ID: 1125475725

View in Genome Browser
Species Human (GRCh38)
Location 15:40046949-40046971
Sequence CTGTGGGTCTGTCACAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125475725_1125475729 -6 Left 1125475725 15:40046949-40046971 CCACCTCTGTGACAGACCCACAG No data
Right 1125475729 15:40046966-40046988 CCACAGATGCAGATTTACACAGG No data
1125475725_1125475730 -5 Left 1125475725 15:40046949-40046971 CCACCTCTGTGACAGACCCACAG No data
Right 1125475730 15:40046967-40046989 CACAGATGCAGATTTACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125475725 Original CRISPR CTGTGGGTCTGTCACAGAGG TGG (reversed) Intergenic
No off target data available for this crispr