56646422-56646444 GTGTTGATGCTGGGATAGGATGG + Intergenic
931182948 2:59921648-59921670 TGGTAGAATTTGGGGCAGGATGG - Intergenic
932087773 2:68776849-68776871 GTGTAGATATTGGGGGTGGGTGG + Intronic
932387795 2:71353532-71353554 GTCTAGAAGTTGGGGTGGGATGG + Intronic
934589158 2:95530746-95530768 GTGTGGATGGTGGGGCTGCAGGG - Intergenic
934901323 2:98162164-98162186 TTCTAGATGTTGGGGCGGGTGGG - Intronic
935332687 2:101988667-101988689 GTGTGGATGGTAGAGCAGGAGGG + Intergenic
935519187 2:104082774-104082796 CTCTACATGTTGGGGCAGAAGGG - Intergenic
936470736 2:112796690-112796712 GTGTAGAGATTGGGGAAGGCTGG - Intergenic
938142110 2:128803206-128803228 GTGTTGATGTTAGTGCTGGAGGG + Intergenic
938142113 2:128803238-128803260 GTGTTGATGTTAGTGCTGGAGGG + Intergenic
938821575 2:134965871-134965893 GTGTATGTGGTGGGGCAGGGAGG - Intronic
940199549 2:151135243-151135265 GTGTTGATGCTGGGGCCTGATGG + Intergenic
940275709 2:151938465-151938487 GTGTAGAGGTGGTGTCAGGAAGG + Intronic
940383442 2:153043128-153043150 GTGGAGATGTGGGGTCAGAATGG - Intergenic
940424509 2:153515091-153515113 GTTTGGATGTTGGGGGAGGGAGG + Intergenic
942232529 2:173873621-173873643 GTGGATAGGTTGGAGCAGGAAGG + Intergenic
942438068 2:176002373-176002395 GGGTAGTTGTTGGGGCGGGTCGG + Intronic
943718267 2:191175961-191175983 GAGGAGATGTTTGGGCAGCATGG + Intergenic
944059849 2:195561039-195561061 GTGTAGTTGTGGTGGCAGAAGGG + Intergenic
944681679 2:202083374-202083396 GAGTAGAGGTCGGGGCAGGGTGG - Intronic
945850646 2:215002657-215002679 ATGTAGATGTTGGTGGGGGAGGG + Intronic
947428952 2:230008960-230008982 GTGTTGATGTTTGCGCAGAAAGG + Intronic
947747736 2:232517785-232517807 GTCTAGATGCTGGGACAGCACGG + Intergenic
948924887 2:241089057-241089079 GTGGGGAGGTGGGGGCAGGATGG - Exonic
949037916 2:241826799-241826821 GTTTGGATGATGGGGAAGGACGG + Intergenic
1168963847 20:1887011-1887033 TTGTAGGCGTTGGGGCAGCAGGG + Intergenic
1169160600 20:3374722-3374744 GTATAGATGTTGGGGCATCTTGG - Intronic
1172063718 20:32205284-32205306 GGGGAGATGTTGGGAAAGGAAGG - Intronic
1172525364 20:35597798-35597820 GTGTAGAGGTTGGGGAAGGGTGG - Intergenic
1173297577 20:41772897-41772919 ATTTAGGTTTTGGGGCAGGAGGG + Intergenic
1174894356 20:54433173-54433195 TGGTAGTTGTTGGGGGAGGAGGG - Intergenic
1175188236 20:57194239-57194261 GTCAAGATGATGGGGCCGGAAGG + Intronic
1175711807 20:61227282-61227304 ATGTTGATGTGGGGGAAGGAGGG - Intergenic
1176113547 20:63421498-63421520 CTGTGGCTGATGGGGCAGGAAGG - Intronic
1176121259 20:63455579-63455601 GAGGAGAAGTTGGGGCAGGGAGG + Intronic
1177884837 21:26734775-26734797 GGGAGGATGATGGGGCAGGAAGG - Intergenic
1178094529 21:29199238-29199260 GTGTTGATGTTAGTGCTGGAAGG - Intronic
1180175021 21:46083141-46083163 GTGCAGATGTGGTGGCAGGCGGG - Intergenic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1181386751 22:22551297-22551319 GTGTAGAGGAGGGGACAGGACGG + Intronic
1182107282 22:27698478-27698500 GTGTGGATGTTGGGGTGGGGAGG - Intergenic
1182139276 22:27938831-27938853 CTGAAGAGGTTGAGGCAGGAGGG + Intergenic
1185170621 22:49291686-49291708 GGGTAGTGGGTGGGGCAGGAAGG - Intergenic
1185181848 22:49368271-49368293 GTGAAGATCTTGGAGCAAGAGGG - Intergenic
1185372596 22:50467979-50468001 GTGCAGATGCTGGGGCGGGTGGG - Intronic
949408525 3:3739699-3739721 GTGTGTGTGTTGGGGGAGGAAGG - Intronic
949652146 3:6172067-6172089 GTGTAGAGGTAGGGGTAAGATGG - Intergenic
950901298 3:16500185-16500207 GTGGAGCTGTGGGAGCAGGATGG - Intronic
952193687 3:31050063-31050085 GTGTACATCTTGGGGAAGGAAGG + Intergenic
952535516 3:34305108-34305130 CAGCAGATGTTGGGGCAGGGGGG + Intergenic
953473511 3:43186194-43186216 GTCTGGATCTTGGGGCAGGAAGG - Intergenic
953628818 3:44593737-44593759 GAGTAGAGGATGAGGCAGGAAGG + Intronic
953933212 3:47017384-47017406 GGGTAGATGTTGGGGCAGGCTGG + Intronic
954106500 3:48412415-48412437 GTGTGGCTGTTGGGGCTGGGTGG - Intronic
954698494 3:52439931-52439953 GTGTAGCTGCTGGGCCAGGTGGG + Exonic
955089002 3:55730891-55730913 GTGCAGATGTTGAGGCAGACTGG - Intronic
958256402 3:91330781-91330803 GTGTAGATCATGGTGCAGTAGGG - Intergenic
958906472 3:99947452-99947474 GTGAAGGGGGTGGGGCAGGAAGG - Intronic
960410211 3:117314003-117314025 GTGGAGATATTGAGGCAGAATGG + Intergenic
960432543 3:117587300-117587322 GTGCAGCTGTAGGGGAAGGAAGG + Intergenic
963005488 3:140723105-140723127 GTGAAGAAGTTGGGAGAGGAAGG - Intergenic
966555508 3:181255243-181255265 GAGTATATGTTGGGGCATAATGG + Intergenic
966855832 3:184193357-184193379 ATGTAGAAGTTGGGGCTGGAAGG - Exonic
967007049 3:185394031-185394053 ATGTGGATGTTGGAACAGGAGGG + Intronic
967130826 3:186469289-186469311 GTGTAAATGATGGGACAGCATGG - Intergenic
968459919 4:719668-719690 GTGGAGCTGGAGGGGCAGGACGG + Intronic
969261259 4:6035626-6035648 GTGCAGATGCTGGAGAAGGAGGG + Intronic
969633234 4:8350680-8350702 GTCTAGATGGTGAAGCAGGAAGG - Intergenic
972625045 4:40788777-40788799 GTGTAGGTTTGGGGGCAGGGAGG + Intronic
976151219 4:82094044-82094066 GTGTTTATGTGGGAGCAGGATGG - Intergenic
976281568 4:83332148-83332170 GTGAAGATGTGTGGGCGGGATGG - Intronic
978854667 4:113380828-113380850 ATGGAGATGGTGGGGGAGGAAGG - Intronic
979280200 4:118858917-118858939 GTTATGATGTGGGGGCAGGATGG - Intronic
980895453 4:138855489-138855511 GTGTGCATGTTGGGGGAGGCAGG + Intergenic
980993757 4:139761439-139761461 CTGTAGCTGTTGGAGCAGGGAGG - Intronic
983687673 4:170430854-170430876 GTGTAGATTTTGGGGAATGGGGG - Intergenic
986897354 5:12385864-12385886 CTCTAAATGTTGGGTCAGGATGG - Intergenic
987017201 5:13832777-13832799 CTGTAGCTGTTGGGACAGGAGGG - Intronic
987995034 5:25265259-25265281 GTGTATGTGTTGGGGAAGGATGG - Intergenic
990669963 5:58117127-58117149 GTGTGGATGAAGGGGCTGGATGG + Intergenic
991673342 5:69069130-69069152 TTGAAGGTGTTGGGGCAGGATGG - Intergenic
991958785 5:72021360-72021382 GTGTTGATTTTCTGGCAGGAAGG - Intergenic
992818835 5:80473109-80473131 GTGTGGTTTTTGGGCCAGGATGG + Intronic
994379934 5:99058717-99058739 TTGTAGAGGTTGTGGGAGGAAGG + Intergenic
995097548 5:108256646-108256668 GTGTATATGTTGGGTCTGGGTGG - Intronic
995497687 5:112764988-112765010 AAGTAGATGTGGGGGCATGAAGG - Intronic
995747875 5:115422975-115422997 GTGTATATGTTTTGGCAGAATGG - Intergenic
996857985 5:128031347-128031369 GTGAAGATGAGGGGGCAGGGTGG - Intergenic
1000727754 5:164792851-164792873 TTGTAGAGGTTGGGGGTGGAAGG - Intergenic
1000951205 5:167485558-167485580 GTATGGAATTTGGGGCAGGAGGG + Intronic
1001604885 5:172952436-172952458 CTGTAGAGGGTGGGGCAGGGTGG + Exonic
1003612397 6:7625716-7625738 GGGTAGATGCTGGGGGAGGCGGG + Intergenic
1003911012 6:10743769-10743791 GGGTGGAGGTTGGGGCAGGTGGG + Intergenic
1004066239 6:12247283-12247305 GTGTAAATGTTGGTGCTGGAGGG + Intergenic
1005805282 6:29468538-29468560 GTGTGGATGTGGGGAGAGGAGGG + Intergenic
1005813941 6:29535307-29535329 GTGTAGATGTGGGGAGAGAAGGG + Intergenic
1006269445 6:32952524-32952546 CTGTAGAGGATGGGGCAGAATGG - Intronic
1006629033 6:35418237-35418259 GTGCAGATGCTGGGGCAGGCAGG - Intronic
1007447029 6:41914753-41914775 GTGTGGATGATGGGGGATGATGG - Intronic
1007701317 6:43768155-43768177 GTAGACATCTTGGGGCAGGATGG - Intergenic
1008485726 6:52033341-52033363 TTGTGGGTGTGGGGGCAGGATGG - Intronic
1008709110 6:54201667-54201689 TTGTAGATTTTGGGGCATGGAGG + Intronic
1009187421 6:60589758-60589780 GTGTAGATCATGGTGCAGTAGGG + Intergenic
1009791390 6:68405536-68405558 GGGAAGATGTAGGGGCAGAAAGG + Intergenic
1010407477 6:75521350-75521372 GAGAGGATGTTGGGGTAGGAGGG - Intergenic
1012739813 6:103001980-103002002 GCCTAGAGGTAGGGGCAGGAAGG + Intergenic
1014255613 6:119157941-119157963 GGGTAGAGATTGGGGTAGGAAGG - Intergenic
1016497607 6:144682136-144682158 GGGTAGTTGGTGGGGCAGGGGGG - Intronic
1018792854 6:167162682-167162704 ATGTAAATGTATGGGCAGGAGGG + Intronic
1019255489 7:47066-47088 AACTAGATGTGGGGGCAGGAGGG - Intergenic
1019622736 7:2000521-2000543 GTGGAAATGGTGGGGCAGGCAGG - Intronic
1019670952 7:2278063-2278085 GTGTGTGTGTCGGGGCAGGAGGG - Intronic
1019680679 7:2347152-2347174 GTGGAGATGGTGGGGGCGGAGGG - Intronic
1020802838 7:12753544-12753566 GTTTAGATATTGGGTCACGAAGG - Intergenic
1023821941 7:43985480-43985502 GGGGAGGTGTGGGGGCAGGAGGG - Intergenic
1024725389 7:52188994-52189016 GTGTAGAAGCTGGGGTGGGATGG - Intergenic
1025187379 7:56871520-56871542 GAGGAGAGGCTGGGGCAGGAGGG + Intergenic
1025683143 7:63695596-63695618 GAGGAGAGGCTGGGGCAGGAGGG - Intergenic
1025684546 7:63705400-63705422 GAGGAGAGGCTGGGGCAGGAGGG - Intergenic
1025772774 7:64528518-64528540 GTGTAGAAGTTGGGTGAGGCAGG + Intronic
1027024565 7:74841570-74841592 GTGTGGATGAGGGGGAAGGATGG - Intronic
1027055037 7:75043872-75043894 GTGGAGATGTTGGGCCAGTGGGG - Intronic
1027063200 7:75102552-75102574 GTGTGGATGAGGGGGAAGGATGG + Intronic
1029011763 7:97269565-97269587 GAGTAGATGTGGGGGTAGGTAGG + Intergenic
1029353127 7:100029762-100029784 GTGAACATGCTGGTGCAGGAAGG + Intronic
1029576436 7:101406599-101406621 GAGTACCTGCTGGGGCAGGATGG - Intronic
1029663816 7:101981193-101981215 GTGTATAGGTTGGGGGAGGAGGG - Intronic
1029750205 7:102538893-102538915 GGGGAGGTGTGGGGGCAGGAGGG - Intronic
1029768156 7:102638001-102638023 GGGGAGGTGTGGGGGCAGGAGGG - Intronic
1030850613 7:114481231-114481253 ATGTACATGAGGGGGCAGGAGGG - Intronic
1031276695 7:119733033-119733055 GCATAGCTATTGGGGCAGGAAGG + Intergenic
1031911124 7:127517693-127517715 GGGTAGCTGCTGGGGCAGCAAGG + Intergenic
1032285022 7:130533292-130533314 GTGTAGGGGTTGGGGCACAAGGG + Intronic
1032428638 7:131842792-131842814 GTGTAGAGGCAGGGGCTGGAAGG - Intergenic
1032629034 7:133626546-133626568 GTTTAGGTGTTGGGGTAGGGAGG + Intronic
1032675274 7:134124374-134124396 GTGTATGTGTTGGAGCAGGCAGG - Intergenic
1033543239 7:142376304-142376326 GTGAAGAGGCTGGGGCAGCAAGG + Intergenic
1033581332 7:142739833-142739855 GTGTACGTGTTGGGGGAGGAAGG + Intergenic
1034293195 7:149948515-149948537 ATGGAGAGGGTGGGGCAGGAAGG - Intergenic
1034812879 7:154148364-154148386 ATGGAGAGGGTGGGGCAGGAAGG + Intronic
1035318063 7:158009925-158009947 GTGCCCATGGTGGGGCAGGATGG - Intronic
1038433171 8:27515935-27515957 GTGACCAGGTTGGGGCAGGAGGG + Intronic
1038869528 8:31479268-31479290 GTGGGGATGGTGGGGGAGGAAGG + Intergenic
1039080735 8:33731777-33731799 GTGTATATGTTGAGGCTGTAGGG + Intergenic
1039232852 8:35467722-35467744 GGGCAGATGTTGGGGTAGGGTGG + Intronic
1039391404 8:37183899-37183921 GTGTGGATGTTGTGCAAGGAAGG - Intergenic
1041513943 8:58679318-58679340 GACTAAAAGTTGGGGCAGGATGG + Intergenic
1045825531 8:106393019-106393041 GTGGAGAAGTTGGAGAAGGATGG - Intronic
1047078425 8:121431732-121431754 GTGTACATGTTCTGGAAGGAAGG + Intergenic
1047514880 8:125545197-125545219 ATGTGGATGTTAGGGCAGGAAGG + Intergenic
1048086585 8:131187104-131187126 GTGGTGAGGTTGGGGGAGGAGGG + Intergenic
1048521613 8:135160481-135160503 GTGTGTATGGTGGGACAGGATGG + Intergenic
1049176391 8:141195252-141195274 GTGTGGTTGTTGGAGCCGGAGGG + Exonic
1049404307 8:142444906-142444928 GTGCAGATGTTGAGGAAGGATGG - Intergenic
1049738506 8:144222682-144222704 GTGTGGATGTGGGTGCAGGTAGG + Intronic
1053307553 9:36995127-36995149 GTGTGGCTTTGGGGGCAGGAAGG - Intronic
1053423731 9:37997598-37997620 GTGTAGAAGCTGGCACAGGAGGG + Intronic
1054703574 9:68438828-68438850 GTGTGTATGTTGGGGGAGGAGGG + Intronic
1056463060 9:86826668-86826690 GTGGTGGTGTTGGGGAAGGAAGG - Intergenic
1056775272 9:89507772-89507794 GTGTTGATGTTGATGCTGGAGGG + Intergenic
1057081488 9:92177365-92177387 GTGAAGATGCTGGGGTAGGCAGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1059777361 9:117488907-117488929 GTGCAGCTGATGGGGCAGGAAGG + Intergenic
1060795491 9:126509970-126509992 GTGATGATGGTGGGACAGGAAGG + Intergenic
1060997408 9:127882953-127882975 GTGCAGATGGAGGTGCAGGAAGG + Intergenic
1062128979 9:134882528-134882550 GTGAAGATGGTGGGCCTGGAGGG + Exonic
1062218063 9:135399781-135399803 GTCCAGATGATGGGGCTGGAAGG + Intergenic
1186209505 X:7234532-7234554 GAGTAGATGTTGGACAAGGAGGG + Intronic
1186597803 X:11002818-11002840 GTGTGGATGTTGGGGGAGGAGGG - Intergenic
1187714286 X:22086668-22086690 GTGTATATGTTGGGGTGGGGAGG + Intronic
1187743751 X:22385541-22385563 GTGTGGATGTTGGGGGTAGATGG - Intergenic
1189194901 X:39144760-39144782 TGGTGGATGTTGAGGCAGGAAGG - Intergenic
1189605701 X:42675437-42675459 GTGTAAATGTGGCAGCAGGAAGG + Intergenic
1189701342 X:43718061-43718083 GGTTAGATGGTGTGGCAGGATGG + Intronic
1190024619 X:46912370-46912392 GAGGAGAGGTTGGGGGAGGAAGG + Intronic
1190093654 X:47461902-47461924 GTAGAGATGGTGGTGCAGGAGGG + Intronic
1190234363 X:48604507-48604529 GTGAGGCTGTTGGGGCAGGAGGG - Intronic
1190760787 X:53436441-53436463 GTGTAGATGCTGGGGAGGGCAGG - Intergenic
1191780311 X:64857380-64857402 GTGTATATTTGGGGGCAGGGAGG - Intergenic
1192191886 X:68996078-68996100 GTGGAGAAGCTGGGGCAGGGCGG + Intergenic
1192487476 X:71541798-71541820 GTCTAGATGTTGTGGCTGGTGGG + Intronic
1194467887 X:94255682-94255704 GTGTTTATGCAGGGGCAGGATGG - Intergenic
1197700823 X:129598213-129598235 GTGGAGAGGTGGGGGCTGGAGGG - Intergenic
1198277859 X:135113140-135113162 CTGTGGATGTTTGGGCTGGAAGG - Intergenic
1200065138 X:153501224-153501246 GTGTGCATGTTCTGGCAGGAGGG + Intronic
1201286112 Y:12380022-12380044 GTGTGGATGTTCGTGCTGGAGGG - Intergenic