ID: 1125466978

View in Genome Browser
Species Human (GRCh38)
Location 15:39963011-39963033
Sequence TTGTATCTCCTTAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125466978_1125466985 19 Left 1125466978 15:39963011-39963033 CCTTCCTCTTTAAGGAGATACAA 0: 1
1: 0
2: 2
3: 12
4: 221
Right 1125466985 15:39963053-39963075 GGAAGCAGCCAGCAGGTGGAGGG 0: 1
1: 0
2: 8
3: 62
4: 521
1125466978_1125466984 18 Left 1125466978 15:39963011-39963033 CCTTCCTCTTTAAGGAGATACAA 0: 1
1: 0
2: 2
3: 12
4: 221
Right 1125466984 15:39963052-39963074 AGGAAGCAGCCAGCAGGTGGAGG 0: 1
1: 1
2: 4
3: 66
4: 605
1125466978_1125466980 -2 Left 1125466978 15:39963011-39963033 CCTTCCTCTTTAAGGAGATACAA 0: 1
1: 0
2: 2
3: 12
4: 221
Right 1125466980 15:39963032-39963054 AAATAAGCAAAAGAGTTGCCAGG 0: 1
1: 0
2: 2
3: 32
4: 639
1125466978_1125466981 12 Left 1125466978 15:39963011-39963033 CCTTCCTCTTTAAGGAGATACAA 0: 1
1: 0
2: 2
3: 12
4: 221
Right 1125466981 15:39963046-39963068 GTTGCCAGGAAGCAGCCAGCAGG 0: 1
1: 1
2: 1
3: 27
4: 315
1125466978_1125466982 15 Left 1125466978 15:39963011-39963033 CCTTCCTCTTTAAGGAGATACAA 0: 1
1: 0
2: 2
3: 12
4: 221
Right 1125466982 15:39963049-39963071 GCCAGGAAGCAGCCAGCAGGTGG 0: 1
1: 1
2: 12
3: 89
4: 617

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125466978 Original CRISPR TTGTATCTCCTTAAAGAGGA AGG (reversed) Intronic
901748406 1:11390003-11390025 TTGTGTTTTCTTAAAGAGTAAGG + Intergenic
904172819 1:28603568-28603590 TTGTCTCTCCTTTCAGAGAATGG - Exonic
905885585 1:41490077-41490099 TTGTTTCTCATGAAGGAGGATGG - Intergenic
906422650 1:45683731-45683753 TTGTATTTTATTAGAGAGGAGGG - Intronic
908094181 1:60719839-60719861 TTTTATTTCCTTAACCAGGAGGG + Intergenic
910864609 1:91776808-91776830 TTGGAGCTCATTAAAGACGAGGG + Intronic
911580351 1:99626650-99626672 TTGTTTCTTCTTAGAGAGAAGGG - Intergenic
916728559 1:167545629-167545651 TTGTATTTTCATAAAGAGGGTGG - Intronic
920687191 1:208118395-208118417 TTGCATCTCCTGGAAGAGGGTGG - Intronic
923115603 1:230934593-230934615 TTGTTTCTACTTAAATAGAATGG - Intronic
923639650 1:235741918-235741940 TTATTCATCCTTAAAGAGGAAGG + Intronic
924048602 1:240058049-240058071 TGGTCTCTCGCTAAAGAGGAAGG - Intronic
924676990 1:246189168-246189190 TTCTAACTTCTTAAAGAGAAAGG + Intronic
1064439892 10:15344095-15344117 TTGCACCTCTTTAAAGATGAAGG - Intronic
1064815560 10:19258045-19258067 TTGTAACTCCTTAAATATAATGG - Intronic
1068522040 10:58087565-58087587 TTGTACCTACTTAAAGGTGAGGG - Intergenic
1068915076 10:62422319-62422341 TTGTGCCTCCTTAATGATGAGGG - Intronic
1071296481 10:84224252-84224274 TTGAATCTCTCTAATGAGGATGG + Intronic
1072081041 10:92032330-92032352 TTGTATCTCTTTACAGATGGTGG - Intergenic
1073398345 10:103236811-103236833 TTGTACCTTTTTATAGAGGATGG + Intergenic
1074177075 10:111018499-111018521 TTGTATTTCCTTAAAGAATTGGG + Intergenic
1077631876 11:3816607-3816629 TTGCATCTCCTCAGAGAGGGAGG + Intronic
1078689912 11:13569402-13569424 TTATTTAGCCTTAAAGAGGATGG + Intergenic
1081687190 11:45051293-45051315 TTATTTAGCCTTAAAGAGGAAGG - Intergenic
1082733625 11:56830749-56830771 TTGTATGTCGTTAAAGATGGGGG - Intergenic
1085049269 11:73371758-73371780 CTGTATCTCATGGAAGAGGAGGG + Intergenic
1085073061 11:73565648-73565670 ATGTCTCTCCTTAAAGAGTTAGG - Intronic
1085726187 11:78956655-78956677 TTGTGTCTTCTTAAAAATGAGGG - Intronic
1086204390 11:84240421-84240443 TTGTCTCTCCTTACAGCTGAGGG + Intronic
1088723484 11:112614340-112614362 TTTTCTGTCCTTAAACAGGAAGG - Intergenic
1090951201 11:131474974-131474996 TTGTTATTCCTTAAAGAGCAAGG - Intronic
1093490555 12:19700172-19700194 TTTTATCTCCTGAAACTGGACGG - Intronic
1093888981 12:24496857-24496879 TTGTATATTCATAAAGAGCAAGG - Intergenic
1095043003 12:37464880-37464902 TGGTGTCTCCTTGGAGAGGAGGG + Intergenic
1095328526 12:40928111-40928133 TTGTATTTCCTTACAGAGAAAGG - Intronic
1099899344 12:88688604-88688626 TTGTCTAGCCTTGAAGAGGAAGG + Intergenic
1100686167 12:96988228-96988250 TTGTATCTTCTAAAATGGGAAGG + Intergenic
1101220632 12:102635536-102635558 TTGTATCTTCTTGTAGAGAAGGG - Intergenic
1103181370 12:118914833-118914855 TTGTACATCCTTAAAGAGCCTGG + Intergenic
1105447124 13:20467423-20467445 TTTTTTCTCCTTAAATTGGATGG + Intronic
1105844615 13:24283272-24283294 TTGCATCCCCTTAAAGACAAGGG + Intronic
1106537563 13:30660669-30660691 TTATCTCTCCATACAGAGGAGGG + Intronic
1107723439 13:43273603-43273625 TTGTCTCTACCTAGAGAGGATGG - Intronic
1107810681 13:44197126-44197148 GTGTGTCTCCTTAAGGAGGTTGG + Intergenic
1108286270 13:48911413-48911435 TTTTTTCTCCATAAAGAGCAGGG - Intergenic
1110241164 13:73268671-73268693 TGGTATCTGCTCAAAGAGAAAGG - Intergenic
1110512819 13:76372564-76372586 TTGTATCTCCCTATGGAGAAAGG - Intergenic
1115089528 14:29557299-29557321 TTGGATCTCTTAAAATAGGAAGG + Intergenic
1117781908 14:59242061-59242083 CTGTTTATCCTTAAAGAGGCAGG - Intronic
1118149933 14:63178734-63178756 TTGTATCTCCATTATGATGAGGG - Intergenic
1123126370 14:105949000-105949022 TTAAATTTCCTAAAAGAGGAAGG + Intergenic
1202941544 14_KI270725v1_random:152482-152504 TGGTGTCTCCTTGGAGAGGAGGG + Intergenic
1124134660 15:27023642-27023664 TTATTTTGCCTTAAAGAGGAAGG - Intronic
1125078723 15:35651565-35651587 CTGTATCTCCTAGAAAAGGATGG - Intergenic
1125466978 15:39963011-39963033 TTGTATCTCCTTAAAGAGGAAGG - Intronic
1125497661 15:40212137-40212159 TTGAATCCCATTTAAGAGGAAGG - Intronic
1126164482 15:45642978-45643000 TTGTTTCTCCTCCAACAGGAGGG + Intronic
1126291931 15:47090910-47090932 TGGTGTCTCCTTGGAGAGGACGG - Intergenic
1127248519 15:57205139-57205161 TTGTATTTCTTTATAGAGGCGGG - Intronic
1130911731 15:88275562-88275584 TTGTAGCCCCTGAAAAAGGAGGG - Intergenic
1133760522 16:8795077-8795099 TTGTAACACAGTAAAGAGGAAGG - Intronic
1133984496 16:10657917-10657939 TTGTATCTCAATAAAGATGTTGG - Intronic
1140674238 16:77311548-77311570 TTGTATCTCTCTAAAATGGATGG - Intronic
1141786748 16:86205888-86205910 TTGCATCTCTTGAAAGAGGCTGG + Intergenic
1145835492 17:27951480-27951502 TTGTATCTCCTTAAGTTGCAGGG + Intergenic
1146776361 17:35620810-35620832 TTGTATTTTTTTAAAGAGGCAGG - Intronic
1147344966 17:39784706-39784728 TTGTAAATCCTTAAAGTGTAGGG + Intronic
1148069633 17:44900518-44900540 TTGAATGTCTTTAATGAGGAAGG - Intronic
1149445880 17:56713052-56713074 ATGTATCTCCTTGAAAAAGAAGG + Intergenic
1153232027 18:2947377-2947399 TTGTTTGTCCTTCTAGAGGATGG - Intronic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1156745709 18:40388773-40388795 TTGTATCTCCCTAAACAGGTTGG - Intergenic
1157570316 18:48708051-48708073 TTATATGGCCATAAAGAGGAAGG - Intronic
1158167899 18:54562093-54562115 GTGTCACTCCTGAAAGAGGATGG - Intergenic
1159058177 18:63487446-63487468 TTCTTTCTCCTTAAAGAGCAGGG + Intronic
1159263351 18:66045850-66045872 TTGTTTCTGCTTAAACAGGTTGG - Intergenic
1162330141 19:10023031-10023053 TTGTATATTCTTAAAGAGGAAGG + Intergenic
1164326260 19:24194991-24195013 TTGTGTGCCCTTAAAGAGGGGGG - Intergenic
1165687361 19:37833367-37833389 TTTTGTCTCCTTAAACTGGATGG - Intergenic
927412028 2:22837472-22837494 TTGTCTCTACTTAAACATGATGG - Intergenic
927918257 2:26950363-26950385 TTGTGTTTCTTCAAAGAGGAGGG + Intergenic
927948337 2:27150595-27150617 ATGCACCTCCTTGAAGAGGAGGG + Intronic
928114384 2:28536742-28536764 ATGTATGACCTTATAGAGGAGGG + Intronic
928216651 2:29367043-29367065 TTGTATTTTCAAAAAGAGGACGG - Intronic
933279490 2:80317372-80317394 TTGTATATTCTGAAAGTGGAAGG - Intronic
935100418 2:99989393-99989415 TTGTATGTCCATAAAGCTGATGG - Intronic
936735549 2:115438552-115438574 TTATTTAGCCTTAAAGAGGAAGG + Intronic
936790795 2:116149173-116149195 TGGTATCTCATGACAGAGGAAGG + Intergenic
940029906 2:149250851-149250873 TTGTGTAGCCTTAAAAAGGAAGG - Intergenic
940149374 2:150582448-150582470 TTCTATCTCCTTAAAAATCATGG + Intergenic
940921936 2:159317241-159317263 TTGAATTTCCTTAAAGAATATGG + Intergenic
941338981 2:164282191-164282213 TTCTAGTTCCTTAAAGAGCATGG + Intergenic
943905077 2:193489411-193489433 TTATAACTCCTTACAGATGATGG + Intergenic
943964630 2:194318261-194318283 TGGAATCTCCTTAAATAGTAGGG - Intergenic
945864059 2:215157059-215157081 TTTTATCACCTTAAAAAGAATGG + Intergenic
946959576 2:224969754-224969776 TTTTATTTCCTTAAAGATGTTGG - Intronic
947443719 2:230146608-230146630 TTGTTTAACCTTAAAAAGGAAGG + Intergenic
948331745 2:237173069-237173091 TTATTTAGCCTTAAAGAGGAGGG - Intergenic
948706548 2:239796649-239796671 TTATTTAGCCTTAAAGAGGAAGG - Intronic
1169523063 20:6393844-6393866 TTGTATCTACTTAACAAGGCTGG + Intergenic
1171537426 20:25907634-25907656 TGGTGTCTCCTTGGAGAGGAGGG + Intergenic
1171803683 20:29653652-29653674 TGGTGTCTCCTTGGAGAGGAGGG - Intergenic
1174775413 20:53339237-53339259 CTGTATCTCTTGGAAGAGGAAGG - Intronic
1175056294 20:56201654-56201676 TTGGATCTCCTCAACTAGGAAGG - Intergenic
1176581621 21:8534452-8534474 TGGTGTCTCCTTGGAGAGGAGGG - Intergenic
1178088073 21:29132983-29133005 TTATATGACCTTAAAGAGGCAGG + Intronic
1180264455 22:10511524-10511546 TGGTGTCTCCTTGGAGAGGAGGG - Intergenic
1181155919 22:20920527-20920549 TTGAGTCTCCTTCTAGAGGAAGG + Intronic
1182189539 22:28444105-28444127 ATGTATCTCCTTAAATAGGATGG - Intronic
1183259639 22:36786134-36786156 TGGTAACTCTTTAAAGAAGAGGG - Intergenic
1183616240 22:38947533-38947555 TTGTACCTCCTGTAAGAGCAGGG - Intergenic
949745550 3:7288160-7288182 TTGTATATCCTTAAAGGAGAAGG - Intronic
949956420 3:9272585-9272607 TTATTCATCCTTAAAGAGGAAGG - Intronic
950610390 3:14123241-14123263 CTGTAAATCCTCAAAGAGGAGGG + Intronic
953708775 3:45251982-45252004 TTCTCTCTTCTAAAAGAGGAAGG + Intergenic
953910594 3:46890921-46890943 CAGAATCTCCTTGAAGAGGAGGG + Intronic
957121216 3:76096044-76096066 TTTTATCTCCTTAGAGATAAAGG - Intronic
957923799 3:86781260-86781282 TTGTATCTCTAAAAAGAGTATGG - Intergenic
959795785 3:110426894-110426916 TTGTTTCTCCTTTAGAAGGAAGG + Intergenic
959909561 3:111748403-111748425 TGGTATTTCCTGAAATAGGAGGG + Intronic
960678030 3:120216071-120216093 TTTTGTCTCAATAAAGAGGAAGG - Intronic
961341494 3:126225167-126225189 ATGTATCTCTATAAAGGGGAGGG + Intergenic
962646039 3:137441253-137441275 TTCTATCTCTTTTCAGAGGAGGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964892919 3:161558040-161558062 CTGTATCACCTTACAGATGATGG + Intergenic
965126108 3:164631897-164631919 TTGTCTCTCCTTATAAAAGAGGG + Intergenic
965883190 3:173411936-173411958 TTGTATTTTCTGAAAGAGAATGG + Intronic
970907687 4:21236121-21236143 TTGTATCTTCTTGTAGAGGCAGG - Intronic
971246446 4:24933200-24933222 TTGTATGTACTTAAATGGGAGGG + Intronic
971891075 4:32522762-32522784 TTTTATTTCCTTCAAGAAGAAGG + Intergenic
971951258 4:33350107-33350129 TTGCATCTCCTAAAAGCTGAGGG - Intergenic
972610107 4:40648659-40648681 TTGTATCTCCAGCACGAGGATGG + Intergenic
972880394 4:43416063-43416085 TTGTATCTGCTTAACTATGAAGG + Intergenic
972976450 4:44642207-44642229 TTGTTTCTCTTTGAAGAGGATGG - Intronic
974211262 4:58779241-58779263 TTGAATCTACATACAGAGGAAGG - Intergenic
974250873 4:59381284-59381306 TTGGATCTACTTAAAGTGGGAGG + Intergenic
975654346 4:76626681-76626703 TTGTCCCTCTTTACAGAGGAAGG + Intronic
976141367 4:81996154-81996176 TTCTATATCCTTCAAAAGGAAGG + Intronic
976537115 4:86230892-86230914 TTTTATCTGCTTAGATAGGAGGG + Intronic
977749989 4:100597984-100598006 TTATTTATCCTTAAAGAGGAGGG - Intronic
979809094 4:125013137-125013159 TTGGATCTGCTTAAAGGGCAAGG + Intergenic
980370073 4:131857681-131857703 TTCTAGCTGCTTATAGAGGATGG + Intergenic
982243185 4:153321174-153321196 CTGTATCTCTTTAAAGAGTGTGG - Intronic
982371811 4:154641921-154641943 CTGTATCACCTCAAAAAGGAGGG - Intronic
982565884 4:156986358-156986380 TTGTCTCTTTCTAAAGAGGATGG + Intergenic
982798332 4:159671888-159671910 TAGTTTCTCCTTCAAGATGAAGG - Intergenic
983115962 4:163816669-163816691 TTATCTCTCCTTACAGAGGGGGG + Intronic
984376937 4:178943678-178943700 TTCTATCTCCTTGAGGATGAAGG + Intergenic
990174432 5:53091419-53091441 TTGTGCCTCCTAAAAGAGAAAGG - Exonic
991698079 5:69292187-69292209 TGGAAGCACCTTAAAGAGGATGG - Exonic
992584886 5:78228469-78228491 TTTTATTCCCTTCAAGAGGAAGG - Intronic
993469014 5:88284039-88284061 TTTTTTCTCCTTAAACTGGATGG + Intergenic
994826973 5:104725404-104725426 TTGTATTTCCTTAAAGAATCTGG + Intergenic
995830364 5:116348391-116348413 TGGTCCCTCCTGAAAGAGGAAGG + Intronic
996497672 5:124180302-124180324 TTTTCTCTCCTTCAAAAGGAAGG + Intergenic
997778433 5:136632300-136632322 TTGCATCTCTTTAATGAGTAAGG + Intergenic
997968436 5:138379740-138379762 ATCCATCCCCTTAAAGAGGATGG + Intronic
998191803 5:140031651-140031673 TTGTATGGCTTTAGAGAGGAGGG - Intronic
999678305 5:154029572-154029594 TTGTCTCTCCTACAAGAGGGAGG + Exonic
1000041722 5:157489447-157489469 TTGTGTCTCCTCACAGGGGAAGG - Intronic
1000696042 5:164385334-164385356 TAGTATATCCTTAATGATGAAGG - Intergenic
1000819232 5:165963009-165963031 TTTTATCATCTTAAAGAGTAGGG - Intergenic
1000873217 5:166603188-166603210 TTATTTCACCTTAAAAAGGAAGG - Intergenic
1003067572 6:2916826-2916848 TTTTATTTCCTTCAAGAGTAAGG - Intergenic
1003615424 6:7651003-7651025 TTGTTTCTCCTAAAATAGAAAGG + Intergenic
1005108335 6:22250117-22250139 TTGGAGCTCCTTAAAGCAGAGGG + Intergenic
1005351081 6:24936215-24936237 TCATATTTCCTTAAAGAGGAAGG + Intronic
1005446446 6:25928813-25928835 GTATATCTCCTTAAAGGGAAGGG - Intronic
1007004798 6:38350872-38350894 TAGTATCTCCTTAAAGGAAAAGG - Intronic
1007364368 6:41380829-41380851 TTGGATTTCTTTAAAGATGAAGG + Intergenic
1008528085 6:52427868-52427890 TTGTATTTACTTCAAGATGAAGG - Intronic
1008533426 6:52486587-52486609 TTCTATCTCCTTAAAGAAAATGG - Intronic
1008682601 6:53889794-53889816 TTATATCTCCGTAAAAAGAATGG + Intronic
1010457518 6:76075364-76075386 TTGTATATTCTTAAAGAGATAGG + Intergenic
1011155883 6:84330977-84330999 CTATATAGCCTTAAAGAGGAGGG + Intergenic
1012485709 6:99720591-99720613 TTGAAGTTCCTTAAAGATGATGG + Intergenic
1013337091 6:109174608-109174630 TTTTTTCTCCTCAAAAAGGAAGG - Intergenic
1014581375 6:123141689-123141711 TTGACTCACCTTAAAGATGATGG - Intergenic
1015015104 6:128403299-128403321 TTGTTTCTCTGTAAAGATGAAGG - Intronic
1017699022 6:157049625-157049647 TTGTATCTCATTGAGGAAGAGGG + Intronic
1018329365 6:162710844-162710866 GTGAATCTCCCTAAAGAGGTGGG + Intronic
1018472466 6:164108891-164108913 TTGCTTCTCCTTCCAGAGGAGGG + Intergenic
1020362688 7:7346462-7346484 TTGTATTGCCTTTAAGAGGGAGG - Intergenic
1020643921 7:10790609-10790631 TTGTTTCTCCTTCAAGATAATGG + Intergenic
1022632495 7:32098369-32098391 TTCTCTGTCCTTAAAGAGAAAGG - Intronic
1024042205 7:45564446-45564468 TTGCATCTCCTTTAAGGGTAGGG - Intergenic
1025288904 7:57694463-57694485 TGGTGTCTCCTTGGAGAGGAGGG + Intergenic
1025517753 7:61674623-61674645 TTGAAGCTCTTTAAAGAGAATGG - Intergenic
1025542077 7:62103271-62103293 TTGAAGCTCTTTAAAGAGAATGG - Intergenic
1028400539 7:90420695-90420717 TTGTATCTTCTTAAAAGGGTTGG - Intronic
1028612756 7:92730714-92730736 TTATTTAACCTTAAAGAGGAAGG - Intronic
1028870532 7:95766717-95766739 TTGTATCTCAGGAAATAGGAAGG - Intergenic
1030084470 7:105804896-105804918 TTGTACCTTTTTAAAGAGGACGG + Intronic
1030220428 7:107093054-107093076 TTATATCATCTTAAAAAGGAAGG - Intronic
1032057115 7:128692343-128692365 TTGTTTCTCCTTCAAAATGAGGG + Intergenic
1032630052 7:133640815-133640837 TTATCTTTCCTTAAAAAGGATGG - Intronic
1033567716 7:142595685-142595707 ATGTCTATCCTTAATGAGGAAGG - Intergenic
1036975026 8:13401227-13401249 TTGTTTATCATTAAACAGGAAGG - Intronic
1040702531 8:50084709-50084731 TTGTAACACCATAAAGAGGTGGG + Intronic
1042725059 8:71865632-71865654 TTATTTCTCCTTAAAGTGGGAGG + Intronic
1043140440 8:76581998-76582020 TTGTATTTGCTTAAAGGGGAAGG + Intergenic
1043739539 8:83793175-83793197 TTCTCTCCCCTTAATGAGGAAGG + Intergenic
1044641260 8:94384306-94384328 TTGTTTAGCCTTAAAAAGGAAGG + Intronic
1046503021 8:115102820-115102842 ATGTATGTGGTTAAAGAGGATGG + Intergenic
1047844356 8:128789834-128789856 TTGTAAGTCCTTGAAGATGATGG - Intergenic
1048556870 8:135486919-135486941 TTTTATTTTCTTAAAGAGGATGG + Intronic
1048760353 8:137787829-137787851 TTGTTTCCCCTGACAGAGGAGGG + Intergenic
1050595565 9:7201001-7201023 ATGTATCTCCTAAAACAAGAAGG + Intergenic
1051195597 9:14560212-14560234 TTGTAGCACCTTAAAAAGAAAGG + Intergenic
1051563702 9:18472034-18472056 TTGGATCTGCTTAATGAGCAGGG + Intergenic
1053634646 9:39984169-39984191 TTCTAGCTGCTTATAGAGGATGG + Intergenic
1053771282 9:41480164-41480186 TTCTAGCTGCTTATAGAGGATGG - Intergenic
1054209241 9:62266528-62266550 TTCTAGCTGCTTATAGAGGATGG - Intergenic
1054315575 9:63581602-63581624 TTCTAGCTGCTTATAGAGGATGG + Intergenic
1055335642 9:75230414-75230436 TTCTACCTTCTTAAATAGGAAGG + Intergenic
1055634643 9:78264294-78264316 TTGGATCTCCTTAAAGATGCTGG + Exonic
1056524115 9:87426800-87426822 TTATCTCTACTTAAAGAAGAAGG + Intergenic
1057873427 9:98734791-98734813 GTGTGTCTCCTTAAAAAGGCTGG + Exonic
1058566350 9:106289301-106289323 TTGTTTTTTCTTAAAGAGCAAGG + Intergenic
1203611638 Un_KI270749v1:12489-12511 TGGTGTCTCCTTGGAGAGGAGGG - Intergenic
1185923238 X:4117830-4117852 TTCTATCCCATTCAAGAGGATGG + Intergenic
1186949223 X:14604456-14604478 TAGTATGTCATTAAAGAGAAAGG + Intronic
1187214887 X:17266443-17266465 TTCTTTCTGCTTAAAGAGTAAGG + Intergenic
1187418593 X:19114951-19114973 TTGTACCTGCTTCAAGAGGTTGG + Intronic
1188234011 X:27704333-27704355 TAGTATCTCCTTTATGAGGCTGG - Intronic
1189187314 X:39065473-39065495 ATGAAACTCCTTAAAAAGGAGGG + Intergenic
1192037290 X:67577719-67577741 TTGCATTTCCTTGAAGAGTAAGG + Intronic
1195431089 X:104790396-104790418 TGGTCTCTCTTTAAAAAGGAGGG - Intronic
1197048143 X:122025535-122025557 GAGTATCTTCTTAAAGAGTAAGG - Intergenic
1197189577 X:123630971-123630993 TTGTATCTCTTAAAAGACAAAGG + Intronic
1197529218 X:127602057-127602079 TTGTATCTCAGAAAATAGGAAGG - Intergenic
1198749390 X:139923366-139923388 GTGTATGTCCTTCAAAAGGATGG + Intronic
1198931046 X:141860607-141860629 TTGTTCCTCCTTAAATATGAAGG + Intronic
1199773160 X:150987510-150987532 TTTTTTTTCCTTAAAGAGTAAGG - Intronic
1199803981 X:151279631-151279653 TCCTAGCTCCTTAAAGAAGAGGG - Intergenic
1201329383 Y:12801482-12801504 TTGTATCTTCATAAAGACAAAGG + Intronic