ID: 1125478284

View in Genome Browser
Species Human (GRCh38)
Location 15:40062502-40062524
Sequence ATACTAGAAGGGATGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125478279_1125478284 -8 Left 1125478279 15:40062487-40062509 CCTAGAGTATGGTAAATACTAGA No data
Right 1125478284 15:40062502-40062524 ATACTAGAAGGGATGGTGGATGG No data
1125478275_1125478284 26 Left 1125478275 15:40062453-40062475 CCAGGTACTAAAATCTGTGAATG No data
Right 1125478284 15:40062502-40062524 ATACTAGAAGGGATGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125478284 Original CRISPR ATACTAGAAGGGATGGTGGA TGG Intergenic
No off target data available for this crispr