ID: 1125471712

View in Genome Browser
Species Human (GRCh38)
Location 15:40010932-40010954
Sequence CCAGAGCCTGGCCTTTGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125471704_1125471712 17 Left 1125471704 15:40010892-40010914 CCTGCGGCTACGGCACATCTGCC 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1125471712 15:40010932-40010954 CCAGAGCCTGGCCTTTGTTAGGG 0: 1
1: 0
2: 0
3: 19
4: 205
1125471707_1125471712 -4 Left 1125471707 15:40010913-40010935 CCAGCGTGGGATGAAATGCCCAG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1125471712 15:40010932-40010954 CCAGAGCCTGGCCTTTGTTAGGG 0: 1
1: 0
2: 0
3: 19
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125471712 Original CRISPR CCAGAGCCTGGCCTTTGTTA GGG Intronic
900892822 1:5461870-5461892 CCAGAGTCTGCCCTGTGTTTTGG + Intergenic
902344029 1:15802767-15802789 CCAGAGCCTCGCCTGTGAGACGG + Intergenic
902363884 1:15958469-15958491 CCACCGTCAGGCCTTTGTTATGG + Intronic
903357258 1:22755872-22755894 ACAGTGCCTGGCCTTTCATAAGG - Intronic
903442659 1:23400118-23400140 CCAGACTCTGGGGTTTGTTAAGG + Intronic
903460543 1:23517581-23517603 CCAGAGCCTGGCATATTATAAGG - Intronic
903658865 1:24965020-24965042 CCAGAGCCTGGGCTCTGTCAAGG - Intronic
904399782 1:30248453-30248475 CCTGAGGCTGGACTTTGCTACGG - Intergenic
904772975 1:32891172-32891194 CCAGACCCTGGCTTCTTTTAGGG + Intronic
907167314 1:52425267-52425289 CCAGATCCTGGCCTTCACTAAGG + Intronic
909958394 1:81803716-81803738 TTAGAACCTGGCCTTTGTAACGG - Intronic
913975184 1:143450161-143450183 CCAGCGCATGGCCTTGGTCATGG - Intergenic
914069577 1:144275777-144275799 CCAGCGCATGGCCTTGGTCATGG - Intergenic
914109578 1:144690577-144690599 CCAGCGCATGGCCTTGGTCATGG + Intergenic
919658870 1:200223713-200223735 CCAAAGCCTGGACTTTCTTGTGG - Intergenic
922767432 1:228163263-228163285 CCAGAGCCTGGCGTTCCTGAGGG - Intergenic
924795046 1:247286949-247286971 CCTGAGCCTACCCTCTGTTATGG + Intergenic
1063899916 10:10721850-10721872 CCAGAGCCTGGCATGTGCAATGG + Intergenic
1065636278 10:27738467-27738489 CCAGAACCTATCCTTGGTTAAGG - Intronic
1065732781 10:28724385-28724407 TCACAGCCTGGCCTGTGTCAGGG - Intergenic
1067034656 10:42904003-42904025 CCAGCGCCTGGACTCTGTGAGGG - Intergenic
1074692342 10:116017595-116017617 CCAGAGTCTTGCTTATGTTAGGG - Intergenic
1074715862 10:116218165-116218187 CCAAGGCCTGACCTTTGTTTCGG + Intronic
1075065095 10:119283871-119283893 CCAGAGCCTGGCATGTCATAGGG + Intronic
1075785733 10:125048809-125048831 CCAGAGGCTGTCATTTGTAATGG - Intronic
1075891742 10:125957359-125957381 CCACATACTTGCCTTTGTTAGGG + Intronic
1076307432 10:129474984-129475006 GAAGAGCCTGGCCTTTGTTGGGG + Intronic
1076510013 10:131006665-131006687 CCAGCGCCTGGCATTTTTTGTGG + Intergenic
1081018673 11:37915365-37915387 CCTGGGTCTGGCCTTTGTTCTGG + Intergenic
1081695582 11:45106956-45106978 ACAAAGCCTGGACTTTGTTCTGG - Intronic
1081737549 11:45414484-45414506 ACAGAGCCTGGCATTTGATATGG - Intergenic
1083339761 11:61951564-61951586 CCAGAGGCTGCCCTTTGCTTTGG - Intronic
1084333166 11:68441486-68441508 CCAGGGCCTGGCTTTGTTTAGGG + Intronic
1084757319 11:71248080-71248102 CCAGAGCCTGCCCTGGGTTTAGG - Intronic
1086091747 11:83011751-83011773 CCAGAGTCTGGCCTTGGTGAAGG - Intronic
1086253087 11:84840827-84840849 CCAGAGCCTGTCCTGGGGTAGGG + Intronic
1086431849 11:86743671-86743693 CCAGAGCCTGCTCTTTTTCAAGG - Intergenic
1088804755 11:113341998-113342020 CCAGGGCCTGGCCTTTGGGGAGG - Intronic
1090934320 11:131328442-131328464 CCACAGCCATGCCTTTGTTATGG + Intergenic
1091538462 12:1436242-1436264 CCAGAGACTGGCCTGTCTTTGGG + Intronic
1091831309 12:3552852-3552874 ACAGAGGCTGGCCTGTGCTAAGG - Intronic
1092657352 12:10700930-10700952 CTAAAACCAGGCCTTTGTTAGGG + Intronic
1092862877 12:12734823-12734845 ACAGAGCCTGGCCTTAGTAAAGG - Intronic
1093921374 12:24863627-24863649 CCAAAGCATGGCCTTTCTAAGGG - Intronic
1098185666 12:67893444-67893466 ACAGAGCCTCGCCTTTATAACGG - Intergenic
1100588504 12:96001374-96001396 CCAGAGACTGGCCTTTATACTGG + Intronic
1100599348 12:96099563-96099585 CCAGTCCATGGTCTTTGTTATGG - Intergenic
1102011964 12:109624356-109624378 TCAGAGGCTGGCCTTGGATAGGG - Intergenic
1102496894 12:113325896-113325918 CCTGAGCCTGGCCTGTAGTAGGG + Intronic
1103377509 12:120468889-120468911 CCAGGGCCCGGGCTTTGTAAAGG - Intronic
1104198416 12:126564143-126564165 GCAGAGCCTGAGCTTTGTGAGGG - Intergenic
1104468053 12:129005913-129005935 TCAGAGCCCGGCCTTTCTCAGGG + Intergenic
1107422993 13:40267206-40267228 CCAGCGCCTGGCTTGTGCTAGGG + Intergenic
1107646626 13:42500740-42500762 CCACTGCCTTGCCTTTGGTATGG + Intergenic
1113105889 13:106771378-106771400 CCAGAACCAGGCCTTTTGTATGG - Intergenic
1115053771 14:29097181-29097203 CCACAGCCTGGCCTGAGTTAAGG - Intergenic
1115896155 14:38089982-38090004 CCAAAGCCTGGCACTTATTAGGG - Intergenic
1118725742 14:68627954-68627976 CAAGGGCCTGGCTTTTGTTTTGG - Intronic
1118941716 14:70345435-70345457 CCTGAGCCTACCCTCTGTTATGG + Intronic
1119964947 14:78904161-78904183 ACAGAGCCTGGCCATTTTTTAGG + Intronic
1121316145 14:92962042-92962064 CCAGTGCCTGGGGTTTGTTATGG + Intronic
1122330991 14:100912721-100912743 CTAGAACCTGGCTTTTGTTTTGG - Intergenic
1123421542 15:20140381-20140403 CCAGAGCCAGGCCATAGATATGG + Intergenic
1123530768 15:21146921-21146943 CCAGAGCCAGGCCATAGATATGG + Intergenic
1123994337 15:25707864-25707886 CCGCAGGCTGGCCTTGGTTAGGG - Intronic
1125471712 15:40010932-40010954 CCAGAGCCTGGCCTTTGTTAGGG + Intronic
1125723692 15:41857293-41857315 CCAGGCCCAGGCCTTTGTGAGGG - Exonic
1126446899 15:48757400-48757422 CCAGAGCCTGGCAGATGATAAGG + Intronic
1126787248 15:52187169-52187191 CCAGAGCCTGGCCCATGGTGGGG + Intronic
1126935790 15:53706050-53706072 ACAGAGCCGTCCCTTTGTTATGG - Exonic
1127121838 15:55778578-55778600 ACATTGCCTGGCCTATGTTATGG + Intergenic
1128083405 15:64870173-64870195 TCAGAGCCTGGTCCTTGTTAAGG + Intronic
1129778897 15:78256158-78256180 CCAGAGCCTGACATTTTCTAGGG + Intergenic
1130460862 15:84157565-84157587 ACCGAGCCGGGCCTTTGTTCCGG - Intergenic
1133861797 16:9602429-9602451 ACAGAGCCTGGCCTATGTTTGGG + Intergenic
1134630416 16:15752228-15752250 CCAGAGCCTGGCATATGGTTAGG + Intronic
1135148942 16:19988509-19988531 CCACAGCCTAGCCTTTTTGAGGG - Intergenic
1135954889 16:26948246-26948268 CTAGATCCTTGCCTTTGGTAGGG + Intergenic
1136403925 16:30032368-30032390 CCAGTCCCTGGCCTTTCTTTGGG - Intronic
1138021084 16:53482169-53482191 CCAGAAACAGGCCTTTGGTAAGG - Intronic
1138108091 16:54301496-54301518 CAAGAGCCTGGCTTTTGTTTTGG - Intergenic
1139699834 16:68701262-68701284 TCAGAGCCTGGGCTCTGTGATGG + Intronic
1141224900 16:82105613-82105635 CCAGTGCCTGGCATTTAATAAGG + Intergenic
1141725234 16:85783606-85783628 GCAGAGGCAGGCCTTCGTTACGG + Intronic
1141967214 16:87453520-87453542 GCAGAGCCTGGGCTTTGTCTGGG - Intronic
1143380597 17:6493773-6493795 CCAGGGCCTGGCCCTTGCGAGGG + Intronic
1143483842 17:7242171-7242193 CCACAGCCTGGCCTTGGATCGGG - Intronic
1144189252 17:12828937-12828959 ACTGAGCCTGGCCTTTATTTTGG + Intronic
1144831097 17:18131592-18131614 TCAGAGCCTGGCCCCTGGTAGGG + Intronic
1147310214 17:39591595-39591617 CCAGGGCCTGCCCTTTGCTGGGG + Intergenic
1152186136 17:78857394-78857416 CCAGAGCCTGGTCTTAGATCAGG + Intronic
1154415588 18:14173828-14173850 CCAGAGCCAGGCCATAGTGAGGG + Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1156308880 18:35904741-35904763 CCAGAGCCTGGACTTTCCCATGG + Intergenic
1156649437 18:39207162-39207184 ACAGTGCCTGGCCTATATTAAGG + Intergenic
1158514074 18:58116654-58116676 CCAGAGCATCACCTTTGTTAGGG + Intronic
1160163292 18:76491441-76491463 ACAGACCCCCGCCTTTGTTATGG + Intronic
1161877371 19:6922100-6922122 CCAGTGCCTGGCCCTACTTAGGG - Intronic
1162998379 19:14350681-14350703 CCACAGCCTGGCCTCAGTTCTGG + Intergenic
1164428520 19:28166503-28166525 CAAGAGTCTGGCCTTTGCTCTGG - Intergenic
1166108258 19:40608136-40608158 CCAGACTCTGGCCTTGGCTAGGG - Intronic
925242449 2:2343894-2343916 CCAGAGCGTGGGCTTTGTAATGG + Intergenic
925294891 2:2769781-2769803 ACAGAAACTGGCCTTTGTTGGGG - Intergenic
928451003 2:31378594-31378616 CCAGAGTTTGACCTTTGTTCTGG + Intronic
930040166 2:47116149-47116171 CCAGTGGCTGGCCTATGCTATGG + Intronic
930279455 2:49352934-49352956 CCAGAGCCTATGCTTTGTCAAGG - Intergenic
934179884 2:89611134-89611156 CCAGCGCATGGCCTTGGTCATGG - Intergenic
934290180 2:91685395-91685417 CCAGCGCATGGCCTTGGTCATGG - Intergenic
937250889 2:120522949-120522971 GCAGAGCCTGGCCTTGGTGGGGG + Intergenic
937287445 2:120762230-120762252 CCTGAGGCTGGCCTTTGCAAGGG + Intronic
939209991 2:139162113-139162135 CAAGAGAGAGGCCTTTGTTAGGG - Intergenic
941364943 2:164598865-164598887 CCAGAACTTAGCCTGTGTTATGG + Intronic
943616048 2:190094015-190094037 CCAGAGCCTTGCATTTTCTAAGG + Intronic
948139741 2:235663539-235663561 CCAGAAGCTGGGCTTTGTAATGG + Intronic
1172019605 20:31904645-31904667 ACCGTGCCTGGCCTTTTTTAAGG + Intronic
1172631631 20:36382365-36382387 ACTGTGCCTGGCCTTTTTTAGGG + Intronic
1172947530 20:38700862-38700884 AGAGAGCCTGGGCTTTGTTCAGG + Intergenic
1173550531 20:43930222-43930244 ACACAGCCTGGGCTATGTTACGG - Intronic
1173556610 20:43970741-43970763 CCAGAGCCTGGCATTAGGGATGG - Intronic
1175604913 20:60304760-60304782 CAAGAGCCTGCCCTTTGGCATGG - Intergenic
1176102406 20:63370464-63370486 CCAGAGCCAGGCCTGGGTGAAGG + Intronic
1176172496 20:63702270-63702292 GCAGAGCCAGGCCTGTGTCATGG + Intronic
1176866857 21:14058751-14058773 CCAGAGCCAGGCCATAGTGAGGG + Intergenic
1178094794 21:29202996-29203018 CCAAAGTCTGGACTTTGTCAAGG + Intronic
1178546104 21:33494193-33494215 CCAGAGTATGGCCTTTTATATGG - Intergenic
1179351654 21:40617090-40617112 TCTGTGCCTGGCCTTTGTTCTGG - Intronic
1179509891 21:41865504-41865526 CCACAGCCTGGGGTGTGTTAGGG - Intronic
1179977294 21:44875382-44875404 CCAGAGCCTGGCCAGTTTTAAGG - Intergenic
1182156359 22:28076800-28076822 CAAGATCCTGGCTTTTGTTTTGG - Intronic
1183279121 22:36922797-36922819 CAGGAGCCTGGTATTTGTTAAGG - Intronic
1183467556 22:37987265-37987287 ACTCAGCCTGGCTTTTGTTAAGG + Intronic
1184107887 22:42379042-42379064 CCAGATCCTGGCCTTGGCTCAGG - Intergenic
1184429881 22:44436197-44436219 CCAGAGCCTGGCACTTAGTAGGG + Intergenic
1184709462 22:46240048-46240070 CGACAGCCTGGCCTTTGGTGGGG + Exonic
1185005833 22:48276552-48276574 TCAGGGCCTGGCCTGTGTTGTGG + Intergenic
950859515 3:16135379-16135401 CAAAAGCCTGGCCACTGTTAAGG + Intergenic
951520822 3:23609363-23609385 CCAGAGTCTGGACTTTGCTGAGG - Intergenic
952379271 3:32791968-32791990 GTACAGCCTGGCTTTTGTTAAGG + Intergenic
953580238 3:44147241-44147263 CCTGAGCATGGACTTTGTTGGGG - Intergenic
956074965 3:65495513-65495535 CCAGTGCCTGGCATGTGTTGGGG - Intronic
956760429 3:72438572-72438594 ACAGTGCCTGGCATTTGGTAGGG - Intronic
959456298 3:106566614-106566636 CCTGAGGGTGGACTTTGTTAAGG - Intergenic
960977832 3:123193605-123193627 TTGGAGCCTGGCCTTTGTTTTGG + Intronic
961142179 3:124564884-124564906 CCAAAGCCAGGCCTTAGTTCTGG + Intronic
961550313 3:127667173-127667195 CCTGAGCCTGGCATTTGCCATGG + Intronic
963498986 3:146101049-146101071 CCAGAACCTGGGTTTTGTTTTGG - Intronic
967764873 3:193268424-193268446 CCAGAACGAGGCCTTTATTATGG + Intronic
967938259 3:194746620-194746642 CCAGAGCCTACCCATTTTTAAGG + Intergenic
970350774 4:15199869-15199891 CCTGAGCCAGGTCTTAGTTATGG + Intergenic
970560895 4:17281389-17281411 CCTGAGCCTGGACTTGGTCAAGG - Intergenic
972164485 4:36265877-36265899 ACATAGCCTGGCTTCTGTTAGGG - Intergenic
972805349 4:42524245-42524267 ACAGAGCCTGGCGTGTGGTAGGG + Intronic
973230440 4:47834953-47834975 CCAGAGCCTTGCGGTTCTTAAGG + Intronic
974950101 4:68576978-68577000 CCAGAGCCTACCCTTTGATATGG + Intronic
974981162 4:68959206-68959228 CCAGAGCCCATCCTTTGTTTTGG - Intergenic
975330064 4:73102250-73102272 ACTGTGCCTGGCCTATGTTAAGG + Intronic
977027676 4:91840816-91840838 CCAGATCCTGTCATTTGATAAGG + Intergenic
979941488 4:126769344-126769366 CCAGAGGCAGTCCTTTCTTATGG - Intergenic
984793177 4:183632929-183632951 GCAGAGCCTGGCCTGTGCCACGG - Intergenic
984832262 4:183986781-183986803 CCAGAGCCTGAGCTCTGTTGGGG + Intronic
987999033 5:25326347-25326369 ACAGAGCCTGACATTAGTTAAGG + Intergenic
988443987 5:31264339-31264361 ACAGTGCCTGGCATTTGGTAAGG - Intronic
988612120 5:32736656-32736678 ATACAGCATGGCCTTTGTTAAGG - Intronic
989586087 5:43074829-43074851 CCTGAGCCTACCCTCTGTTATGG - Intronic
990330798 5:54723519-54723541 CCAGTGCATGGCCTTTGCAAAGG + Intergenic
993286796 5:86009297-86009319 ACAGTGCCTGGCATTTGTTTAGG + Intergenic
996683095 5:126249687-126249709 CCAAATGCTGGCCTGTGTTAGGG - Intergenic
997245339 5:132343353-132343375 CCAGTGCCTGGCCTTGATAAAGG + Intronic
1000871473 5:166582546-166582568 CCAGACACTGGCCATTGTCAAGG - Intergenic
1000886075 5:166749247-166749269 GCAATGCCTGGCCTTTTTTATGG - Intergenic
1001772945 5:174309432-174309454 CCAGGGCCTGGCCTGTGCTGTGG + Intergenic
1001954436 5:175838621-175838643 TCAGAGCCAGGTCTTTCTTATGG + Intronic
1002174767 5:177395553-177395575 TCAGAGCCTGGACTTTATTGAGG + Intronic
1002433808 5:179219556-179219578 CCAGAGCCTGGCCCCTTTTCTGG - Intronic
1007716854 6:43861802-43861824 CCAGAACCTGGCCTTGGGTTGGG - Intergenic
1008664401 6:53701861-53701883 CCAGAGCCTGCCATCTGTTCTGG - Intergenic
1008922227 6:56854286-56854308 CCAGAGCCTAACCTTTGATGTGG + Intronic
1011610667 6:89146898-89146920 CCCAAGCCTGGTGTTTGTTACGG + Intronic
1016658258 6:146544603-146544625 TCTGAGACTGGCCTTTGTGAGGG + Intronic
1018103716 6:160464059-160464081 CCAGAGCCTGCCCTTCGTCATGG - Intergenic
1019341847 7:512184-512206 CCAGGGCCAGGCCTATTTTAGGG + Intronic
1020819498 7:12948514-12948536 CCTCAGTCTTGCCTTTGTTATGG - Intergenic
1023607207 7:41941727-41941749 ACAGAGCCTGGACTGTGTGAAGG - Intergenic
1026806290 7:73431168-73431190 CTAGAGCCTGGCCTGTGGTAGGG - Intergenic
1026953792 7:74364354-74364376 CCGGTGCCTGGCCCTTGCTAGGG + Intronic
1028485144 7:91349204-91349226 GCAGTGCCTGACCTTAGTTATGG - Intergenic
1028832818 7:95345129-95345151 CCAGAGGATGGCCCTGGTTAGGG - Intergenic
1028933151 7:96436887-96436909 CTAGAACCTGGCCCTTGTTGAGG - Intergenic
1035401214 7:158567183-158567205 CCACATTCTAGCCTTTGTTAAGG - Intronic
1046077750 8:109333569-109333591 CCACAGCCTGGCTTCTGTTTCGG - Intronic
1046480441 8:114810043-114810065 CCAGAGGCTGTCCTGAGTTAAGG - Intergenic
1046698884 8:117377253-117377275 GCAGAGCCTTGCTTTTGTTCAGG - Intergenic
1047510052 8:125509072-125509094 ACAAAGCCTGGCCTTGGGTAGGG + Intergenic
1048102145 8:131364476-131364498 CAAGGTCATGGCCTTTGTTAAGG - Intergenic
1048162799 8:132036596-132036618 CTAGAGCCAGGCCTGTGTTTAGG + Intronic
1049075470 8:140392615-140392637 CGAGTGCCTGGCCTTTGGTGTGG + Intronic
1051964791 9:22814518-22814540 GCAGAATCTAGCCTTTGTTATGG + Intergenic
1052105110 9:24504800-24504822 CCAGAATCTGTCCTTTGTCAGGG - Intergenic
1052313035 9:27088910-27088932 CAAGTGCCTGGCCTGTGTTGTGG + Intergenic
1054878999 9:70125496-70125518 CCAGAGGCTGGCCTCCATTAGGG - Intronic
1054916375 9:70498587-70498609 CAAGTGCCTGACCTTTGTCAGGG + Intergenic
1056292775 9:85160547-85160569 CCTGAGGCTGGCCTTTGGTGAGG + Intergenic
1056720590 9:89068210-89068232 CCTGTGCCTGGCCATTGTTCTGG + Intronic
1056860685 9:90178207-90178229 CCAGAGCCATGCCTTTATGACGG - Intergenic
1057070059 9:92089895-92089917 TCATGGCCTGGCCTGTGTTATGG - Intronic
1057544407 9:96006694-96006716 CCAGAGCGTGGCCTGTGGTTTGG - Intronic
1057599877 9:96449019-96449041 CCAGAGCCTGTATTTTGTTCAGG - Intergenic
1060205188 9:121678683-121678705 CGAGAGCCCGGCCTTTCTTGAGG - Exonic
1060662800 9:125414253-125414275 CCAGAGCCTGGCATGGATTAGGG - Intergenic
1060814494 9:126627490-126627512 CCAGAGCCTTGCCTTGGTGCTGG + Intronic
1060823116 9:126672741-126672763 CCAGGGCCTGGCCTTAGGGAGGG + Intronic
1061672299 9:132195614-132195636 ACCGCGCCTGGCCTTTGTTTTGG + Intronic
1061766172 9:132882787-132882809 TTCGAGCCTGGCCTTTGTTCTGG + Intronic
1061851957 9:133421592-133421614 ACAGAGCCTGGCCTGTTTCAGGG + Intronic
1062392071 9:136337842-136337864 GCAGCGCCTGGCCATTGCTAAGG + Exonic
1062400367 9:136370099-136370121 CCAGAGGTTGGCCTTTGCCATGG + Intronic
1062725050 9:138068136-138068158 CCTGTCCCTGGCCTTTGTTGTGG - Intronic
1189752065 X:44232297-44232319 CAAGAACCTGGCCTCTGTGATGG + Intronic
1197091187 X:122539310-122539332 CCAGAGCCTGCCATTTGGTCTGG - Intergenic
1197150699 X:123217263-123217285 CCAGAGCCAGGCCTCTCGTAAGG + Intronic
1198223651 X:134625764-134625786 GCAGTGCCTCGCCTTGGTTAGGG - Intronic
1200008887 X:153106975-153106997 GCAGAGCCTGGCCTTTGCCTAGG - Intergenic
1200030713 X:153292947-153292969 GCAGAGCCTGGCCTTTGCCTAGG + Intergenic
1202378391 Y:24257615-24257637 ACCGAGCCGGGCCTTTGTTACGG + Intergenic
1202492391 Y:25412506-25412528 ACCGAGCCGGGCCTTTGTTACGG - Intergenic