ID: 1125471348

View in Genome Browser
Species Human (GRCh38)
Location 15:40007396-40007418
Sequence CCACCAATTAAGTTTTAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 681}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125471348_1125471355 20 Left 1125471348 15:40007396-40007418 CCCTTTTAAAACTTAATTGGTGG 0: 1
1: 0
2: 4
3: 36
4: 681
Right 1125471355 15:40007439-40007461 TATGTGAAAACTGCCTACACAGG 0: 1
1: 0
2: 1
3: 7
4: 119
1125471348_1125471353 -7 Left 1125471348 15:40007396-40007418 CCCTTTTAAAACTTAATTGGTGG 0: 1
1: 0
2: 4
3: 36
4: 681
Right 1125471353 15:40007412-40007434 TTGGTGGGACAAATGGCCAGTGG 0: 1
1: 0
2: 1
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125471348 Original CRISPR CCACCAATTAAGTTTTAAAA GGG (reversed) Intronic
900107074 1:987087-987109 CCACAAACTAATTTTTAAAATGG - Intergenic
900840732 1:5046665-5046687 CCAGCAATTTACTCTTAAAAAGG + Intergenic
903587991 1:24431682-24431704 CCTTTAATTCAGTTTTAAAAGGG - Intronic
904996531 1:34635852-34635874 CCAGCAATTTACTCTTAAAAAGG - Intergenic
907292578 1:53426087-53426109 CCAGCAATTTACTCTTAAAAAGG + Intergenic
907503619 1:54901761-54901783 CCAGCAATTTACTCTTAAAAAGG - Intergenic
907521207 1:55024417-55024439 CCAGCAATTTACTCTTAAAAAGG + Intergenic
908277177 1:62485799-62485821 CATCCATTTAAGTTTTACAAAGG + Intronic
908461765 1:64353861-64353883 CCAGCAATTTACTCTTAAAAAGG - Intergenic
908592006 1:65645768-65645790 CCAGCAATTTACTCTTAAAAAGG - Intergenic
909222711 1:72983724-72983746 CCAGCAATTTATTCTTAAAAAGG - Intergenic
909690571 1:78402887-78402909 CCATTATTTTAGTTTTAAAATGG - Intronic
909776746 1:79492456-79492478 CCAGCAATTTACTCTTAAAAAGG - Intergenic
909793031 1:79700237-79700259 CCAGCAATTTACTCTTAAAAAGG - Intergenic
909909908 1:81247256-81247278 CCAGCAATTTACTCTTAAAAAGG + Intergenic
910145125 1:84071409-84071431 CAACAAAATTAGTTTTAAAAAGG - Intergenic
910698670 1:90048929-90048951 CCACTACATAAATTTTAAAAGGG + Intergenic
911570350 1:99511454-99511476 CCAGCAATTTACTCTTAAAAAGG + Intergenic
911689021 1:100810187-100810209 CCAAAAATTAATTTTTAATAGGG + Intergenic
911754051 1:101532030-101532052 TCTCCAATCAAATTTTAAAAGGG - Intergenic
912296425 1:108474768-108474790 CCAGCAATTTACTCTTAAAAAGG + Intergenic
912604561 1:110975699-110975721 ACACAAATAAAGATTTAAAATGG - Intergenic
912620386 1:111150261-111150283 CCACAAAATAAGATTTAAAGAGG - Intronic
915385074 1:155484008-155484030 CTACCGATTATATTTTAAAATGG + Intronic
917894979 1:179478797-179478819 CCAGGTATTCAGTTTTAAAAGGG - Intronic
918307505 1:183260513-183260535 CCAGCCATTTACTTTTAAAAGGG - Intronic
918347060 1:183615465-183615487 CCAGCAATTTACTCTTAAAAAGG + Intergenic
918434520 1:184497636-184497658 CTGCCAATGAATTTTTAAAATGG - Intronic
918549357 1:185723260-185723282 CCACCAAATCATTTTTAAAGAGG - Intergenic
918586040 1:186189607-186189629 CCACCAATCAAGATTTAATCCGG + Exonic
918714461 1:187769390-187769412 CCAGCAATTTATTCTTAAAAAGG - Intergenic
919476348 1:198036610-198036632 CCAGCAATTTATTCTTAAAAAGG + Intergenic
920165114 1:204030317-204030339 CCACCTATCAAATTTTAAATGGG - Intergenic
920829349 1:209450753-209450775 CCAGCAATTTACTCTTAAAAAGG + Intergenic
921083425 1:211763764-211763786 CCAACAAATAAATTTTAAATAGG - Intronic
921212365 1:212911322-212911344 CCAGCAATTTACTCTTAAAAAGG + Intergenic
921248286 1:213270753-213270775 CAGACAATTCAGTTTTAAAATGG + Intronic
921459835 1:215413836-215413858 CCAGCAATTTACTCTTAAAAAGG - Intergenic
921509208 1:216009824-216009846 CCAGCAATTTACTCTTAAAAAGG + Intronic
921520078 1:216147364-216147386 CCAGCAATTTACTCTTAAAAAGG + Intronic
921533137 1:216310310-216310332 CCCCCAAAAAAGTTTTAAAAAGG - Intronic
921733028 1:218597685-218597707 CCAGCAATTTACTCTTAAAAAGG - Intergenic
921912777 1:220569225-220569247 CCACAAGTCAATTTTTAAAATGG - Intronic
922049589 1:221976999-221977021 CCAGCAATTTACTCTTAAAAAGG - Intergenic
922154124 1:223028297-223028319 CCAGCAATTTACTCTTAAAAAGG - Intergenic
922906347 1:229176237-229176259 CCAGCAATTTATTCTTAAAAAGG + Intergenic
923075152 1:230603046-230603068 CCAGCAATTTACTCTTAAAAAGG + Intergenic
923244701 1:232119995-232120017 CCAGCAATTTACTCTTAAAAAGG + Intergenic
923257326 1:232233096-232233118 CCAGCAATTTACTCTTAAAAAGG - Intergenic
923408676 1:233687326-233687348 CCAGCAATTTACTCTTAAAAAGG - Intergenic
923962730 1:239103158-239103180 CCAGCAATTTACTCTTAAAAAGG + Intergenic
924180604 1:241435776-241435798 CCAGCAATTTACTCTTAAAAAGG + Intergenic
924703061 1:246473777-246473799 CCATGACTTAAGTTTTAAAGAGG + Intronic
924733577 1:246734224-246734246 GCTCCAAATGAGTTTTAAAATGG + Intronic
924893444 1:248309427-248309449 CTAACAATTCATTTTTAAAATGG - Intergenic
1063354199 10:5382635-5382657 CCAGCAATGAAGATTTAGAAGGG - Intergenic
1063509654 10:6633488-6633510 CCAGCAATTTACTCTTAAAACGG - Intergenic
1063527734 10:6800985-6801007 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1064301595 10:14127702-14127724 CCACTCATTAACGTTTAAAATGG + Intronic
1064663867 10:17630739-17630761 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1064887045 10:20123054-20123076 CCAGCAATTTACTCTTAAAAAGG - Intronic
1065768476 10:29054419-29054441 ACAGCACTTAAGTTTTAAAGAGG + Intergenic
1066071455 10:31818662-31818684 TCACAAATAATGTTTTAAAAAGG + Intronic
1068058401 10:52037657-52037679 CCAGCAATTTACTCTTAAAAAGG - Intronic
1068179707 10:53502928-53502950 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1068230921 10:54168572-54168594 CCAGCAATTTACTCTTAAAAAGG + Intronic
1068324044 10:55460568-55460590 GCACAAAATATGTTTTAAAAAGG - Intronic
1068592394 10:58864912-58864934 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1070474875 10:76820386-76820408 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1070905749 10:80071771-80071793 CAACAAAATTAGTTTTAAAAAGG - Intergenic
1071689260 10:87798055-87798077 ACAAAAATTAATTTTTAAAAAGG + Intronic
1071811343 10:89185146-89185168 CCACCAGCTAAGCTTTATAAAGG + Intergenic
1071897785 10:90084934-90084956 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1071916152 10:90296822-90296844 CCAGCAATTTATTCTTAAAAAGG + Intergenic
1072077643 10:91993958-91993980 CCAGCTGGTAAGTTTTAAAATGG + Intronic
1072200363 10:93152306-93152328 CCAAGAATTAAGTTAAAAAATGG + Intergenic
1072875729 10:99171257-99171279 CCACCAAGTGTGGTTTAAAATGG - Intronic
1073524268 10:104164698-104164720 CCACAAATTATCTTTTAAGAAGG + Intronic
1073643110 10:105273093-105273115 ACACCAATTAAGGTTTTAAGTGG + Intergenic
1074740724 10:116482462-116482484 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1075506419 10:123026646-123026668 CAACTATTTAAATTTTAAAAAGG + Intronic
1076304399 10:129454204-129454226 CCAACCATCAAGTTTTCAAATGG - Intergenic
1077589933 11:3483556-3483578 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1077596917 11:3540972-3540994 CCACCAAAAAACTCTTAAAATGG + Intergenic
1077850846 11:6073732-6073754 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1078046177 11:7916056-7916078 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1078224133 11:9376687-9376709 CCAACAATCTAGTTTTTAAATGG + Intergenic
1078243640 11:9552953-9552975 CGGCCAATCCAGTTTTAAAATGG + Intergenic
1078336021 11:10463871-10463893 CCACCAACTAAGTTCCACAATGG - Intronic
1079447409 11:20569606-20569628 CCAGCAATTTATTCTTAAAATGG + Intergenic
1079672624 11:23187834-23187856 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1080085923 11:28281910-28281932 CCACTGAATAAATTTTAAAAGGG + Intronic
1080370664 11:31637203-31637225 TCACCAATTAACTATTAACATGG - Intronic
1081201690 11:40223923-40223945 CTGCAAATTAATTTTTAAAAAGG + Intronic
1081356755 11:42122393-42122415 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1081623899 11:44635250-44635272 CCAGCCATTTAGTTTTGAAATGG - Intergenic
1084232251 11:67761501-67761523 CCAGCAATTTACTCTTAAAAGGG + Intergenic
1084245653 11:67855330-67855352 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1084355499 11:68635528-68635550 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1084827034 11:71739248-71739270 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1084993365 11:72950664-72950686 CTACAAATTCAGTTTTAAAAAGG - Intronic
1086133106 11:83420911-83420933 CCAGCAATTTCCTTTTAAAAAGG + Intergenic
1086190057 11:84068423-84068445 GCTTGAATTAAGTTTTAAAAGGG - Intronic
1086197822 11:84162368-84162390 TTAAAAATTAAGTTTTAAAATGG - Intronic
1086749950 11:90479699-90479721 ACATGAATTAATTTTTAAAAAGG + Intergenic
1087099586 11:94351441-94351463 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1087196861 11:95311348-95311370 CCAGCAATTTATTCTTAAAAAGG + Intergenic
1087314626 11:96589742-96589764 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1087472281 11:98591511-98591533 TATCCAATTAAGTTTAAAAATGG + Intergenic
1087839593 11:102908000-102908022 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1088354410 11:108927451-108927473 CCAATAATTAAGTTATAAAACGG - Intronic
1088962613 11:114684631-114684653 CTACCAATTAAGTTTCTCAAGGG - Intronic
1089349042 11:117811099-117811121 CCAGCAATTTACTCTTAAAAAGG + Intronic
1089471105 11:118720894-118720916 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1090546543 11:127772998-127773020 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1090850650 11:130568258-130568280 CCAGCAATTTACTCTTAAAACGG - Intergenic
1091886460 12:4020348-4020370 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1091982859 12:4880568-4880590 CGACCAAGCATGTTTTAAAATGG - Intergenic
1091988080 12:4930000-4930022 CAACAAATTTATTTTTAAAATGG - Intronic
1092423085 12:8349731-8349753 CCACCAAAAAACTCTTAAAATGG + Intergenic
1092626797 12:10336823-10336845 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1092723769 12:11466065-11466087 CCAGCAATTTACTCTTAAAAAGG - Intronic
1092739377 12:11613590-11613612 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1092840710 12:12538619-12538641 ACACCCATTAAGTGTTTAAAAGG - Intronic
1093268064 12:17025598-17025620 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1093358381 12:18196746-18196768 CCAGCAATTTACTCTTAAAAAGG + Intronic
1093578763 12:20765194-20765216 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1093584572 12:20820896-20820918 CCAGCAATTTACTCTTAAAAAGG - Intronic
1093606685 12:21099005-21099027 CAAGCAATTTAATTTTAAAAAGG - Intronic
1094131891 12:27083291-27083313 CAATGAAATAAGTTTTAAAAGGG - Intergenic
1094769473 12:33637530-33637552 CCTCCTATTCAGTTTTAATATGG + Intergenic
1096373461 12:51087553-51087575 CTATGAATTAAGTATTAAAAAGG - Intergenic
1097360118 12:58650272-58650294 CAACCAATTATGCTTAAAAATGG - Intronic
1097514048 12:60581037-60581059 CCACCAATATAATTTTTAAATGG - Intergenic
1097677601 12:62619788-62619810 TAACCTATTAAGTTCTAAAATGG + Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1098173695 12:67770542-67770564 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1098179310 12:67829105-67829127 TCTCCAATTAAGGCTTAAAAGGG - Intergenic
1098402190 12:70087217-70087239 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1099188660 12:79541685-79541707 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1099292150 12:80786972-80786994 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1099528961 12:83751965-83751987 CAAACTATTAAGTTATAAAAAGG + Intergenic
1099762536 12:86940616-86940638 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1100149125 12:91714122-91714144 CTACCACATAAGTTTCAAAAGGG + Intergenic
1100561293 12:95750906-95750928 CCAGCAATTTACTCTTAAAAAGG + Intronic
1100894836 12:99169967-99169989 CCAGCAAGTTTGTTTTAAAAGGG + Intronic
1100940238 12:99716977-99716999 CCAGCAATTTACTCTTAAAAAGG + Intronic
1101278450 12:103226573-103226595 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1101351330 12:103931905-103931927 ACACCGAGTAAGTTTAAAAATGG + Intronic
1101793165 12:107949166-107949188 CCAAGAATTAAGGTTTAAAGGGG + Intergenic
1102488659 12:113275542-113275564 CCAAAATTTAAGTCTTAAAAAGG + Intronic
1103655696 12:122468675-122468697 CCAACAATATATTTTTAAAATGG + Intergenic
1103754948 12:123197470-123197492 CCAAAAGGTAAGTTTTAAAAGGG + Intronic
1105358294 13:19680314-19680336 CCAATATTTAATTTTTAAAAGGG + Intronic
1105456613 13:20546901-20546923 GCCCCACCTAAGTTTTAAAAGGG - Intergenic
1105655201 13:22429156-22429178 CCAAAAATTAAGTTTTGAAATGG - Intergenic
1106716107 13:32390071-32390093 AAACAAATTAAATTTTAAAAAGG - Intronic
1106827465 13:33539975-33539997 CAAACAACTTAGTTTTAAAATGG + Intergenic
1106943391 13:34800462-34800484 CCAGCAATTTATTCTTAAAAAGG + Intergenic
1107070549 13:36263659-36263681 CACCCAATTATGTTTTAACAGGG - Intronic
1107075526 13:36318259-36318281 CCAGCAATTTACTCTTAAAAAGG + Intronic
1107191164 13:37588355-37588377 GCAACACTTAAGTTTTAACAAGG + Intronic
1107220349 13:37973096-37973118 CCAGCAATTTATTCTTAAAAAGG - Intergenic
1107683195 13:42871308-42871330 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1108420795 13:50247137-50247159 CCAACACTTACGTTTTAGAAAGG + Intronic
1108512940 13:51171684-51171706 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1108814075 13:54268674-54268696 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1108919597 13:55658869-55658891 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1108924549 13:55724402-55724424 CCACCAAATATATTTTTAAAAGG + Intergenic
1108947383 13:56042129-56042151 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1108952999 13:56116313-56116335 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1109212844 13:59554665-59554687 CCAATAATTAAATTTTAAAATGG + Intergenic
1109410908 13:61968031-61968053 CTAACAATTATGTTTTAAATAGG - Intergenic
1109499246 13:63214940-63214962 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1109709716 13:66145232-66145254 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1109716799 13:66230269-66230291 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1110533957 13:76629572-76629594 CCAACAATTCATATTTAAAAGGG - Intergenic
1110765422 13:79275951-79275973 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1111126093 13:83912176-83912198 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1111301995 13:86360225-86360247 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1111458895 13:88516718-88516740 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1111630386 13:90841262-90841284 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1111631759 13:90852481-90852503 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1111873897 13:93868997-93869019 CCAAAAATTAAGTTTTAAAATGG - Intronic
1112868534 13:103939331-103939353 CAAACATTTAATTTTTAAAAAGG - Intergenic
1113324282 13:109267161-109267183 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1115058104 14:29155704-29155726 ACATAAATTAAGTTTTAACAGGG + Intergenic
1115240649 14:31249198-31249220 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1115425177 14:33250405-33250427 CCAGCAATAAAGTTGTAATAGGG + Intronic
1115428532 14:33289455-33289477 CCATCATTCAGGTTTTAAAAGGG - Intronic
1115909860 14:38243533-38243555 TAACCAATTAATTTTTTAAAAGG + Intergenic
1116092253 14:40324279-40324301 CCATAAAGTAAGTTTCAAAATGG + Intergenic
1116179623 14:41517754-41517776 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1116613459 14:47105998-47106020 CCAGCAATTTACTCTTAAAAAGG + Intronic
1116844357 14:49851497-49851519 CTAACAATTAAGTTTTTAATTGG - Intronic
1116952861 14:50894988-50895010 CCAGCAATTTACTCTTAAAAAGG + Intronic
1117539269 14:56730761-56730783 CCAGCAAATTAATTTTAAAATGG + Intergenic
1117595325 14:57321221-57321243 CCACCAAGTATGTTTTAAAGTGG + Intergenic
1117834732 14:59791820-59791842 CCACCTAGTCAGTTTTATAAAGG + Intronic
1118776522 14:68977693-68977715 CCCCCTTTTAAGTTTAAAAAAGG + Intronic
1119317146 14:73705309-73705331 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1120251449 14:82065002-82065024 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1120373701 14:83672188-83672210 CCAACAATATATTTTTAAAATGG - Intergenic
1120438104 14:84504101-84504123 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1121703594 14:95974738-95974760 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1121848813 14:97200294-97200316 CCCACAATTAAGTAATAAAATGG + Intergenic
1122040943 14:98987017-98987039 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1122101072 14:99409992-99410014 CCAACAATAATTTTTTAAAAAGG + Intronic
1123141959 14:106088517-106088539 CCATGAATTACCTTTTAAAATGG + Intergenic
1123586308 15:21763594-21763616 CCACGAATTAAATTTTTAAATGG - Intergenic
1123622949 15:22206184-22206206 CCACGAATTAAATTTTTAAATGG - Intergenic
1124054301 15:26227577-26227599 CAGCCAATTATCTTTTAAAAAGG - Intergenic
1124128760 15:26966502-26966524 CCAACAGTCTAGTTTTAAAATGG + Intergenic
1125045720 15:35240587-35240609 CCAGCAATTTACTCTTAAAAAGG + Intronic
1125131570 15:36289535-36289557 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1125213279 15:37240133-37240155 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1125471348 15:40007396-40007418 CCACCAATTAAGTTTTAAAAGGG - Intronic
1126912460 15:53430729-53430751 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1129500513 15:76032707-76032729 CCATGAATTAATTTTTAGAAAGG + Intronic
1129641797 15:77387246-77387268 CCATCAATAGACTTTTAAAATGG + Intronic
1130947529 15:88560368-88560390 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1131656356 15:94462988-94463010 CCACAATTTTAGTGTTAAAATGG - Intronic
1131882569 15:96875727-96875749 CCAGCAATTTATTCTTAAAAAGG - Intergenic
1132262960 15:100442074-100442096 CCAGCAATTTACTCTTAAAAAGG + Intronic
1133938121 16:10284946-10284968 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1134342231 16:13356460-13356482 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1135712673 16:24730554-24730576 CCCCTAATTAAATTCTAAAAGGG - Intronic
1135925827 16:26693298-26693320 CCACCAAATAATGTTTAAAATGG + Intergenic
1135955155 16:26950485-26950507 CCACCAATTAACTTAGAAAAGGG - Intergenic
1136037755 16:27553245-27553267 CCACCTATTTCATTTTAAAAAGG + Intronic
1137847590 16:51706810-51706832 CCTAAAATAAAGTTTTAAAAAGG + Intergenic
1139039286 16:62983062-62983084 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1139173256 16:64656970-64656992 GCTCCAATTAAATTTTACAAAGG - Intergenic
1139225967 16:65233726-65233748 CCAGCAATTTACTTTTAAAACGG - Intergenic
1139417994 16:66830185-66830207 CCTCCAAGACAGTTTTAAAAAGG + Intronic
1139467545 16:67162027-67162049 CCAGCAATTATTTTTTAATATGG - Intronic
1139943103 16:70620359-70620381 CCAGCAATTCACTCTTAAAAAGG - Intronic
1139943771 16:70624677-70624699 CCAGCAATTTATTCTTAAAAAGG - Intronic
1140201935 16:72902069-72902091 CCAGCACTTCAGTTATAAAAAGG - Intronic
1141061918 16:80881423-80881445 CCACCATTTATGTTTTTCAATGG + Intergenic
1141865260 16:86745916-86745938 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1142579699 17:934022-934044 ACTTCAATTAATTTTTAAAAAGG + Intronic
1143814810 17:9504065-9504087 ACACATACTAAGTTTTAAAAAGG + Intronic
1144104618 17:11973724-11973746 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1144250471 17:13411534-13411556 CCACCTTTTAACTCTTAAAAAGG - Intergenic
1144348738 17:14373727-14373749 CCAACAAAAAATTTTTAAAAAGG + Intergenic
1145227329 17:21141111-21141133 ACAGAAATTAATTTTTAAAATGG - Intronic
1146108741 17:30067947-30067969 CCACCAAAAAATTATTAAAACGG + Intronic
1146263952 17:31438813-31438835 CCGGCAAGTAAGTCTTAAAAAGG - Intronic
1146597845 17:34185093-34185115 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1149420705 17:56508347-56508369 ACAGCATTTAATTTTTAAAAAGG - Intronic
1151622433 17:75254366-75254388 CCAGCAATTTACTCTTAAAAAGG + Intronic
1151839810 17:76609846-76609868 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1152492273 17:80644661-80644683 CAACCAAATAAGTGTTCAAAAGG - Intronic
1153678273 18:7475601-7475623 CCAAAAAATAAGATTTAAAAAGG - Intergenic
1155161445 18:23199115-23199137 CCAAGGATTAATTTTTAAAATGG + Intronic
1155639502 18:27997010-27997032 CAATAAATTAAGCTTTAAAAAGG - Intronic
1156191298 18:34724090-34724112 CCACCAATAAAGTGTGAGAATGG - Intronic
1156875782 18:42009365-42009387 ACACCAAATAATTTTTAAAAAGG - Intronic
1156955288 18:42955459-42955481 TCTCCACTTAAGTTTTAAAGAGG + Intronic
1157269094 18:46256677-46256699 CCACCACTGAGGTTTTAAAATGG - Intronic
1157941466 18:51933417-51933439 CCAAGAATTTAGATTTAAAAGGG + Intergenic
1158336324 18:56417410-56417432 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1158394692 18:57070520-57070542 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1158455896 18:57607378-57607400 CCACTATTCAAGTTTCAAAACGG + Intronic
1158705004 18:59784413-59784435 CCCACAATGAAGTTTTAAAGGGG + Intergenic
1161661663 19:5550290-5550312 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1163284023 19:16335111-16335133 CCACGAATAAAGTTTAAAAAAGG - Intergenic
1163907128 19:20157353-20157375 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1164152921 19:22570059-22570081 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1164459283 19:28433781-28433803 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1165497056 19:36159293-36159315 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1165835302 19:38751407-38751429 CCAGCAATTTACTCTTAAAAAGG + Intronic
1165875079 19:39000877-39000899 CCACCAACTAAGTTCTGAAATGG - Intronic
1166249324 19:41556362-41556384 CAAGCAATTAATTTCTAAAACGG + Intronic
1167447337 19:49545493-49545515 TTACTAATTAATTTTTAAAAAGG + Intronic
1167902096 19:52629590-52629612 CCAGCAATTTACTCTTAAAAAGG + Intronic
1168174699 19:54616925-54616947 CAACAAAATGAGTTTTAAAAAGG + Intronic
925544499 2:5002799-5002821 CCAGCAATTTACTCTTAAAAAGG + Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
926355236 2:12035412-12035434 CCACCAATTAGGATGCAAAAAGG + Intergenic
926407719 2:12571577-12571599 CCAGCAATTTACTCTTAAAAAGG + Intergenic
926413537 2:12628321-12628343 CCAGCAATTTACTCTTAAAAAGG + Intergenic
926464144 2:13167880-13167902 CCAGCAATTTATTCTTAAAAAGG - Intergenic
926815603 2:16795832-16795854 CCAGCAATTTACTCTTAAAAAGG - Intergenic
926894118 2:17665789-17665811 GCAGGAATTAATTTTTAAAATGG - Intronic
927161825 2:20270707-20270729 ATACCAAGTAATTTTTAAAAAGG + Intronic
928827710 2:35441001-35441023 CCAGCAATTTACTCTTAAAAAGG - Intergenic
929076726 2:38084647-38084669 CCAGCAATTGACTCTTAAAAAGG - Intronic
929191874 2:39147617-39147639 ACAGCAATAAAGTTTTAAAGAGG + Intergenic
929353758 2:40994008-40994030 CCATCAAATAAGTGTTAAAAGGG + Intergenic
930955043 2:57194787-57194809 CCAGCAATTTATTCTTAAAAAGG + Intergenic
931026446 2:58117303-58117325 CCAGCAATTTACTCTTAAAAAGG - Intronic
931236887 2:60419442-60419464 CCAGCAATTCACTCTTAAAAAGG + Intergenic
931625719 2:64254351-64254373 CCAGCAATTTACTCTTAAAAAGG + Intergenic
931850370 2:66245747-66245769 CCAGCAATTTACTCTTAAAAAGG + Intergenic
931948202 2:67333396-67333418 CCAGCAATTTACTCTTAAAAAGG + Intergenic
932038351 2:68271242-68271264 CCACAAAATGATTTTTAAAAGGG + Intergenic
932283053 2:70511281-70511303 CCACCAGTTAGGTGTGAAAATGG - Intronic
932295800 2:70622438-70622460 CCAGCAATTTACTCTTAAAAAGG + Intronic
932358870 2:71088935-71088957 CCAGCAATTTACTCTTAAAAAGG - Intergenic
932367701 2:71163575-71163597 CCAGCAATTTACTCTTAAAAAGG - Intergenic
932557519 2:72838287-72838309 CCACCTAGTAAGTTTTGATAAGG + Intergenic
932854261 2:75217681-75217703 CCAGCAATTTACTCTTAAAAAGG - Intergenic
932974003 2:76577743-76577765 CCAGCAATTTACTCTTAAAAAGG - Intergenic
933013039 2:77090196-77090218 CCAGCAATTTACTCTTAAAAAGG + Intronic
933079221 2:77966928-77966950 CCAGCAATTTACTCTTAAAAAGG + Intergenic
933163681 2:79053206-79053228 CCAGCAATTTACTCTTAAAAAGG + Intergenic
933329572 2:80878358-80878380 CCAGCAATTTACTCTTAAAAAGG - Intergenic
933457599 2:82536385-82536407 ATACCAAATAAATTTTAAAAAGG - Intergenic
934086107 2:88511195-88511217 CGGCCACTGAAGTTTTAAAATGG + Intergenic
935100029 2:99985472-99985494 ACACCAATTTACCTTTAAAAAGG - Intronic
936883283 2:117280560-117280582 CCAGCAATTTATTCTTAAAAAGG + Intergenic
938401385 2:130994800-130994822 CAAGGAATTAAGATTTAAAAAGG - Intronic
939356189 2:141106039-141106061 ACACCAAGTAAGTTTCTAAATGG + Intronic
939867759 2:147493219-147493241 CAATGAATTAACTTTTAAAAAGG + Intergenic
940375687 2:152955636-152955658 CCACAAATTCAGTTTTATAGAGG - Intergenic
940530137 2:154869141-154869163 CCAGCAATTTACTCTTAAAAAGG + Intergenic
940675857 2:156723960-156723982 CCAGCAATTTACTCTTAAAAAGG - Intergenic
940928157 2:159391996-159392018 CCACCAACTAATATTTATAATGG + Intronic
941340345 2:164297672-164297694 CCAGCAATTTACTCTTAAAAAGG + Intergenic
941353334 2:164460933-164460955 CCAGCAATTTATTCTTAAAAAGG + Intergenic
941456240 2:165714387-165714409 CCAGCAATTTACTCTTAAAAAGG - Intergenic
941935948 2:170981552-170981574 CCAGCAATTTACTCTTAAAAAGG - Intergenic
942730346 2:179055667-179055689 CCAGCAATTTACTCTTAAAAAGG - Intergenic
943412981 2:187564369-187564391 CCAGCAATTTACTCTTAAAAAGG - Intronic
943421637 2:187674364-187674386 CCAGCAATTTACTCTTAAAAAGG - Intergenic
943462408 2:188184923-188184945 ACACCAATTAAGTTAAAAACAGG - Intergenic
943468709 2:188264577-188264599 CAAATAATTAATTTTTAAAATGG + Intergenic
943806594 2:192132239-192132261 CCAGCAATTTACTCTTAAAAAGG + Intronic
944387397 2:199181191-199181213 CCAGCAATTTACTCTTAAAAAGG + Intergenic
944394083 2:199248745-199248767 CCAGCAATTTACTCTTAAAAAGG + Intergenic
944595415 2:201256847-201256869 CCAGCCATGAATTTTTAAAAAGG - Intronic
944876178 2:203965816-203965838 CCAGCAATTCACTGTTAAAAAGG - Intergenic
945078573 2:206065699-206065721 CAACCAATTCAATTTTTAAATGG + Intronic
945153158 2:206810747-206810769 CCAGCAATTTACTCTTAAAAAGG - Intergenic
945361592 2:208901040-208901062 CCAGCAATTTACTCTTAAAAAGG + Intergenic
945394248 2:209301043-209301065 CCAGCAATTTACTCTTAAAAAGG + Intergenic
945623177 2:212168096-212168118 CCAACAATAGAGATTTAAAAGGG - Intronic
946215086 2:218177922-218177944 CCAGCAATTTACTCTTAAAAAGG - Intergenic
946781099 2:223193759-223193781 CCAGCAATTTACTCTTAAAAAGG - Intronic
946886446 2:224227106-224227128 CCAGCAATTTACTCTTAAAAGGG + Intergenic
946893220 2:224298491-224298513 CCAGCAATTTACTCTTAAAAGGG + Intergenic
948390631 2:237608775-237608797 CCAGCAATTTACTCTTAAAAGGG + Intergenic
1168824828 20:803042-803064 CAACAAAATTAGTTTTAAAAAGG + Intergenic
1170040098 20:12030957-12030979 CCCCCAAATAACTCTTAAAATGG + Intergenic
1170068916 20:12344167-12344189 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1170106182 20:12755691-12755713 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1170325540 20:15151752-15151774 CCAGCAATTTACTCTTAAAAAGG - Intronic
1170556668 20:17520354-17520376 CCACCATTTGAGTTAAAAAAGGG - Intronic
1170617314 20:17964410-17964432 CCAACACTTAAGTTTAAAAATGG - Intronic
1173101856 20:40095161-40095183 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1173118816 20:40270877-40270899 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1173763832 20:45588114-45588136 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1174834746 20:53846299-53846321 CAAACAATGAAATTTTAAAATGG - Intergenic
1177010100 21:15721720-15721742 CCATCAACCAAATTTTAAAATGG + Intergenic
1177072870 21:16532656-16532678 CCATGAATTTAGTATTAAAAAGG + Intergenic
1177102623 21:16915780-16915802 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1179387499 21:40956769-40956791 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1182113895 22:27743805-27743827 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1182732223 22:32504606-32504628 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1183208687 22:36436483-36436505 CCTCCACTTTAGTTTTACAAGGG - Intergenic
1184702683 22:46187245-46187267 CCATGAGTTCAGTTTTAAAATGG - Intronic
949162151 3:894567-894589 CCAGCAATTTACTCTTAAAAAGG - Intergenic
950154554 3:10711828-10711850 CCACCAACAAAGATTTAACAGGG + Intergenic
950926443 3:16746136-16746158 CCAGCAATTTACTCTTAAAAAGG + Intergenic
951298867 3:20971413-20971435 CCAGCAATTTACTCTTAAAAAGG - Intergenic
951316377 3:21193117-21193139 CCAGCAATTTACTCTTAAAAAGG - Intergenic
951740448 3:25916264-25916286 CAACCATTTAAAATTTAAAATGG + Intergenic
951746278 3:25981023-25981045 CCACTTATCATGTTTTAAAAAGG + Intergenic
952095440 3:29946088-29946110 CTACCAATTAAATCTTACAAGGG - Intronic
952152894 3:30611795-30611817 CCACCAAAGCAGTTTTAAATAGG + Intronic
952263517 3:31763625-31763647 ACAGCAATTAAGTTTTAAAAGGG - Intronic
952896111 3:38080169-38080191 CCAGCAATTTACTCTTAAAAAGG - Intronic
953077186 3:39581691-39581713 CCAGCAATTTATTCTTAAAAAGG - Intergenic
953825760 3:46250184-46250206 CCAGCAATTTACTCTTAAAAAGG - Intronic
954049634 3:47963198-47963220 CAACCAATTAAGTAGGAAAAGGG + Intronic
954767600 3:52933721-52933743 TCACCAATCAAAATTTAAAAGGG + Intronic
954853739 3:53625317-53625339 CCACCAACTCAGTTTTAATTGGG - Intronic
954969319 3:54638374-54638396 CCAGCAATTTATTCTTAAAAAGG - Intronic
955253311 3:57305488-57305510 CCAGCAATTTACTCTTAAAAAGG + Intronic
955416191 3:58694240-58694262 ACAAAAATTAATTTTTAAAATGG - Intergenic
955570747 3:60302743-60302765 CTACCAATTAACTTTGATAAAGG - Intronic
955902246 3:63769451-63769473 CAACAAATTAACTCTTAAAATGG + Intergenic
956159745 3:66336913-66336935 CTAAAAATAAAGTTTTAAAAAGG - Intronic
956318913 3:67973096-67973118 CAAGCAATTAATTTTTAAAAAGG + Intergenic
956549044 3:70438781-70438803 CCAGCAATTTACTCTTAAAAAGG - Intergenic
956709163 3:72024780-72024802 CCAGCAATTTACTCTTAAAAAGG + Intergenic
957059952 3:75473950-75473972 CCAGCAATTTACTCTTAAAAAGG - Intergenic
957066902 3:75531392-75531414 CCACCAAAAAACTCTTAAAATGG + Intergenic
957195262 3:77059536-77059558 CCACCAACTAACCTTTAAATAGG - Intronic
957295188 3:78325698-78325720 CCAGCAATTTACTCTTAAAAAGG + Intergenic
957317364 3:78587038-78587060 CCAGCAATTTACTCTTAAAAAGG - Intergenic
957326482 3:78701690-78701712 CCACAAAATAACTTTTTAAAAGG + Intronic
959387914 3:105735614-105735636 TCACCACATAACTTTTAAAATGG + Intronic
959936528 3:112035133-112035155 GCACTGATTAAATTTTAAAATGG - Intronic
959937413 3:112043737-112043759 CCAATTATGAAGTTTTAAAATGG + Intronic
959972319 3:112421453-112421475 CCAGCAATTTACTCTTAAAAAGG - Intergenic
960282933 3:115797395-115797417 CCAGCAATTTACTCTTAAAAAGG - Intergenic
960310172 3:116109210-116109232 CCAGCAATTTACTCTTAAAAAGG - Intronic
960470131 3:118054127-118054149 CCACCTATTTAATTTCAAAATGG - Intergenic
961120952 3:124369281-124369303 ACACCAAAGAAATTTTAAAAGGG - Intronic
961164818 3:124756444-124756466 CCAGCAATTTACTCTTAAAAAGG - Intergenic
961286251 3:125806659-125806681 CCACCAAAAAACTCTTAAAATGG - Intergenic
961541888 3:127605738-127605760 CCAGGAATTGACTTTTAAAAGGG + Intronic
961711683 3:128833079-128833101 CCAGCAATTTACTCTTAAAAAGG - Intergenic
961730531 3:128961533-128961555 CCAGCAATTTACTCTTAAAAAGG + Intronic
961893770 3:130151058-130151080 CCAGCAATTTACTCTTAAAAAGG - Intergenic
961900512 3:130206288-130206310 CCACCAAAAAACTCTTAAAATGG + Intergenic
962057277 3:131885882-131885904 CTATTAATTCAGTTTTAAAAGGG + Intronic
962205509 3:133430946-133430968 CCAGCAATTTACTCTTAAAAAGG + Intronic
962660573 3:137597265-137597287 CCAGCAATTTACTCTTAAAAAGG + Intergenic
962807121 3:138935959-138935981 CCATCAAGTAAGGTTGAAAAGGG + Intergenic
962822066 3:139058939-139058961 CAAACAATTGAATTTTAAAATGG - Intronic
963456713 3:145555066-145555088 CCAGCAATTTACTCTTAAAAAGG - Intergenic
963520391 3:146355348-146355370 CCAGCAATTTACTCTTAAAAAGG + Intergenic
963663286 3:148153469-148153491 CCAGCAATTTACTCTTAAAAAGG + Intergenic
963684279 3:148416166-148416188 CCAGCAATTTACTCTTAAAAAGG + Intergenic
964121404 3:153188023-153188045 CCAAAATTTAATTTTTAAAAAGG - Intergenic
965286788 3:166827995-166828017 CCAGCAATTTACTCTTAAAAAGG - Intergenic
965336271 3:167433006-167433028 CCAGCAATTTACTCTTAAAAAGG + Intergenic
965624937 3:170676435-170676457 CCAGCAATTTACTCTTAAAAAGG - Intronic
966085378 3:176063126-176063148 CCAGCAATTTACTCTTAAAAAGG + Intergenic
966105142 3:176325515-176325537 CCAGCAATTTACTCTTAAAAAGG - Intergenic
966198986 3:177342084-177342106 CCAGCAATTATTTTTTCAAATGG - Intergenic
966232905 3:177669738-177669760 CCAGCAATTTACTCTTAAAAAGG - Intergenic
966576069 3:181504061-181504083 TCAGCAATTAAGTTTTATTATGG + Intergenic
967212222 3:187179421-187179443 CCAGCAATTTACTCTTAAAACGG - Intronic
967244223 3:187470171-187470193 CCAGCAATTTACTCTTAAAAAGG - Intergenic
967545723 3:190724921-190724943 CCACCTTTTTATTTTTAAAATGG - Intergenic
967561333 3:190921924-190921946 CCAGCAATTTACTCTTAAAAAGG + Intergenic
967624705 3:191670378-191670400 CCAGCAATTTACTCTTAAAAAGG - Intergenic
968330571 3:197865784-197865806 CAACCAATTTAATTTAAAAATGG - Intronic
969654162 4:8486741-8486763 CCAGCAATTTACTCTTAAAAAGG - Intronic
970020810 4:11566421-11566443 TCAAGTATTAAGTTTTAAAATGG - Intergenic
970087490 4:12365558-12365580 CCAGCAATTTACTCTTAAAAAGG + Intergenic
970706521 4:18810494-18810516 CAACCAAGTAAATTTTAAAAAGG + Intergenic
971180499 4:24325028-24325050 CCAGCAATTTACTCTTAAAAAGG + Intergenic
971200080 4:24502826-24502848 CCAGCAATTTACTCTTAAAAAGG + Intergenic
971632591 4:29013000-29013022 CCACAAAGTAACTTTTAATACGG - Intergenic
971846790 4:31928768-31928790 CAATAAATTATGTTTTAAAATGG + Intergenic
972008424 4:34141764-34141786 CCACCAATTATGTTAGAAAATGG + Intergenic
972064932 4:34930046-34930068 CAGCCAATTAATTTTTAATATGG + Intergenic
973154931 4:46939046-46939068 GCAACAAGTAAGTTTTAAATAGG + Intronic
974428453 4:61768184-61768206 CCAGCAATTTACTCTTAAAAAGG - Intronic
975865142 4:78717753-78717775 CCAGCAATTTACTCTTAAAAAGG - Intergenic
975933943 4:79557873-79557895 CCAGCAATTTACTCTTAAAAAGG - Intergenic
976696481 4:87923684-87923706 CCAGCAATTTACTCTTAAAAAGG + Intergenic
976714180 4:88105855-88105877 CAAACAATTCAATTTTAAAATGG + Intronic
976884626 4:89968688-89968710 CCAGCAATTTACTCTTAAAAAGG - Intergenic
976913340 4:90337114-90337136 CCATCAATTATGTTTGTAAAAGG + Intronic
977010261 4:91625906-91625928 CCAGCAATTTACTCTTAAAAAGG + Intergenic
977012981 4:91658518-91658540 CCAGCAATTTACTCTTAAAAAGG - Intergenic
977062563 4:92275387-92275409 CCAGCAATTTACTCTTAAAAAGG - Intergenic
977075261 4:92442855-92442877 CCAACAATTTACTCTTAAAAAGG - Intronic
977217210 4:94297109-94297131 CCAGCAATTTATTCTTAAAAAGG - Intergenic
977402811 4:96555297-96555319 ATACCTATTAAGTTTCAAAATGG + Intergenic
977472450 4:97457447-97457469 CCACCAATTAACATTTAACTAGG + Intronic
979379884 4:119995737-119995759 CCAGCAATTTACTCTTAAAAAGG + Intergenic
979850361 4:125565531-125565553 CCAGCAATTTACTCTTAAAAAGG - Intergenic
979895218 4:126149032-126149054 CCAGCAATTTACTCTTAAAAAGG - Intergenic
980527817 4:134013959-134013981 CCAGCAATTTACTCTTAAAAAGG + Intergenic
980575688 4:134681802-134681824 CCAGCAATTTACTCTTAAAAAGG - Intergenic
980611831 4:135171187-135171209 CCAGCAATTTACTCTTAAAAAGG - Intergenic
980903883 4:138929686-138929708 CCAGCAATTTACTCTTAAAAAGG + Intergenic
981260363 4:142711580-142711602 TCACTAATACAGTTTTAAAAAGG + Intronic
981525148 4:145700923-145700945 CCAGCAATTTACTCTTAAAAAGG + Intronic
981539669 4:145834560-145834582 CCAGCAATTTACTCTTAAAAAGG + Intronic
982084020 4:151816497-151816519 CCAGCAATTTACTCTTAAAAAGG - Intergenic
982104754 4:152002080-152002102 CAAAGAATAAAGTTTTAAAATGG - Intergenic
982139674 4:152305657-152305679 ACACCATTTTAGTTTCAAAACGG + Intergenic
982180532 4:152745247-152745269 CCAGCAATTTATTCTTAAAAAGG - Intronic
982414252 4:155112357-155112379 CCAGCAATTTACTCTTAAAAAGG - Intergenic
982497161 4:156107362-156107384 CCAGCAATTTACTCTTAAAAAGG - Intergenic
982535389 4:156602097-156602119 CCAGCAATTTACTCTTAAAAAGG + Intergenic
983023816 4:162710917-162710939 CCAGCAATTTACTCTTAAAAAGG + Intergenic
983055429 4:163094905-163094927 CCAGCAATTTATTCTTAAAAAGG + Intergenic
983345501 4:166522310-166522332 CCAGCAATTTACTCTTAAAAAGG + Intergenic
983360355 4:166718115-166718137 CCAGCAATTTACTCTTAAAAAGG + Intergenic
983414764 4:167439700-167439722 CCAGCAATTTACTCTTAAAAAGG - Intergenic
983452282 4:167924709-167924731 CCAGCAATTTACTCTTAAAAAGG + Intergenic
983659524 4:170118270-170118292 CCAGCAATTTACTCTTAAAAAGG + Intergenic
983707617 4:170679280-170679302 CCAGCAATTTACTCTTAAAAAGG + Intergenic
983881402 4:172937210-172937232 CCAACAAATAATTATTAAAATGG + Intronic
984099104 4:175465329-175465351 CCAGCAATTTACTCTTAAAAAGG - Intergenic
984334020 4:178363729-178363751 GTACCAATTGACTTTTAAAAAGG - Intergenic
984700612 4:182816337-182816359 CCAGCAATTTACTCTTAAAAAGG + Intergenic
984813491 4:183817121-183817143 CCACCACTAAAGCTTTGAAATGG + Intergenic
985435667 4:189927636-189927658 CCAGCAATTTACTCTTAAAAAGG + Intergenic
985582302 5:704605-704627 CCAGCAATTTACTCTTAAAAAGG + Intergenic
985781616 5:1874613-1874635 CAACCAATTAAGATTTAAAGTGG - Intergenic
986213422 5:5695264-5695286 TCAGCAGTTAACTTTTAAAAAGG + Intergenic
986555611 5:9007796-9007818 CCAGCAATTTACTCTTAAAAAGG - Intergenic
986905722 5:12491652-12491674 CCAGCAATTTACTCTTAAAAAGG + Intergenic
986919640 5:12666435-12666457 CCAGCAATTTACTCTTAAAAAGG - Intergenic
987253526 5:16124571-16124593 CCACCAATGAAGTTTCTACATGG + Intronic
987498182 5:18672754-18672776 CCAGCAATTTACTCTTAAAAAGG - Intergenic
988192207 5:27953064-27953086 TCAACAATTAATTTTTAAATGGG - Intergenic
988769380 5:34415933-34415955 ACAAAAATTAATTTTTAAAATGG + Intergenic
989752221 5:44908672-44908694 CCACAAATCAACTTTAAAAAAGG + Intergenic
990933766 5:61124086-61124108 ACAATATTTAAGTTTTAAAAAGG + Intronic
991303457 5:65151322-65151344 CCACAATTTAAATTATAAAACGG - Exonic
992394608 5:76359167-76359189 CCAGCAATTTACTCTTAAAAAGG + Intergenic
993776402 5:92003788-92003810 TCAACAATTAAATTTTAATATGG + Intergenic
993836650 5:92825796-92825818 CCAGCAATTTACTCTTAAAAAGG + Intergenic
994532597 5:100988149-100988171 CCAGCAATTTATTCTTAAAAAGG - Intergenic
994892746 5:105658871-105658893 CTACATATTCAGTTTTAAAAAGG - Intergenic
995296623 5:110531656-110531678 CCAGCAATTTACTCTTAAAAAGG + Intronic
995899422 5:117050261-117050283 CCAGCAATTGACTCTTAAAAAGG - Intergenic
996203313 5:120701486-120701508 CCAGCAATTTACTCTTAAAAAGG - Intergenic
996745501 5:126843454-126843476 CCAGCAATTTACTCTTAAAAAGG - Intergenic
996933671 5:128922668-128922690 CAATAAATTAATTTTTAAAAGGG + Intronic
996995283 5:129688489-129688511 TCTCAAACTAAGTTTTAAAATGG + Intronic
997769732 5:136543507-136543529 CCAGCAATTTACTCTTAAAAAGG - Intergenic
997772696 5:136569227-136569249 CCAGCAATTTACTCTTAAAAAGG - Intergenic
998995335 5:147865090-147865112 CCAGCAATTTACTCTTAAAAAGG + Intergenic
999618921 5:153453605-153453627 CCAGCAATTTACTCTTAAAAAGG - Intergenic
999883724 5:155896310-155896332 CCACCTCCTACGTTTTAAAAGGG - Intronic
1000519466 5:162279272-162279294 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1000935701 5:167301810-167301832 CCAGCAATTTACTCTTAAAAAGG - Intronic
1001331509 5:170765929-170765951 CCAGCAATTTACTCTTAAAAAGG - Intronic
1002611021 5:180418621-180418643 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1003430225 6:6031677-6031699 CCAGCAATTTATTCTTAAAAAGG - Intergenic
1004283579 6:14300846-14300868 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1004508052 6:16262888-16262910 CCAGCAATTTACTCTTAAAAAGG - Intronic
1004575170 6:16887772-16887794 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1004786171 6:18970010-18970032 CCAAAAATTAATTTTTAAATAGG - Intergenic
1004836943 6:19540692-19540714 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1005014713 6:21365403-21365425 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1005909151 6:30292943-30292965 CCACAAAATAATTTTTAAAATGG - Intergenic
1006679890 6:35789297-35789319 CAGCCAATTAAGTTTCAACAAGG + Intronic
1006709353 6:36052349-36052371 CCAGAAAATAAGTTTTAAAATGG - Intronic
1007437869 6:41829943-41829965 CAACATATTAATTTTTAAAAGGG - Intronic
1007541398 6:42648891-42648913 CCATTATTTAATTTTTAAAAAGG - Intronic
1008125302 6:47661224-47661246 GCACCAAAGAAGTTTTGAAATGG - Intronic
1009610482 6:65934440-65934462 CCACAAATTAGGTGTAAAAAAGG - Intergenic
1009797429 6:68489378-68489400 TCACTAAATAATTTTTAAAATGG - Intergenic
1010586752 6:77664448-77664470 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1010826969 6:80486333-80486355 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1010894598 6:81349025-81349047 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1011753223 6:90474074-90474096 CCAGGTTTTAAGTTTTAAAACGG + Intergenic
1011771000 6:90674107-90674129 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1012014445 6:93833973-93833995 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1012066600 6:94557842-94557864 CCAGCAATTCACTCTTAAAAAGG - Intergenic
1012315769 6:97781411-97781433 CCAGCAATTTACTCTTAAAAGGG + Intergenic
1012388854 6:98713961-98713983 TCAACAATTCAATTTTAAAATGG + Intergenic
1012595948 6:101039726-101039748 TAAACAATTAAATTTTAAAATGG - Intergenic
1012689521 6:102294740-102294762 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1013253850 6:108362956-108362978 TCACCACTTCACTTTTAAAATGG + Intronic
1013407939 6:109859653-109859675 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1013843738 6:114426219-114426241 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1013891646 6:115033699-115033721 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1014454927 6:121624335-121624357 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1014555793 6:122841647-122841669 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1014610870 6:123543736-123543758 CCATCAACTCAGTTTTTAAAAGG - Intronic
1014614729 6:123586192-123586214 CCAGCAATTTACTCTTAAAAAGG - Intronic
1014716453 6:124869931-124869953 ACATCTATTAATTTTTAAAAAGG + Intergenic
1014718839 6:124893851-124893873 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1014794045 6:125705757-125705779 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1014891489 6:126850567-126850589 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1015266677 6:131297272-131297294 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1015278098 6:131404627-131404649 CCAGCAATTTATTCTTAAAAAGG + Intergenic
1015305558 6:131703103-131703125 CCAGCACTTAATTTTTAAAAAGG - Intronic
1015323776 6:131903500-131903522 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1015406187 6:132839330-132839352 CCACCAATTAACTTTTAGCAAGG - Intergenic
1016114197 6:140261304-140261326 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1016204478 6:141454622-141454644 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1016535812 6:145107045-145107067 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1016650349 6:146454311-146454333 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1016853214 6:148641614-148641636 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1017324110 6:153127539-153127561 ACAGCAATAAAGTTTTTAAAGGG + Intronic
1017374100 6:153747481-153747503 CCACCAATGAACTTTTACGAAGG - Intergenic
1017795509 6:157840610-157840632 CAATCAATTAAGTTTTAAGAAGG - Intronic
1017856226 6:158351577-158351599 CCACAAATACAGTTATAAAAGGG - Intronic
1020204967 7:6107222-6107244 GCTCCAATTACCTTTTAAAAGGG - Intronic
1020324000 7:6960590-6960612 CCAGCAATTTCGTCTTAAAAAGG - Intergenic
1020541191 7:9462426-9462448 CAAGCAATTAACTCTTAAAAAGG - Intergenic
1020903444 7:14034840-14034862 CAACCATTTAATTTTTAATATGG + Intergenic
1020994319 7:15243609-15243631 ATACCAATTAAGATTTAAATTGG + Intronic
1021623896 7:22573893-22573915 TCACGAAGTAAGTTTTAAGAGGG - Intronic
1021810608 7:24398091-24398113 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1021977952 7:26028080-26028102 CCAGCAATTTATTCTTAAAAAGG - Intergenic
1021998705 7:26204028-26204050 ACACTAATGAATTTTTAAAATGG - Intronic
1022372818 7:29786661-29786683 CCAGCAATTTATTCTTAAAAAGG + Intergenic
1022572849 7:31470949-31470971 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1022710101 7:32841798-32841820 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1022854766 7:34303787-34303809 CCAGCAATTTATTCTTAAAAAGG - Intergenic
1023237767 7:38108295-38108317 ACACCAATTATTTTTTAAGAAGG - Intergenic
1023426327 7:40040749-40040771 CCACCAGTTAAAATATAAAATGG - Intronic
1023698945 7:42874503-42874525 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1024697567 7:51871832-51871854 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1024746132 7:52408354-52408376 CCTCCACTTTAGTTTCAAAAAGG - Intergenic
1024954900 7:54907295-54907317 CAACCAATTAAGTTTGAGAACGG - Intergenic
1027851889 7:83461483-83461505 CCAACAATTTACTCTTAAAAAGG + Intronic
1028670457 7:93395747-93395769 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1030441746 7:109595950-109595972 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1030751561 7:113237474-113237496 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1030852550 7:114508627-114508649 TGACCTATTAAGTTTTAGAAAGG + Intronic
1031004615 7:116457298-116457320 CCAGCAATTTATTCTTAAAAAGG + Intronic
1031399928 7:121317386-121317408 CCAGCAATTTATTCTTAAAAAGG + Intergenic
1031427813 7:121628641-121628663 TCAGCAATTATGTTTTCAAATGG + Intergenic
1031525538 7:122818735-122818757 CCAGCAATTTACTCTTAAAAAGG + Intronic
1031718703 7:125141101-125141123 GCAACTATTAATTTTTAAAAGGG + Intergenic
1033271498 7:139936810-139936832 CTACCAATCAAGTCTTAAATAGG + Intronic
1033739673 7:144261334-144261356 CCAGCACTTAATTTTTAAAAAGG - Intergenic
1035102398 7:156411990-156412012 CTACCAAATTAGTTTTAAAAAGG - Intergenic
1036253030 8:7180081-7180103 CCACCAAAAAACTCTTAAAATGG + Intergenic
1036281423 8:7404253-7404275 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1036340044 8:7907319-7907341 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1036364467 8:8107392-8107414 CCACCAAAAAACTCTTAAAATGG - Intergenic
1038056273 8:23861023-23861045 CTTACAATTAATTTTTAAAAGGG - Intergenic
1038076355 8:24079777-24079799 CCACCAGATACGTTTTACAAAGG - Intergenic
1038656639 8:29458650-29458672 CCATCAATTGAGATTTAGAAAGG - Intergenic
1038662404 8:29508434-29508456 ACACAATTTAAGCTTTAAAAAGG - Intergenic
1038826390 8:31007062-31007084 TCACTAATTGAGTTTTTAAAAGG - Intronic
1038829270 8:31038861-31038883 CCACCAATTGATTTTTGACAAGG - Intronic
1038979673 8:32745231-32745253 CAAACAATTAAATTTTAAAACGG - Intronic
1040845178 8:51830166-51830188 CCACCAATTTAGCGATAAAATGG - Intronic
1041196173 8:55403553-55403575 CCACCAATTAAGAAATTAAAAGG + Intronic
1041348309 8:56923968-56923990 CCACCAAGTAAGTTGTGAAAGGG - Intergenic
1042453499 8:68974987-68975009 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1042706027 8:71666201-71666223 CCAGCAATTTCCTTTTAAAAAGG + Intergenic
1043262136 8:78215201-78215223 CCCCCAATATAGTTGTAAAAGGG - Intergenic
1043632481 8:82353486-82353508 CCATCAATTAACTTTTAAAAGGG - Intergenic
1043717952 8:83509039-83509061 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1043775948 8:84268630-84268652 CCTCCAATTAATATTGAAAATGG - Intronic
1044148570 8:88746111-88746133 CCAGCAATTTATTCTTAAAAAGG - Intergenic
1044258672 8:90094101-90094123 CCAGCAATTTACTCTTAAAAAGG - Intronic
1044417031 8:91949818-91949840 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1044657398 8:94562965-94562987 AAACCTATTAATTTTTAAAAAGG + Intergenic
1044921931 8:97176895-97176917 CCAGCAATTTATTCTTAAAAAGG + Intergenic
1044925105 8:97202739-97202761 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1045122618 8:99054386-99054408 CAAACAATTGAATTTTAAAATGG - Intronic
1045197464 8:99945685-99945707 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1045258881 8:100554132-100554154 ACACCAATTTGATTTTAAAATGG - Intronic
1046386399 8:113513409-113513431 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1046425298 8:114040231-114040253 CAACCAATCAATTTTTGAAAAGG + Intergenic
1046439956 8:114243151-114243173 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1046443193 8:114283806-114283828 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1046559224 8:115816422-115816444 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1047829597 8:128615804-128615826 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1048168492 8:132084133-132084155 CCAGCAATTTACTCTTAAAAAGG - Intronic
1048361283 8:133699123-133699145 CTACCAATTAAGTTGCAATATGG - Intergenic
1050258167 9:3815094-3815116 CCAGCAATTTACTTTTAATAAGG - Intergenic
1051013840 9:12451403-12451425 CCATCAATTAAATGGTAAAATGG + Intergenic
1051052568 9:12950135-12950157 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1051849344 9:21489597-21489619 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1052233380 9:26182228-26182250 CCACCAATTATTTTCTTAAAAGG - Intergenic
1053299505 9:36939016-36939038 GCACCAATAAACTTTTAAAATGG - Intronic
1053565120 9:39241541-39241563 CCACCAATTAAAGTTTACATAGG - Intronic
1053728609 9:41029227-41029249 CCACCAAAAAAGTTTTAAAATGG - Intergenic
1053830894 9:42079379-42079401 CCACCAATTAAAGTTTACATAGG - Intronic
1054132031 9:61377497-61377519 CCACCAATTAAAGTTTACATAGG + Intergenic
1054599662 9:67108058-67108080 CCACCAATTAAAGTTTACATAGG + Intergenic
1054699896 9:68402853-68402875 CCACCAAAAAAGTCTTAAAATGG + Intronic
1054807544 9:69408675-69408697 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1055233004 9:74087479-74087501 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1055626667 9:78182597-78182619 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1055809992 9:80139224-80139246 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1056044795 9:82704606-82704628 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1056061102 9:82885572-82885594 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1056323828 9:85460461-85460483 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1056437296 9:86587206-86587228 CCAGCAATTTATTCTTAAAAAGG - Intergenic
1056522387 9:87412741-87412763 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1057234789 9:93349420-93349442 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1057377933 9:94541642-94541664 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1057683911 9:97216443-97216465 CCAGCAATTTACTCTTAAAACGG + Intergenic
1057683943 9:97216658-97216680 CCAGCAATTTACTCTTAAAACGG + Intergenic
1057744519 9:97740773-97740795 CTACCAAGTAAGTTTGGAAAGGG + Intergenic
1057982025 9:99671980-99672002 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1058271212 9:102974513-102974535 ATAGCAATTAAGTTTTAACATGG + Intergenic
1058612344 9:106789985-106790007 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1058815876 9:108682371-108682393 CCTCTTATTAATTTTTAAAAAGG + Intergenic
1059574566 9:115475177-115475199 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1059606762 9:115843100-115843122 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1059863542 9:118489569-118489591 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1060737940 9:126078550-126078572 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1061756286 9:132814751-132814773 ACACCCATTAAATTTTAAATAGG + Intronic
1185858489 X:3557022-3557044 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1185960742 X:4544382-4544404 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1185991001 X:4893406-4893428 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1187170718 X:16848756-16848778 CCACCACATAAGCTTTCAAAGGG + Intronic
1188419426 X:29977074-29977096 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1188430967 X:30105141-30105163 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1189806813 X:44743500-44743522 CTAATAATTAAGTTTTAAAATGG - Intergenic
1190018024 X:46845530-46845552 TCACCAATCAAGATATAAAATGG + Intronic
1190804353 X:53820737-53820759 CCATAAATAAATTTTTAAAAAGG + Intergenic
1191991957 X:67047747-67047769 CCAAAAAGTAATTTTTAAAAAGG - Intergenic
1193885879 X:86983621-86983643 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1193941439 X:87683706-87683728 CCAGCAATTGACTCTTAAAAAGG + Intergenic
1194186306 X:90777213-90777235 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1194293680 X:92104130-92104152 CCAGCAATTTATTCTTAAAAAGG - Intronic
1194308594 X:92276957-92276979 CCAGCAATTTACTCTTAAAAAGG - Intronic
1194351233 X:92826317-92826339 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1194367052 X:93024749-93024771 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1194428782 X:93774765-93774787 ACAAGAATAAAGTTTTAAAAGGG - Intergenic
1194463395 X:94200736-94200758 ACAGTATTTAAGTTTTAAAAAGG - Intergenic
1194503035 X:94702709-94702731 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1194822823 X:98528166-98528188 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1195908733 X:109869109-109869131 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1196073029 X:111545733-111545755 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1196165491 X:112532432-112532454 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1196299957 X:114041800-114041822 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1196330768 X:114468579-114468601 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1196341771 X:114605196-114605218 CCAGCAATTTACTCTTAAAAAGG - Intronic
1196533592 X:116816358-116816380 CCAACAATTTACTCTTAAAAAGG - Intergenic
1196572446 X:117280977-117280999 CCAGCAATTTATTCTTAAAAAGG + Intergenic
1196773912 X:119321659-119321681 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1197043948 X:121973603-121973625 ACACCTAATAAGTTTTAAGAGGG + Intergenic
1197064857 X:122223851-122223873 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1197304495 X:124824954-124824976 CCAAAAATAAAATTTTAAAAAGG + Intronic
1197352116 X:125392739-125392761 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1197764721 X:130052590-130052612 CCATCAAATAAGTATTAAATTGG - Intronic
1197773175 X:130103346-130103368 CAAACAATTCAGTTTAAAAATGG + Intronic
1197831797 X:130650956-130650978 CCTGTAATTAAGCTTTAAAAGGG - Intronic
1198089288 X:133311924-133311946 CCCCAAATTAAGGTTTAGAAGGG + Intronic
1198951852 X:142080847-142080869 CAACAAAATTAGTTTTAAAAAGG + Intergenic
1199576425 X:149317477-149317499 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1200532895 Y:4359290-4359312 CCAGCAATTTACTCTTAAAAAGG - Intergenic
1200611197 Y:5328672-5328694 CCAGCAATTTATTCTTAAAAAGG - Intronic
1200659560 Y:5942997-5943019 CCAGCAATTTACTCTTAAAAAGG + Intergenic
1200675272 Y:6141005-6141027 CCAGCAATTTACTCTTAAAAAGG + Intergenic