ID: 1125472967

View in Genome Browser
Species Human (GRCh38)
Location 15:40022411-40022433
Sequence ATTCACATTGAGAATATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 326}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125472965_1125472967 -1 Left 1125472965 15:40022389-40022411 CCCTGAAGTCAGCATTTTAGTAA 0: 1
1: 0
2: 2
3: 31
4: 281
Right 1125472967 15:40022411-40022433 ATTCACATTGAGAATATAATTGG 0: 1
1: 0
2: 0
3: 21
4: 326
1125472966_1125472967 -2 Left 1125472966 15:40022390-40022412 CCTGAAGTCAGCATTTTAGTAAT 0: 1
1: 0
2: 2
3: 9
4: 221
Right 1125472967 15:40022411-40022433 ATTCACATTGAGAATATAATTGG 0: 1
1: 0
2: 0
3: 21
4: 326
1125472964_1125472967 0 Left 1125472964 15:40022388-40022410 CCCCTGAAGTCAGCATTTTAGTA 0: 1
1: 0
2: 0
3: 9
4: 225
Right 1125472967 15:40022411-40022433 ATTCACATTGAGAATATAATTGG 0: 1
1: 0
2: 0
3: 21
4: 326
1125472963_1125472967 1 Left 1125472963 15:40022387-40022409 CCCCCTGAAGTCAGCATTTTAGT 0: 1
1: 0
2: 1
3: 14
4: 211
Right 1125472967 15:40022411-40022433 ATTCACATTGAGAATATAATTGG 0: 1
1: 0
2: 0
3: 21
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125472967 Original CRISPR ATTCACATTGAGAATATAAT TGG Intronic
901095292 1:6674117-6674139 ATCCACATTGAAAATGAAATTGG - Intronic
901096790 1:6687733-6687755 ATTCACATGTAGAATATCTTTGG + Intronic
903331037 1:22597449-22597471 ATCCACATCGAGAAAATCATCGG + Exonic
904165836 1:28554307-28554329 ATTCACTTTGAGTATAAAAATGG + Intronic
904985917 1:34548820-34548842 ATTCATATTGAGAGGATAAGAGG + Intergenic
905918407 1:41701672-41701694 TTTCTCAATGAGAAGATAATAGG - Intronic
906360917 1:45157773-45157795 ATTGTCATTGGGAATATAAATGG - Intronic
907174826 1:52509642-52509664 ATTCACATTGAAAATATCCAGGG - Exonic
907596785 1:55727480-55727502 ATTCACCTGGAGAAAATAACTGG - Intergenic
909238117 1:73178904-73178926 TATAACATTGAAAATATAATGGG - Intergenic
910200970 1:84698232-84698254 ATTCACATTTGGATAATAATGGG + Intergenic
915770541 1:158417856-158417878 ATTCACATGGAAAAAATAAGAGG + Intergenic
917299414 1:173557448-173557470 ATTCAAATTATGAATATAATTGG - Exonic
917668533 1:177249353-177249375 ATTCACATTGCACATATAAAGGG - Intronic
918471089 1:184875018-184875040 ATTGACATAGAGTATATATTTGG + Intronic
918747407 1:188222466-188222488 ATTCAGGTTGAAAATATAATTGG - Intergenic
919054290 1:192550341-192550363 GTTCAAATTGAGAATTTAAGTGG - Intergenic
920899430 1:210092111-210092133 ATATCCATTGAGAATATATTTGG + Intronic
921462896 1:215449644-215449666 ATTCCTATTCAGAATATATTAGG + Intergenic
921668010 1:217895542-217895564 ACTCACATTGAGAGTATAAAAGG - Intergenic
922623196 1:227007701-227007723 CTTAACATAGAGAATACAATAGG + Intronic
1063248768 10:4251487-4251509 ATTCAAGTTGAGCATATCATGGG - Intergenic
1064223035 10:13457894-13457916 ATTCATCTTGAGAATGCAATAGG + Intronic
1064732125 10:18343028-18343050 ATGCACAATGAGAATTAAATGGG - Intronic
1066431550 10:35356667-35356689 ACTTACATTGAGAACCTAATAGG + Intronic
1066549566 10:36541260-36541282 ATTTTCAGTGAGAATATGATTGG + Intergenic
1066702847 10:38148373-38148395 TTTCACATGGAGAATTTCATGGG + Intergenic
1067993658 10:51244327-51244349 ATTCACCTTGACAATATAAATGG - Intronic
1068086207 10:52375839-52375861 ATTGACATTGAGAAAATATTTGG - Intergenic
1068176479 10:53466212-53466234 ATTAAAATTGAGAATAAAATTGG + Intergenic
1068344821 10:55761911-55761933 ATTGAGATGAAGAATATAATAGG + Intergenic
1068397512 10:56483231-56483253 AGTCACATACAGAATATACTTGG + Intergenic
1070040591 10:72774847-72774869 ATAGACATTTATAATATAATTGG - Intronic
1070051898 10:72897519-72897541 ATTCACTTTGAGAATATTTCTGG + Intronic
1070182740 10:74029945-74029967 ATCCACATTGAAAAAATAACTGG - Intronic
1070478536 10:76855205-76855227 ATTAACATTAAGAAAATAAAAGG - Intergenic
1070940762 10:80344558-80344580 ATTCAAGTTGAGAATTGAATGGG - Intronic
1071296698 10:84225936-84225958 TTTCACTTTGAGAAAATGATTGG - Intergenic
1072330024 10:94338770-94338792 ATTAACATTGTTAATATAAGAGG + Intronic
1073619553 10:105032492-105032514 ATTCAAATTCAAAATATTATAGG - Intronic
1073723449 10:106202317-106202339 ATTCAAATTGAGATTTTAGTGGG - Intergenic
1074593215 10:114834732-114834754 ATTTACATTATGATTATAATAGG - Intronic
1077956290 11:7023124-7023146 AATAAAATTGAGAATGTAATAGG + Intronic
1079625578 11:22612808-22612830 ATTAACAATGAGAATATATAAGG - Intergenic
1080118840 11:28651304-28651326 ATTTACATACAGAAAATAATGGG - Intergenic
1080715254 11:34793979-34794001 ATTCACAGAGAGAACATAAAAGG + Intergenic
1082607905 11:55264619-55264641 ATCCACATTCAGAAAAAAATGGG + Intronic
1082667893 11:55996955-55996977 ATAAATATTGAAAATATAATAGG - Intergenic
1083017255 11:59468138-59468160 ATTCAGAATCAGAATATAAATGG - Intergenic
1083085388 11:60137779-60137801 ATTAATATTCAGAATATAAAAGG + Intergenic
1085729668 11:78986045-78986067 ATTTTCATTTAGAATATACTAGG + Intronic
1086757746 11:90585652-90585674 ACCCAGATTCAGAATATAATGGG - Intergenic
1087383314 11:97437005-97437027 AATCAAAGTGAGAATAAAATGGG + Intergenic
1087763507 11:102126326-102126348 ATTCACATTGAGATTTCAGTGGG - Intronic
1091097290 11:132836101-132836123 ATTAACAGTGAGAACATAAACGG + Intronic
1092394836 12:8116553-8116575 ATTTAAATCAAGAATATAATAGG + Intergenic
1092621097 12:10269671-10269693 GTTCACTTTGAGATTAGAATTGG + Intergenic
1093509424 12:19908615-19908637 CTTCAAAATGAGAAAATAATTGG - Intergenic
1093858032 12:24129083-24129105 CTTCACATTGTGATTATAATGGG + Intergenic
1094061855 12:26322755-26322777 AATAACATAGAGAATGTAATTGG - Intergenic
1095153598 12:38825088-38825110 ATTCACACTGGGGAAATAATAGG - Intronic
1095915163 12:47470919-47470941 ATTAACTTTGAAAATAAAATAGG + Intergenic
1097611581 12:61829035-61829057 ATTCAATTTGAAATTATAATTGG - Intronic
1097764538 12:63510405-63510427 ATTCACATGCAGAATAAAATTGG + Intergenic
1097905665 12:64916742-64916764 ATTCTAATTAAAAATATAATTGG - Intergenic
1098962559 12:76753933-76753955 ATTCACATTGGGAACAAACTGGG - Intergenic
1099165257 12:79298489-79298511 ATTTACACTGATAAAATAATAGG + Intronic
1099726431 12:86434496-86434518 ATTCAGATAGAGTTTATAATAGG + Intronic
1099840741 12:87962588-87962610 ATTAATATTGAGAATATACAAGG - Intergenic
1100122971 12:91390586-91390608 AATAACAGAGAGAATATAATGGG - Intergenic
1100703260 12:97171483-97171505 ATTCATTCTGAAAATATAATTGG + Intergenic
1100734357 12:97510914-97510936 ATTCACATGGAGTCCATAATTGG + Intergenic
1101214830 12:102570270-102570292 ATTCGATTTGAGAATAAAATGGG - Intergenic
1106835666 13:33632429-33632451 AATCATATTCAGAATATCATTGG + Intergenic
1107819143 13:44270625-44270647 CCTCACATTGAGAATACAAAAGG + Intergenic
1108786112 13:53903150-53903172 ATTCAGATTGACAATATCAAAGG - Intergenic
1108963598 13:56268374-56268396 TTTCACATTGAGACTTTCATGGG + Intergenic
1109181077 13:59214463-59214485 ATAGACATTTTGAATATAATGGG - Intergenic
1109233632 13:59789379-59789401 CTTCGCATTGAAAATATATTAGG + Intronic
1109426768 13:62174778-62174800 ATTGAATTTTAGAATATAATAGG + Intergenic
1109460504 13:62650716-62650738 ATGCACAGAGAGAATATCATGGG - Intergenic
1109557813 13:64003496-64003518 ATTAACAATGATAATAAAATAGG + Intergenic
1110128286 13:71975794-71975816 AGTGACACTGAAAATATAATAGG + Intergenic
1111662594 13:91230093-91230115 AAACACATTGAGACTATACTGGG + Intergenic
1112875576 13:104034056-104034078 AATAACAATGAGAAGATAATAGG + Intergenic
1114012991 14:18393551-18393573 ATGCATATTGAAAATCTAATTGG - Intergenic
1114380365 14:22197502-22197524 ATTCAAAATGAGAATTTGATGGG - Intergenic
1114759231 14:25293752-25293774 ATTAACATTTTCAATATAATAGG - Intergenic
1115379940 14:32724549-32724571 AATTGCATTGAGAAGATAATAGG + Intronic
1117184051 14:53221316-53221338 ATTCATATTCAGAATATACAGGG - Intergenic
1117235824 14:53773670-53773692 ACTCACATCGAAAATATAAAGGG + Intergenic
1117448162 14:55824765-55824787 ATGCACATTGAGACTATAAAAGG - Intergenic
1117515882 14:56500749-56500771 ATTGACATTGAGAGTACATTGGG - Intronic
1117919161 14:60709810-60709832 AACCATATTGAGTATATAATTGG + Exonic
1118017964 14:61679760-61679782 ATTTATTTTGAAAATATAATAGG - Intergenic
1118661181 14:68014744-68014766 ATTCACATTCAGAATAGTACAGG - Intronic
1120150527 14:81028050-81028072 ATTCATAGTGAGAAATTAATAGG + Intronic
1120198044 14:81507822-81507844 TTTTACATGGAGAATTTAATTGG + Intronic
1120581228 14:86252485-86252507 TTTCACATTGATAATAAAAAGGG + Intergenic
1120647520 14:87091286-87091308 CTTCACAGTGATAATTTAATAGG - Intergenic
1125162451 15:36661514-36661536 AATTGCATTGAGAGTATAATTGG + Intronic
1125242383 15:37590286-37590308 ATTAACTTTGGGAATATGATGGG + Intergenic
1125472967 15:40022411-40022433 ATTCACATTGAGAATATAATTGG + Intronic
1127369321 15:58322523-58322545 ATTCACATCCAGAATATACAAGG - Intronic
1128008150 15:64265230-64265252 AAAGAAATTGAGAATATAATCGG + Intronic
1128406997 15:67352130-67352152 AATCACAATAAGAATATAAAAGG - Intronic
1128523821 15:68394761-68394783 ATAGACATTGAAAAGATAATAGG + Intronic
1128855045 15:71003359-71003381 TTTCAGTTGGAGAATATAATTGG + Intronic
1129304856 15:74652542-74652564 ATTCACATTTAGAAGAGAAAAGG + Intronic
1133041635 16:3064121-3064143 GTCCCCTTTGAGAATATAATGGG + Intergenic
1134567085 16:15261084-15261106 AATCACTTTGAGAATAAAAATGG - Intergenic
1134735408 16:16495616-16495638 AATCACTTTGAGAATAAAAATGG + Intergenic
1134932118 16:18216601-18216623 AATCACTTTGAGAATAAAAATGG - Intergenic
1137926005 16:52542797-52542819 GTTCAAATTGAGAACATATTGGG - Intronic
1138163828 16:54781108-54781130 CTTCACATAGAGATTATAAAGGG - Intergenic
1139102007 16:63779094-63779116 ATTCCCATTCAGAATCTCATTGG + Intergenic
1139140053 16:64250895-64250917 ATTTAAATTCTGAATATAATAGG - Intergenic
1140421129 16:74819785-74819807 ATTCATATTCAGAATATACAAGG - Intergenic
1140846683 16:78895562-78895584 ATTCTCCTTTAGAATTTAATAGG + Intronic
1140960718 16:79909888-79909910 ATTAACATTAAGAATATATTTGG - Intergenic
1143715167 17:8762372-8762394 ATTCAAGTTGAGATTAGAATGGG + Intergenic
1144128603 17:12224631-12224653 TTCTATATTGAGAATATAATGGG + Intergenic
1145407820 17:22622681-22622703 ATTGAGATGAAGAATATAATAGG + Intergenic
1145711274 17:26981594-26981616 ATTTAGATTGAAAATAGAATAGG + Intergenic
1147111521 17:38265405-38265427 TCTCACATTAAGAAAATAATAGG - Intergenic
1148418052 17:47523395-47523417 TCTCACATTAAGAAAATAATAGG + Intronic
1149125554 17:53226401-53226423 ATACATATTTAGAATATATTTGG - Intergenic
1150557636 17:66268658-66268680 ATCCACATCTAGAATAGAATTGG - Intergenic
1153373769 18:4352822-4352844 ATTCACATACAGAAAATCATTGG - Intronic
1156558263 18:38091920-38091942 ATACACATTGAGAATGCAATGGG + Intergenic
1156706374 18:39887961-39887983 ATTAATATTAATAATATAATAGG + Intergenic
1157047363 18:44118473-44118495 CTTCATTTTGAGAACATAATGGG + Intergenic
1157972881 18:52290682-52290704 ATTCACTTTGAGAGAATAAAGGG - Intergenic
1159085752 18:63789614-63789636 ATTCAGAGAGAGAATATACTGGG - Intronic
1159441917 18:68491984-68492006 AATCACTTTGAAAATAAAATTGG + Intergenic
1159679493 18:71330019-71330041 ATTCAAATTGAGAGTAGAAAAGG - Intergenic
1159699454 18:71606669-71606691 ATTCACTTTGAATATCTAATTGG + Intergenic
1163738798 19:18998076-18998098 ATCCTCATTGAGAATTGAATGGG - Intronic
1166610779 19:44193844-44193866 ATGCACATTTAAAAAATAATTGG - Intergenic
925232569 2:2246966-2246988 CTTCATAATGAGAATGTAATTGG + Intronic
925653303 2:6116292-6116314 ATTCACACTGAGAAATAAATGGG - Intergenic
925788766 2:7460013-7460035 AATCATATCAAGAATATAATAGG - Intergenic
927031948 2:19129732-19129754 CTACAAATTGAGAATAGAATGGG - Intergenic
928067940 2:28185515-28185537 AGTCATATTGAAAATATACTAGG + Intronic
928998227 2:37319594-37319616 ATTCAAACTGCTAATATAATGGG + Intronic
930152372 2:48071565-48071587 ATTCAAAATAAGAATACAATGGG + Intergenic
930325719 2:49914750-49914772 ATTAACATTGATTATATAATAGG - Intergenic
930502582 2:52240666-52240688 ATCCATATTGATAACATAATGGG - Intergenic
930633410 2:53779264-53779286 ATTAAAATTCAGAATATAAAAGG - Intronic
931492248 2:62760902-62760924 TTTTTCATTGAGAATTTAATAGG + Intronic
932016725 2:68036084-68036106 ATTCACCATGAGAATCTGATGGG + Intergenic
933471691 2:82734033-82734055 TTTCACATATAGAATATAAATGG - Intergenic
933641172 2:84761932-84761954 ATTCACATTGTAGATATTATAGG + Intronic
933937778 2:87220237-87220259 ATTAACAATGAGAACATTATTGG + Intergenic
934039949 2:88119770-88119792 CTTCACATTGAAAATATTAATGG + Intergenic
934513375 2:94966801-94966823 ATTCATATTGAGAATATGCAAGG - Intergenic
936355361 2:111745536-111745558 ATTAACAATGAGAACATTATTGG - Intergenic
937055711 2:118934592-118934614 TTTCAAATTGTGAATATATTTGG + Intergenic
937443346 2:121935371-121935393 ATTTCCATTAAAAATATAATGGG - Intergenic
937648125 2:124288332-124288354 ATTTACAGTGAGAGTATAATTGG - Intronic
938375277 2:130801141-130801163 ATACAGATTAAGAATTTAATAGG - Intergenic
939053723 2:137336306-137336328 ATTCAGTTTCAGAAGATAATAGG - Intronic
939540773 2:143491153-143491175 ATTAACATTGAGCATCTCATTGG + Intronic
939645028 2:144686973-144686995 ATTCACATTGAGAAAGGAAAGGG + Intergenic
941123190 2:161555041-161555063 ATTCACAAAAAGAAAATAATAGG - Intronic
942130398 2:172873115-172873137 ATTCACTGTGAGAAAATTATTGG - Intronic
942279631 2:174347113-174347135 ATTAACATTGATATTAAAATTGG + Intergenic
942907662 2:181203238-181203260 ATTCACAATGTGACTATATTTGG + Intergenic
943253441 2:185561464-185561486 ATTAACATTAAGAATACAAGTGG - Intergenic
943904299 2:193478019-193478041 ATTGGGATTGAGAATATTATTGG + Intergenic
944122162 2:196251891-196251913 CTTCACATGGACAATAGAATAGG + Intronic
944839151 2:203608695-203608717 ACTCACATTGAAGATATAAAAGG - Intergenic
945130530 2:206566644-206566666 ATGCACAGTGACAATAGAATTGG - Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
946995484 2:225386016-225386038 ATTTACTCTGAGAATATAGTTGG + Intergenic
947569346 2:231219758-231219780 AAAGACATGGAGAATATAATAGG - Intronic
948218440 2:236250084-236250106 ATCCACCTTGAAATTATAATGGG + Intronic
1168797039 20:617743-617765 AATATCATTGAAAATATAATAGG + Intergenic
1169561984 20:6811417-6811439 TTTCTCATTGTGAATATAAAGGG + Intergenic
1170410621 20:16087026-16087048 ATTAATATTCAGAATATAAAAGG + Intergenic
1170925815 20:20722401-20722423 AATCACATTGATATTTTAATTGG + Intergenic
1171232872 20:23501343-23501365 ATTCACATGGAGACTGCAATAGG - Intergenic
1171335080 20:24377684-24377706 ATTCAAGTTGAGATTTTAATGGG - Intergenic
1172200592 20:33123397-33123419 ATTCACGTTGAGATTATGGTGGG - Intergenic
1177329345 21:19636057-19636079 ATTGATAATGAGAATATAAAAGG + Intergenic
1177499514 21:21934405-21934427 ATTCAAATTTCTAATATAATAGG - Intergenic
1177667223 21:24176124-24176146 GTTCACCTTGAAAATATAGTTGG + Intergenic
1178578357 21:33815172-33815194 ATTCCCATAGAGAACATTATCGG + Intronic
1178624948 21:34207343-34207365 ATTCAGTTAGACAATATAATGGG - Intergenic
1180437485 22:15324367-15324389 ATGCATATTGAAAATCTAATTGG - Intergenic
1180520337 22:16194583-16194605 ATGCATATTGAAAATCTAATTGG - Intergenic
1180592548 22:16953615-16953637 ATTCAGATAGAGAAAATAATTGG - Intergenic
1184312222 22:43653831-43653853 ATTCACCTTGAGAACCTGATGGG - Intronic
949657404 3:6236718-6236740 ATTCACAGGGAGACTTTAATGGG - Intergenic
949774093 3:7611931-7611953 ATTCTCATGAAGAATATAATAGG + Intronic
949975177 3:9450255-9450277 ATACACTTGGAGAATATAACAGG - Intronic
953125516 3:40088431-40088453 ATTAACATTCAGGATATATTAGG - Intronic
955784193 3:62519057-62519079 ATTCAAGTTGAAAATATAAAGGG + Intronic
956649410 3:71490193-71490215 ATGCACCTTGAGAAAAAAATGGG + Intronic
957027680 3:75202383-75202405 ATACACATTGCAAAAATAATTGG - Intergenic
957414946 3:79889877-79889899 ATTGACCTTGGGTATATAATGGG - Intergenic
957983356 3:87541453-87541475 ATTCACATTGTGAACATGGTTGG + Intergenic
958593003 3:96183704-96183726 AATCTCATTGTTAATATAATAGG + Intergenic
959187799 3:103068960-103068982 ATTATTATTGATAATATAATAGG + Intergenic
962130058 3:132663006-132663028 ACTCCCATTGAAAATATAAAGGG + Intronic
962395685 3:135013691-135013713 ATTCTCTTTGGGAATATATTTGG - Intronic
962480936 3:135797958-135797980 ATAAAAATTGAGAATATAAATGG + Intergenic
963261150 3:143192288-143192310 AGTCAAATTTAGAATATATTTGG - Intergenic
965009725 3:163072567-163072589 ATTCATATTAAGAAAATATTTGG - Intergenic
965340253 3:167481892-167481914 ATTCAAATTGAGATTTGAATGGG + Intronic
966364026 3:179163038-179163060 ATACACATTGATAGTAAAATTGG + Intronic
966369096 3:179227843-179227865 ATTCACATAGAAAATTAAATAGG - Intronic
966864431 3:184249405-184249427 ATTCATATTGAAAATATGAGAGG + Intronic
967156138 3:186694252-186694274 GTTCACAGACAGAATATAATAGG + Intergenic
968325831 3:197814396-197814418 ATTCACGTTGAGACTTGAATGGG + Intronic
969745698 4:9069477-9069499 ATTCACAGAGAGTATATAACAGG - Intergenic
970503180 4:16699560-16699582 ATTCACATGGAGAATATGTGAGG + Intronic
971652026 4:29289778-29289800 TTTCAAATTGATAATATGATTGG - Intergenic
972302942 4:37802685-37802707 ATTCACATAAAGAATTTTATTGG - Intergenic
972722392 4:41713371-41713393 TTTCAATGTGAGAATATAATTGG + Intergenic
972839738 4:42916477-42916499 ATTGACATTGTGAAAATCATAGG + Intronic
973088483 4:46100175-46100197 ATTTACTTGGAGAAAATAATAGG - Intronic
973141831 4:46779222-46779244 TCACACATTGAGAATCTAATAGG + Intronic
973169265 4:47119311-47119333 ATTCAAATTTAGAAGAAAATAGG + Intronic
973633011 4:52837094-52837116 ATTCAAATTGAGAAAAGAAAAGG - Intergenic
973710335 4:53623641-53623663 CTTCAAATTGAGAATTTGATTGG - Intronic
974677147 4:65107133-65107155 ATTCAAATGGAAAACATAATGGG + Intergenic
974799372 4:66796984-66797006 ATTAACTTTGTGATTATAATTGG - Intergenic
974837628 4:67269943-67269965 ATTCTCTTTGAGAATAAAATGGG + Intergenic
975451079 4:74527530-74527552 ATTCTCATTCAGAAAAAAATGGG + Intergenic
975668747 4:76758948-76758970 CTACTCATTGATAATATAATAGG - Intronic
976023151 4:80655717-80655739 TTTCACTTTGAGAATATTGTTGG - Intronic
977769282 4:100837986-100838008 ATTTACAATGAAAATATAAGAGG - Intronic
978292758 4:107164884-107164906 ATTAATAATCAGAATATAATAGG + Intronic
979123988 4:116943804-116943826 GTTCACATAGAGAATATCCTGGG - Intergenic
980272559 4:130605127-130605149 ATTGACCTTGATAATATAACTGG + Intergenic
980415872 4:132487058-132487080 ATTCAATTTGATAATATTATTGG - Intergenic
980767551 4:137327428-137327450 AATGACATTGATAACATAATTGG + Intergenic
980797860 4:137708890-137708912 ATTCATATGCAGAATATAAAAGG - Intergenic
980896049 4:138861502-138861524 ATTCACATTTAGAAATTAGTTGG - Intergenic
981018150 4:139996757-139996779 ATTCACATTAAATATATTATTGG + Intronic
981271381 4:142850229-142850251 AGTCACATTTCAAATATAATAGG + Intergenic
982799011 4:159679689-159679711 CTTCTCATTGAGAATCTGATAGG - Intergenic
982833132 4:160088233-160088255 ATTCACATATAGAATAAAATTGG - Intergenic
982927453 4:161356504-161356526 ATTTACATTGACTATATCATTGG + Intergenic
983016742 4:162622672-162622694 CTTCACAGTGAGAATTTGATAGG + Intergenic
983305517 4:165980161-165980183 ATTTATATTGAGAATATGTTGGG + Intronic
983743569 4:171166164-171166186 ATTGACATTGAGAAACTAGTTGG - Intergenic
984342068 4:178469984-178470006 CCTCACATTCAGAAAATAATGGG + Intergenic
984636257 4:182113037-182113059 ATTCACACTGAAAATCTAACTGG + Intergenic
985047107 4:185951573-185951595 ATCCACACTGAGAAAATAACAGG - Intronic
985065906 4:186121573-186121595 AATTACATTGAGAAGATCATGGG + Intronic
985191475 4:187378635-187378657 ATGCACATTGAGAAGGTGATTGG - Intergenic
987732556 5:21795082-21795104 ATTCACATTGTGAATACTAAAGG - Intronic
988935650 5:36079760-36079782 ATTCTCATTAACAATAGAATGGG - Intergenic
989560342 5:42842979-42843001 ATACACAGTGAGATCATAATGGG + Intronic
990671451 5:58134835-58134857 TTTCACATTCTGAAGATAATAGG + Intergenic
991553741 5:67872195-67872217 AATGACATTGAAATTATAATTGG - Intergenic
991978949 5:72211794-72211816 ATCCACATGGAGATTTTAATGGG - Intergenic
992975816 5:82118700-82118722 ATTCAGATTTAGGATATAAGTGG + Intronic
994078578 5:95681012-95681034 ATTAACATTGGAAATAGAATGGG - Intronic
994458247 5:100042210-100042232 ATTCAATTTGATAATATATTAGG - Intergenic
994487504 5:100398233-100398255 AATCAAATTGAGAAAATTATAGG + Intergenic
995161045 5:108982304-108982326 ATTTAGATGGAGAATATAGTAGG + Intronic
995773342 5:115697187-115697209 AAAGACATTGAGAATATAAAGGG + Intergenic
996046376 5:118878114-118878136 AATCTCAATGAGAATTTAATAGG - Intronic
996225525 5:120989427-120989449 AATAACATTGAGATTTTAATTGG - Intergenic
996490219 5:124086055-124086077 ATTCAAATTGAGATTTGAATAGG - Intergenic
997483251 5:134205831-134205853 ATTCAGATAGAGAAAATAACTGG + Intronic
998189321 5:140009378-140009400 AATCCCATTTAGAATATTATGGG - Intronic
999569351 5:152901264-152901286 TTTCACATTAAGAATATGAAAGG + Intergenic
1000404460 5:160872574-160872596 ATCCACATGGAGAATAAAACTGG - Intergenic
1004108906 6:12695073-12695095 ATTCAAATTGAGCATGTCATTGG - Intergenic
1004686583 6:17952330-17952352 ATTTATATTAAGAAAATAATTGG + Intronic
1006344274 6:33467208-33467230 ATTCAAATTGAGATTTGAATGGG - Intergenic
1008322971 6:50140490-50140512 TTTCACATATAGAATATTATGGG - Intergenic
1008723567 6:54389048-54389070 ATCCATAATGAGAAAATAATGGG - Intronic
1008904733 6:56663736-56663758 ATTTTGAATGAGAATATAATAGG - Intronic
1010092057 6:71994510-71994532 AGTCATTTTGATAATATAATGGG + Intronic
1010464795 6:76154643-76154665 ATTAACCATGAGAATATAAGTGG + Intergenic
1010470826 6:76226482-76226504 ATTCACCCTGAGATTTTAATGGG - Intergenic
1010506432 6:76665628-76665650 ATTCACAGAGAGAAAAAAATGGG + Intergenic
1012211606 6:96525315-96525337 ATTCATATTGAAAATAGAATTGG + Exonic
1012568798 6:100696335-100696357 TTTCACATTGAGAAAATACATGG + Intronic
1013318621 6:108964944-108964966 ATTCAAATTGAGAAGTTATTAGG - Intronic
1013332123 6:109113646-109113668 ATTCACATTTAAACTATATTTGG - Intronic
1014447231 6:121542662-121542684 ATTTGCATCGAGAAAATAATTGG + Intergenic
1016511365 6:144846907-144846929 ATTTACATGGAGAATAAAGTAGG - Intronic
1016685344 6:146875429-146875451 AATCATATAGAAAATATAATAGG - Intergenic
1016753303 6:147655174-147655196 CTTCACTTTGAGAATATCTTGGG - Intronic
1018343596 6:162878824-162878846 ATTCAGATTTAGAATAACATGGG - Intronic
1018700398 6:166421825-166421847 ATTAATATTGATAATATTATGGG - Intronic
1018957801 6:168422522-168422544 ATCCACATGCAGAATAAAATTGG - Intergenic
1024789520 7:52948546-52948568 ATTCACAATGAGAACAAGATAGG - Intergenic
1025770135 7:64497000-64497022 AAAAACATTGACAATATAATAGG - Intergenic
1026534623 7:71229591-71229613 CTTCACAGTGAGAATAGAAATGG - Intronic
1027541393 7:79471191-79471213 ACTCACACTGAGAAAATAACAGG - Intergenic
1028764585 7:94538504-94538526 ATCTTCATTGAGAATATACTGGG + Intronic
1029623474 7:101704897-101704919 ATTCACATTAAGAGAAAAATGGG + Intergenic
1030498428 7:110329084-110329106 ATTCATATATAGAATATAAGGGG + Intergenic
1030611003 7:111688741-111688763 AATCTCTTGGAGAATATAATGGG - Intergenic
1032646214 7:133827294-133827316 ATTCAATTTGATCATATAATGGG - Intronic
1032765571 7:134988936-134988958 ATTTAAATTAAGAATAAAATTGG - Intronic
1035439813 7:158887379-158887401 ATTCAGAATGAGCAAATAATTGG + Intronic
1036525605 8:9531727-9531749 ATTGAAATTGAGAAGTTAATTGG - Intergenic
1037089609 8:14897580-14897602 ATTCACATTTAAAATAGAAAAGG - Intronic
1039006275 8:33040869-33040891 ATTCAGACTGAGAAAATATTTGG - Intergenic
1042792742 8:72626403-72626425 AATCACACTCAGAATATATTTGG + Intronic
1043210473 8:77508252-77508274 ATTAAAATTGTGAATATACTTGG - Intergenic
1043225077 8:77716452-77716474 ATAAACATTGAGAGTACAATTGG + Intergenic
1043260608 8:78190483-78190505 ATTGAAATTGAGATTAGAATTGG - Intergenic
1044624271 8:94220941-94220963 ATTCAGGTTGACAATATAAGAGG + Intergenic
1044975372 8:97659520-97659542 ATTGAATTTGAGAATATAAATGG + Intronic
1046139761 8:110075687-110075709 ATTCACAAAGATAATATAAATGG + Intergenic
1046398467 8:113673023-113673045 ATTTGCATTGACAATATAAGTGG - Intergenic
1047405434 8:124581769-124581791 ATTCACATTGATAGTAACATGGG + Intronic
1048391219 8:133967042-133967064 ATTCACATTCAGTTTATAAGTGG + Intergenic
1050064548 9:1745258-1745280 ATTCATATTTTGAATCTAATCGG + Intergenic
1050227887 9:3482042-3482064 ATTCATATAAAGAAAATAATTGG + Intronic
1050235693 9:3577031-3577053 ATTCAAATTAATAAGATAATTGG + Intergenic
1051011304 9:12417641-12417663 ATTAAAATTAATAATATAATGGG - Intergenic
1051200520 9:14616338-14616360 ATTGACAGCAAGAATATAATGGG + Exonic
1055082478 9:72280886-72280908 ATTCATAATGAGAATAAAAAAGG + Intergenic
1057787913 9:98101840-98101862 CTACACATAGAGAATAGAATTGG + Intronic
1058036876 9:100262274-100262296 ATTCTCTTGGAGAATAAAATTGG + Intronic
1186102353 X:6170425-6170447 AATCACCTGGAGAATGTAATAGG - Intronic
1186634087 X:11383349-11383371 ATTCACTCTGAGAAGATATTAGG - Intronic
1187199214 X:17118718-17118740 GTTCACATTTAGAAAATTATTGG - Intronic
1187233252 X:17442559-17442581 ATTCACGTTGAGAGAATAAATGG + Intronic
1187292098 X:17964628-17964650 ACCCACAGTTAGAATATAATGGG + Intergenic
1187996066 X:24928056-24928078 TTTGACATTGAAAATGTAATAGG + Intronic
1188327183 X:28820117-28820139 TTTTATATTGAGAATATAAAAGG - Intronic
1188528255 X:31109052-31109074 TTTCACAATGAGCATATAAATGG + Intronic
1188540111 X:31240264-31240286 TTGCACATTGAGAGTATAATAGG - Intronic
1189608458 X:42705105-42705127 ATTCACAGTGAGTAAATAAGTGG - Intergenic
1189828555 X:44946441-44946463 ATTCATATTTAGAATATATAAGG - Intronic
1191163606 X:57363111-57363133 ACTCACATTGAGAGTTTGATGGG + Intronic
1191741201 X:64436979-64437001 CTTCACACTAAGTATATAATAGG - Intergenic
1192624339 X:72712431-72712453 ATTCTCATTGAGAAAATGTTTGG - Intronic
1193214388 X:78845547-78845569 AATGCCATTGAGACTATAATGGG - Intergenic
1194125301 X:90009057-90009079 TTTCACTGTGAGAACATAATGGG + Intergenic
1194237997 X:91408720-91408742 ATCCAAATTGAAAAAATAATTGG + Intergenic
1195525578 X:105885432-105885454 ATTTTCAATGAAAATATAATTGG - Intronic
1195600862 X:106746189-106746211 ATTCACAATGAGAATAATAAGGG - Intronic
1196629027 X:117914200-117914222 ATTCCCATTTAGAAAAAAATGGG + Intronic
1197290893 X:124655786-124655808 ATTGACATTTATAATAAAATAGG + Intronic
1197588625 X:128381726-128381748 ATTCACATGCAGAATAAAATTGG + Intergenic
1197596856 X:128474541-128474563 ATTCACAGAGAAAATAAAATAGG + Intergenic