ID: 1125478813

View in Genome Browser
Species Human (GRCh38)
Location 15:40066098-40066120
Sequence TAGGGAATACAGGCCGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1278
Summary {0: 1, 1: 1, 2: 18, 3: 148, 4: 1110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125478813 Original CRISPR TAGGGAATACAGGCCGGGCA CGG Intergenic
900239384 1:1607627-1607649 AAGGAAATCAAGGCCGGGCACGG - Intergenic
900283163 1:1884971-1884993 ATTGGAATACTGGCCGGGCACGG - Intronic
900284960 1:1894626-1894648 AAGGGAATGGAGGCGGGGCAGGG - Intergenic
900332550 1:2143317-2143339 GAGGAAATATAGGCCGGGCGTGG - Intronic
900969122 1:5979802-5979824 TAGAAAATACAGGCCGGGCATGG - Intronic
901355965 1:8649437-8649459 TATGGAATACAGGCTGGGCGCGG + Intronic
901389497 1:8934726-8934748 AAGAGATTATAGGCCGGGCATGG - Intergenic
901408052 1:9063339-9063361 TAAAGTATACAGGCTGGGCATGG - Intronic
901472811 1:9469410-9469432 AAAGAAATAAAGGCCGGGCATGG + Intergenic
901480587 1:9522248-9522270 AAGGAAATTCAGGCCGGGCATGG + Intergenic
901644993 1:10712053-10712075 AAGTGATTACAGGCCGGGCGTGG + Intronic
901730926 1:11279152-11279174 AAGAGAATATAGGCCGGGCATGG - Intronic
901805126 1:11733898-11733920 AATGAAAAACAGGCCGGGCACGG - Intergenic
901852367 1:12023703-12023725 AAGAGAAGACAGGCCGGGCACGG + Intronic
902180235 1:14682576-14682598 AAGGGAATTCTGGCCAGGCATGG - Intronic
902524725 1:17048999-17049021 TAAAAAATAAAGGCCGGGCAAGG - Intronic
902735866 1:18400293-18400315 TAAGAACTAGAGGCCGGGCATGG + Intergenic
902834866 1:19040471-19040493 GAGGGAACACAGGTCAGGCAGGG + Intergenic
902879972 1:19365538-19365560 GATGGAAACCAGGCCGGGCATGG + Intronic
902993650 1:20207022-20207044 GAGAGAATCCAGGCCGGGCACGG - Intergenic
903116108 1:21179268-21179290 CAGGTGTTACAGGCCGGGCATGG - Intergenic
903172333 1:21561955-21561977 AAGTGTATACAGGCCAGGCACGG - Intronic
903267424 1:22166242-22166264 GAGGGGCAACAGGCCGGGCATGG - Intergenic
904093197 1:27959447-27959469 AAGGGAATAGAGGCCGGGCGCGG - Exonic
904182686 1:28677891-28677913 AAGGGAGAAGAGGCCGGGCATGG + Intronic
904195174 1:28780174-28780196 TAGGAGAAACAGGCCGAGCACGG - Intergenic
904210059 1:28881207-28881229 TTAAGAATACAGGCCGGGCACGG - Intergenic
904736907 1:32641621-32641643 TACTTTATACAGGCCGGGCACGG + Intronic
905147733 1:35901259-35901281 AAGGCGATTCAGGCCGGGCATGG - Intronic
905149542 1:35916656-35916678 TTGGGCATAATGGCCGGGCACGG - Intronic
905375309 1:37516207-37516229 AGGGGAATGCAGGCCGGGCGCGG + Intergenic
905495078 1:38378478-38378500 AAGAGTATACAGGCAGGGCACGG + Intergenic
905504476 1:38466168-38466190 TAGGGACAAGAGGCCGGGCATGG - Intergenic
905577307 1:39055740-39055762 TAACAAATAGAGGCCGGGCACGG + Intergenic
905611859 1:39359678-39359700 TATCGTATACAGGCCGGGCGTGG + Intronic
905626922 1:39495399-39495421 TATGGATGACAGGCCAGGCAGGG - Intronic
905670014 1:39785372-39785394 TATGGATGACAGGCCAGGCAGGG + Intronic
905830358 1:41060975-41060997 TAAGGAAAATAGGCCAGGCATGG - Intronic
906170099 1:43717796-43717818 TAGAAAATACAGGCCAGGCACGG - Intronic
906322586 1:44826424-44826446 GAGGGATGACAGGCTGGGCAGGG + Intronic
906411124 1:45580352-45580374 TGAGGAAAACAGGCCGGGCATGG + Intergenic
906479408 1:46190332-46190354 TAGGAACTTCAGGCCGGGCGCGG - Intronic
906496157 1:46305418-46305440 TAGGGTATTCTGGCCGGGCGCGG + Intronic
906639872 1:47435255-47435277 GAGGACATTCAGGCCGGGCAGGG + Intergenic
906869750 1:49465174-49465196 TAGGGAATACAGTCAGGGTTGGG - Intronic
907036356 1:51219782-51219804 TTGGGATTACAGGCCGGGTGCGG - Intergenic
907147223 1:52246218-52246240 TACGGCATAAAGGCCAGGCATGG - Intronic
907177949 1:52543043-52543065 TGGTGAACACAGGCCGGGCATGG - Intronic
907356672 1:53880972-53880994 TAGGGAATACCAGCTGGGCGCGG + Intronic
907647821 1:56261782-56261804 TAAGGAATACATGCTGGACAAGG + Intergenic
908157100 1:61364923-61364945 TAGAGAACCCTGGCCGGGCATGG + Intronic
908226547 1:62061470-62061492 TGGGAAAAACAGGCTGGGCACGG - Intronic
908243063 1:62204014-62204036 TAGCGAAAAAAGGCCAGGCACGG - Intronic
908295467 1:62708383-62708405 TATGTAAGACAGGCCGGGCATGG + Intergenic
908504765 1:64785657-64785679 TAGGGACAATTGGCCGGGCATGG - Intronic
909009233 1:70314946-70314968 AAGAATATACAGGCCGGGCACGG + Intronic
909291144 1:73885284-73885306 TAGAAACTACTGGCCGGGCATGG - Intergenic
909500514 1:76330091-76330113 TGGGGAATATAGGCTGGGCATGG - Intronic
909634744 1:77804915-77804937 AAATGAATACAGGCCAGGCATGG - Intronic
909655303 1:78025223-78025245 TTCGAAATAAAGGCCGGGCATGG + Intronic
909960324 1:81832431-81832453 TAGAAAGTTCAGGCCGGGCAAGG - Intronic
910229396 1:84970377-84970399 TAAAGAATACTGGCCAGGCATGG + Intronic
910290275 1:85593969-85593991 TAGGGAACAGAGGCCGTGCATGG - Intergenic
910416428 1:87004098-87004120 TACTGAATACTGGCCGGGCGTGG + Intronic
911143894 1:94534155-94534177 TAAGGAAAAGAGGCTGGGCATGG - Intronic
911261586 1:95693022-95693044 TGGGGATAATAGGCCGGGCATGG + Intergenic
911334243 1:96561769-96561791 TACGGCATCCAGGCCGGGCATGG - Intergenic
911348543 1:96724553-96724575 ATGACAATACAGGCCGGGCACGG - Intronic
911583145 1:99658479-99658501 TAAAAAATATAGGCCGGGCACGG + Intronic
912275233 1:108250810-108250832 TAGTAAATACAGGCCGGGCATGG + Intergenic
912292990 1:108443539-108443561 TAGTAAATACAGGCCGGGCATGG - Intronic
912794682 1:112685364-112685386 TAGGGGATTACGGCCGGGCACGG + Intronic
912794750 1:112686003-112686025 TAGGGAATGCAGGCCCCGGATGG - Intronic
912917207 1:113826957-113826979 TAGAGACTCCAGGCCGGGCGCGG - Intronic
913101264 1:115569147-115569169 TAGGGAGGAGAGGCTGGGCACGG + Intergenic
913351612 1:117867396-117867418 AAGGAAATACAGGATGGGCACGG + Exonic
913707142 1:121436567-121436589 TAAGCAGTACAGGCTGGGCACGG + Intergenic
914435208 1:147653417-147653439 TAAAAAATACAGGCCAGGCATGG - Intronic
914867314 1:151442417-151442439 TTAGGGTTACAGGCCGGGCATGG + Intronic
914873215 1:151492706-151492728 TGGGGACTGCAGGCCGGGCGCGG + Intergenic
915221200 1:154376028-154376050 AAAGAAATATAGGCCGGGCACGG - Intergenic
915514274 1:156403708-156403730 AAAGGGATTCAGGCCGGGCACGG - Intergenic
916159877 1:161898836-161898858 TACAGAATACAGGCCTGGCACGG - Intronic
916219319 1:162427985-162428007 TATATAATACAGGCCGGGCATGG + Intergenic
916224606 1:162477022-162477044 AAGTAAAAACAGGCCGGGCATGG + Intergenic
916649863 1:166824643-166824665 AAGGGCATGCAGGCCGGGCACGG - Intergenic
917100828 1:171443405-171443427 TAAGAAATTCAGGCCGGGCATGG - Intergenic
917150999 1:171944662-171944684 TAAGGAATTGAGGCTGGGCATGG - Intronic
917360995 1:174175913-174175935 TAAGTAATACTGGCTGGGCACGG - Intronic
917882821 1:179355821-179355843 CAGGAAACAGAGGCCGGGCACGG - Exonic
918064860 1:181093447-181093469 TAGGGAATAAAGTCTGGGCGCGG + Intergenic
918098734 1:181355295-181355317 CAATGAGTACAGGCCGGGCATGG + Intergenic
918182232 1:182094374-182094396 GAGGAAGTCCAGGCCGGGCACGG + Intergenic
918196361 1:182225925-182225947 TAGGGAGTAGAGGCCAGGCACGG - Intergenic
918210082 1:182342680-182342702 GAGAAAATACAGGCCGGGTATGG + Intergenic
918862336 1:189846773-189846795 TAAGGCATATAGGCCAGGCACGG + Intergenic
918936842 1:190931575-190931597 TAAAGAATTCAGGCCAGGCACGG - Intergenic
918971148 1:191421088-191421110 TAGAGAATGTCGGCCGGGCACGG + Intergenic
919101286 1:193100182-193100204 GAGGCAATTCAGGCCAGGCACGG + Intronic
919530987 1:198719899-198719921 TAAAGAATATGGGCCGGGCACGG - Intronic
919630846 1:199959159-199959181 TAGGGAAAACAGGGCGAACAGGG - Intergenic
919633891 1:199985511-199985533 TAAGGATTACTGGCCAGGCATGG + Intergenic
919647151 1:200106345-200106367 GAGTGAATCTAGGCCGGGCATGG - Intronic
919764436 1:201117143-201117165 AAGTGAAACCAGGCCGGGCATGG + Intronic
919842078 1:201616775-201616797 GAGACAAAACAGGCCGGGCATGG - Intergenic
919891107 1:201975550-201975572 CTGGGATCACAGGCCGGGCATGG + Intergenic
920529126 1:206688922-206688944 GAAGTAATACAGGCCGGGCGCGG - Intronic
920538065 1:206753534-206753556 TAGGAAATCTAAGCCGGGCATGG + Intergenic
920618587 1:207521265-207521287 AAGGCTATACAGGCCTGGCACGG - Intronic
920881813 1:209887659-209887681 TGGGAAGTACAGGCCGGGCGTGG - Intergenic
921026020 1:211282787-211282809 TATGCAATTGAGGCCGGGCACGG - Intronic
921134033 1:212244166-212244188 AAGGAAACACAGGCCGGGCGTGG - Intergenic
921410194 1:214827621-214827643 TAAAGAATACAGGCTGGCCATGG - Intergenic
921876521 1:220202650-220202672 AAGGGAATTCAGGCCGGGCATGG + Intronic
921996811 1:221427857-221427879 AAGAGAAAACAGGCCGGGCATGG - Intergenic
922159826 1:223071228-223071250 AAAGTAATCCAGGCCGGGCATGG + Intergenic
922519026 1:226230535-226230557 TAAGTAAGACAGGCCGGGTATGG + Intergenic
922904365 1:229162629-229162651 TAAGGATTGTAGGCCGGGCACGG + Intergenic
923098741 1:230795631-230795653 TAGGGCTTACAGGGCGGGGAAGG - Intronic
923111098 1:230890823-230890845 TGTGGAAAACAGGCTGGGCATGG + Intergenic
923139890 1:231152126-231152148 AGGGGAATACAGGCAGGCCATGG - Intergenic
923177111 1:231477502-231477524 TATGAGATAGAGGCCGGGCATGG + Intergenic
923186925 1:231582878-231582900 AAGATAGTACAGGCCGGGCATGG - Intronic
923339724 1:232997093-232997115 TAGGGGAAAAAGGCGGGGCAGGG - Intronic
923352182 1:233119267-233119289 TAGGAAAAAAAGGCCAGGCACGG + Intronic
923672095 1:236049747-236049769 TAGGTACTACTGGCCGGGCGTGG + Intronic
923688457 1:236170683-236170705 TTGCATATACAGGCCGGGCACGG + Intronic
924051644 1:240085372-240085394 GAGGGCTTAGAGGCCGGGCACGG + Intronic
924073958 1:240313675-240313697 TAGTGTATACTGCCCGGGCACGG + Intronic
924094522 1:240537499-240537521 AAAGGAGTTCAGGCCGGGCACGG + Intronic
924099930 1:240592841-240592863 TAGGTAATCTTGGCCGGGCACGG + Intronic
924166791 1:241291862-241291884 TTGGGAATTCTGGCTGGGCATGG - Intronic
924363367 1:243264322-243264344 TGGACAATACAGGCCAGGCAGGG + Intronic
924482004 1:244444223-244444245 GATGAAATACAGGCCGGGCGCGG + Intronic
924512886 1:244742352-244742374 GAGAGAAAATAGGCCGGGCATGG + Intergenic
924555770 1:245117342-245117364 GAAGGAAACCAGGCCGGGCACGG - Intronic
1063315850 10:5005390-5005412 CAAGGCATACAGGCCAGGCACGG + Intronic
1063373635 10:5538511-5538533 TAGAAGAAACAGGCCGGGCACGG - Intergenic
1063682937 10:8207733-8207755 AATGGGATACAGGCTGGGCACGG - Intergenic
1063751856 10:8958351-8958373 AAGGGCAAATAGGCCGGGCATGG + Intergenic
1064038057 10:11931858-11931880 TAGCAAGTACAGGCTGGGCACGG + Intronic
1064129432 10:12695786-12695808 AAAGGAATACTGGCCGGGCATGG + Intronic
1064301417 10:14126457-14126479 TGGGCAAGGCAGGCCGGGCACGG - Intronic
1064355169 10:14610051-14610073 TATGGCATCTAGGCCGGGCACGG + Intronic
1064627693 10:17278287-17278309 TCTGGCACACAGGCCGGGCATGG + Intergenic
1064797360 10:19028396-19028418 GAGGGAATGCAGGCTGGGCACGG + Intergenic
1064971064 10:21067688-21067710 AATGGAATACAGGCTAGGCACGG + Intronic
1065007085 10:21389950-21389972 TAGTGTATATAGGCCGGGCGTGG - Intergenic
1065098194 10:22303704-22303726 TAGCAAATCAAGGCCGGGCACGG + Intergenic
1065400564 10:25295701-25295723 AAGGGAAGTCAGGCCGGGCGCGG - Intronic
1065418026 10:25510002-25510024 AAGGCAATATAGGCTGGGCACGG - Intronic
1065635671 10:27730746-27730768 TAGCCAATTGAGGCCGGGCATGG - Intronic
1066365531 10:34772499-34772521 TGAGGAATACACGCCGGGCATGG + Intronic
1066373299 10:34835794-34835816 TGGGGGATATAGGCTGGGCATGG - Intergenic
1066577990 10:36847575-36847597 TAGCGCATATAGGCCGGGCGCGG - Intergenic
1066994894 10:42554404-42554426 AAGGGAATAGAAGCCGGGCGCGG - Intergenic
1067075514 10:43178330-43178352 TACCTAATACAGGCCAGGCACGG + Intronic
1068754100 10:60631236-60631258 TAGTTAATACTGGCCGGGCATGG + Intronic
1069001853 10:63276174-63276196 TAGGCAGTTGAGGCCGGGCACGG + Intronic
1069380103 10:67834536-67834558 TGAGGAATAGAGGCCGGGCGCGG + Intronic
1069839665 10:71331713-71331735 TAGGGGAAACAGGCAGAGCAGGG - Intronic
1070066360 10:73038914-73038936 AAGCAAATAAAGGCCGGGCACGG - Intronic
1070956737 10:80468848-80468870 AAGTGCATTCAGGCCGGGCATGG - Intronic
1071546070 10:86530781-86530803 TAGAGGAAACTGGCCGGGCACGG + Intergenic
1071670728 10:87607039-87607061 TCATGACTACAGGCCGGGCATGG - Intergenic
1071677155 10:87665499-87665521 TGGTAAATTCAGGCCGGGCACGG - Intronic
1071808168 10:89146972-89146994 TTGGAATTATAGGCCGGGCACGG - Intergenic
1071920880 10:90348671-90348693 TAGGGATAACTGGCTGGGCATGG - Intergenic
1072062063 10:91822846-91822868 TATGGTATCCAGGCTGGGCATGG - Intronic
1072097885 10:92200252-92200274 TAGGGCATACAGGCCGGGCACGG + Intronic
1072131481 10:92498463-92498485 AAAAAAATACAGGCCGGGCATGG + Intronic
1072144095 10:92618352-92618374 CAGAGAAAACAGGCCAGGCACGG + Intronic
1072351164 10:94558889-94558911 AAGGGAAAACAGGCTGGGCGTGG - Intronic
1072594407 10:96857891-96857913 TAGGGAATAGGGACTGGGCAGGG - Intronic
1072721683 10:97784812-97784834 AAAGGAAAATAGGCCGGGCATGG + Intergenic
1072730829 10:97845411-97845433 TAAAGAAGGCAGGCCGGGCATGG - Intergenic
1072974727 10:100047693-100047715 AAGAAAAAACAGGCCGGGCATGG + Intronic
1073055281 10:100696169-100696191 AAGAGATTACCGGCCGGGCACGG + Intergenic
1073275235 10:102304481-102304503 TAGGTAAAAGGGGCCGGGCATGG + Intronic
1073560749 10:104494644-104494666 TGGGTACTACAGGCCGGGAAGGG - Intergenic
1074810457 10:117099885-117099907 GAGTAAATACAGGCCAGGCATGG + Intronic
1075028936 10:119007997-119008019 TAAAAAATTCAGGCCGGGCATGG - Intergenic
1075060684 10:119254762-119254784 ATGGAAAAACAGGCCGGGCACGG + Intronic
1075440683 10:122477255-122477277 AAGTAACTACAGGCCGGGCATGG - Intronic
1075843513 10:125525587-125525609 TAGAAAATATTGGCCGGGCATGG - Intergenic
1076473114 10:130734040-130734062 TATGGAAAAGAGGCTGGGCACGG + Intergenic
1077051870 11:570260-570282 CAGGGAAAACAGGCCGGGTGTGG + Intergenic
1077193716 11:1268266-1268288 CAGGGCATGTAGGCCGGGCACGG - Intergenic
1077396358 11:2325188-2325210 TAGGGAAGACAGGCGGGTCCTGG + Intergenic
1077517298 11:3009692-3009714 TAGAGAGCACAGGCCTGGCAAGG - Intronic
1078114011 11:8426576-8426598 TAGAGAAAACAGGCTGGGCATGG - Intronic
1078222486 11:9363567-9363589 AAGAAAATACAGGCCAGGCACGG + Intergenic
1078820003 11:14869154-14869176 TAGGGAAAACTGGCTGGGTATGG - Intronic
1079055268 11:17200913-17200935 TAGGCGATTCAAGCCGGGCACGG + Intronic
1079066534 11:17298987-17299009 AAGGAAAGAGAGGCCGGGCATGG - Intronic
1079068866 11:17325091-17325113 TAGACAATATAGGCCAGGCACGG - Intronic
1079642155 11:22819479-22819501 TAGCCAATGCAGGCCGGGCGCGG + Exonic
1080278254 11:30527218-30527240 TAGAAAATAGAGGCCGGGCGCGG - Intronic
1080375868 11:31710332-31710354 TATGAAATAAGGGCCGGGCATGG + Intronic
1080700526 11:34640369-34640391 TAGGGAGGACAGGCAGGGAAAGG - Intronic
1080803757 11:35633199-35633221 GAGAGAATCCAGGCCAGGCACGG - Intergenic
1080964779 11:37201930-37201952 TAAGATTTACAGGCCGGGCACGG - Intergenic
1081143120 11:39528577-39528599 TATTTAATACAGGCCAGGCATGG + Intergenic
1082815937 11:57509297-57509319 AAGAAAACACAGGCCGGGCATGG + Intronic
1084207128 11:67601794-67601816 TAGGAAATACAGGCCAGGTGCGG - Intergenic
1084272289 11:68035727-68035749 CAGGCAAGGCAGGCCGGGCACGG + Intronic
1084646144 11:70459700-70459722 TAGAAAAAACAGGCCAGGCATGG + Intergenic
1084760769 11:71269206-71269228 TAGGGACAGCAGGCTGGGCACGG + Intergenic
1084907175 11:72357167-72357189 TTGGGGATACAGGCCAGGCCTGG + Intronic
1085000681 11:73031185-73031207 TAGAGAATAAAGGCCGGGCACGG + Intronic
1086054452 11:82630359-82630381 TAAGAAATGCTGGCCGGGCATGG + Intergenic
1086194831 11:84125138-84125160 AAGTGAAAACAGGCCAGGCACGG - Intronic
1086270133 11:85053496-85053518 TAGTGAGTACAGGCCGGGCGTGG + Intronic
1086448816 11:86895768-86895790 AGGTGAATACAGGCCAGGCACGG - Intronic
1087114452 11:94509727-94509749 TAGAAAATTCAGGCCAGGCAAGG - Intergenic
1087790638 11:102403298-102403320 TAAGGAGTATTGGCCGGGCACGG - Intronic
1088332032 11:108664429-108664451 TAGGTAATAGAGGCCGGGCACGG - Intergenic
1088464349 11:110118504-110118526 TAAGAAATACAAGCCGGGCACGG + Intronic
1088568157 11:111195131-111195153 CAGGGTATACAGGACAGGCAGGG - Intergenic
1088598942 11:111458949-111458971 TCGTGCATACTGGCCGGGCACGG + Intergenic
1089071330 11:115701691-115701713 TAGGAAGTGCAGGCTGGGCAGGG - Intergenic
1090030929 11:123205479-123205501 TAAGGAATGCAGGCCGGGCACGG - Intergenic
1090212036 11:124927733-124927755 TAGAAGAAACAGGCCGGGCATGG + Intronic
1090342801 11:126040523-126040545 TAGGTACTAAAGGCCGGGCGCGG + Intronic
1090522960 11:127498406-127498428 TAGGAACTCTAGGCCGGGCACGG - Intergenic
1091423191 12:361482-361504 TGGGGACTACAGGCCGGGCATGG - Intronic
1091933200 12:4414085-4414107 GAGGTAATACAGGCTGGGCATGG - Intergenic
1091983531 12:4886884-4886906 TAGAGGATATAGGCCGGGCGCGG + Intergenic
1092089017 12:5788847-5788869 TATGTAATTCAGGCTGGGCATGG - Intronic
1092113969 12:5985408-5985430 TGGGAAATGCAGGCTGGGCAAGG + Intronic
1092162947 12:6326014-6326036 AAGGTAATGTAGGCCGGGCACGG + Intronic
1092297905 12:7216256-7216278 TAAGGAATTTGGGCCGGGCACGG - Intronic
1092413244 12:8270314-8270336 TAGGAAATAGGGGCAGGGCATGG - Intergenic
1092738698 12:11608428-11608450 TAGCAATTATAGGCCGGGCATGG + Intergenic
1092818769 12:12333956-12333978 TAGGAAATAGAGGCTGGGCACGG + Intronic
1092823045 12:12371582-12371604 TAGAAAATATAGGCCAGGCATGG - Intronic
1092867958 12:12780872-12780894 TATAAAATTCAGGCCGGGCATGG - Intronic
1092885844 12:12923695-12923717 AAGAGAAGAGAGGCCGGGCACGG - Intergenic
1093514585 12:19971465-19971487 TAGGGTATGCAGGCTGGGCAGGG + Intergenic
1093847045 12:23985403-23985425 TAAAAAATACAGGCCAGGCATGG - Intergenic
1094181469 12:27596671-27596693 TAGGGAAAACTAGCCAGGCATGG - Intronic
1094200788 12:27792811-27792833 TAGTGGAACCAGGCCGGGCACGG - Intronic
1094307643 12:29038393-29038415 TAAGAAATTGAGGCCGGGCACGG - Intergenic
1094587200 12:31788453-31788475 TATGTAATGCTGGCCGGGCACGG - Intergenic
1095091504 12:38111675-38111697 AATAGAATACAGGCCGGGCATGG - Intergenic
1095204719 12:39426580-39426602 TTGGAAATTAAGGCCGGGCACGG + Intronic
1095297825 12:40547297-40547319 GAGAAAACACAGGCCGGGCATGG + Intronic
1095379929 12:41578463-41578485 TAAAGAATACTGGCTGGGCATGG - Intergenic
1095619737 12:44237427-44237449 CAGGGACTATAGGCCAGGCATGG + Intronic
1095742154 12:45619187-45619209 TTAAGAATACAGGCCGGGCGCGG - Intergenic
1096248254 12:50008984-50009006 TATAAAATTCAGGCCGGGCACGG + Intronic
1096632430 12:52937078-52937100 AAAGAGATACAGGCCGGGCATGG + Intronic
1096689639 12:53312035-53312057 AAGGGAGGACAGGCCGGGCATGG + Intronic
1096733700 12:53635643-53635665 TAGGCAATTCAGGCTGGGTATGG - Intronic
1096908039 12:54953808-54953830 TAGAGAAGGTAGGCCGGGCACGG - Intronic
1097026997 12:56064163-56064185 TAAAAAATATAGGCCGGGCACGG + Intergenic
1097074870 12:56385449-56385471 GAGTTATTACAGGCCGGGCACGG + Intergenic
1097088079 12:56483979-56484001 TAGGTAAGACTGGCTGGGCATGG + Intronic
1097174483 12:57134993-57135015 AAAGGAAACCAGGCCGGGCATGG - Intronic
1097393940 12:59050599-59050621 AAGAGAAGACAGGCCAGGCATGG - Intergenic
1097698866 12:62800625-62800647 TGGAGATTACAGGCCGGGCACGG - Intronic
1097726218 12:63078539-63078561 ATGGAAATAGAGGCCGGGCATGG + Intergenic
1097862990 12:64536298-64536320 AAGTGAAAACAGGCTGGGCACGG - Intergenic
1097890740 12:64774800-64774822 TATGGAAAGAAGGCCGGGCATGG + Intergenic
1098062239 12:66575060-66575082 GTGGGAATGGAGGCCGGGCACGG - Intronic
1098301566 12:69059778-69059800 TAGAAAAGATAGGCCGGGCACGG + Intergenic
1098348471 12:69531037-69531059 TATGGTAGACAGGCTGGGCATGG + Intronic
1099121941 12:78701093-78701115 AAGGGGATATAGGCCAGGCATGG - Intergenic
1099245641 12:80190495-80190517 GAGTGAATCCAGGCCGGGCGCGG + Intergenic
1100264142 12:92959718-92959740 TATGTAGTAGAGGCCGGGCACGG + Intergenic
1100277233 12:93082272-93082294 TATGGAAAGCAGGCCGGGCGCGG + Intergenic
1100353838 12:93810256-93810278 TAGGGAATTTCGGCTGGGCACGG + Intronic
1100717458 12:97321120-97321142 AAGAGAAAAGAGGCCGGGCACGG - Intergenic
1100963415 12:99987537-99987559 TAGCAAATGTAGGCCGGGCATGG + Intergenic
1101142400 12:101809986-101810008 TAGGGGAAACAGGCCAGGTATGG + Intronic
1101230237 12:102733460-102733482 TTGTACATACAGGCCGGGCATGG + Intergenic
1101425466 12:104584545-104584567 AAGTGAAAACAGGCAGGGCATGG - Intronic
1101541998 12:105673713-105673735 AAGAGAATGCTGGCCGGGCACGG - Intergenic
1102756523 12:115346096-115346118 TAAGGACCAAAGGCCGGGCATGG + Intergenic
1102824332 12:115934920-115934942 TAAAAAATATAGGCCGGGCATGG - Intergenic
1103282757 12:119773716-119773738 CAGCAAACACAGGCCGGGCATGG - Intronic
1103369841 12:120410596-120410618 AAGAAAATACAGGCCGGGCACGG - Intergenic
1103665009 12:122556751-122556773 TAGAGAGTAGAGGTCGGGCACGG - Intronic
1103745885 12:123123319-123123341 TAAGTAATATAGGCCAGGCAAGG + Intronic
1103761457 12:123253326-123253348 TGTGAAATTCAGGCCGGGCATGG - Intronic
1104386731 12:128357404-128357426 GAGGGAGCCCAGGCCGGGCACGG + Intronic
1104437968 12:128771029-128771051 AAGGGAAAAAAGGCCGAGCACGG + Intergenic
1105332465 13:19430834-19430856 TAGGGAAGCTAGGCCGGGCATGG + Intronic
1105526583 13:21183526-21183548 GATGGAGTAAAGGCCGGGCACGG + Intergenic
1105630129 13:22155540-22155562 TATGTAATATTGGCCGGGCACGG + Intergenic
1105734260 13:23251490-23251512 GAAGGAATGCAGGCCAGGCATGG + Intronic
1105879218 13:24588954-24588976 TAGGGAAGGTAGGCCGGGCATGG - Intergenic
1105909873 13:24853202-24853224 AAGGAAATAAGGGCCGGGCATGG - Intronic
1105920618 13:24960104-24960126 TAGGGAAGGTAGGCCGGGCATGG + Intergenic
1106211618 13:27653188-27653210 TGGTAAATACAGGCCGGGCACGG - Intronic
1106259602 13:28054429-28054451 AAAAGAATAAAGGCCGGGCAAGG + Intronic
1106666160 13:31852833-31852855 TAGGGAACTCTGGCCGGGCACGG + Intergenic
1106733833 13:32569226-32569248 AAGGAAATCCAGGCTGGGCACGG - Intergenic
1106941985 13:34789943-34789965 TAGGGTATACTGGCTGGGCTGGG + Intergenic
1107456636 13:40561676-40561698 TATAGAATATAGGCCAGGCATGG + Intronic
1107640739 13:42440796-42440818 TAAGGAAAAGAGGCCGGGCGCGG + Intergenic
1107640788 13:42441114-42441136 AAAAGAATACGGGCCGGGCATGG + Intergenic
1107867051 13:44713265-44713287 TACGGTACACAGGCTGGGCACGG + Intergenic
1108056103 13:46486972-46486994 TTGAACATACAGGCCGGGCATGG + Intergenic
1108617091 13:52144121-52144143 AAGTACATACAGGCCGGGCATGG + Intronic
1108639873 13:52373004-52373026 TATGGAAGACAGGCCAGGCGCGG - Intergenic
1108833386 13:54507493-54507515 AATGCAATAAAGGCCGGGCACGG - Intergenic
1109161185 13:58976864-58976886 AAAGGAAAACAGGCCAGGCACGG + Intergenic
1109217510 13:59606404-59606426 TAAGATATACTGGCCGGGCATGG + Intergenic
1110437160 13:75487927-75487949 TAGAGAGTAGAGGCCAGGCATGG + Intergenic
1110674265 13:78221599-78221621 TGGATAATACTGGCCGGGCACGG + Intergenic
1110703349 13:78575779-78575801 TAAAGAATACTGGCCGGGCGCGG + Intergenic
1111026818 13:82538134-82538156 TAGGGAATCCTGGCCGGGCGCGG - Intergenic
1111243550 13:85507317-85507339 TAGAAAATTCAGGCGGGGCACGG + Intergenic
1111281241 13:86028356-86028378 ATGGGAAGACAGGCCGGGCGCGG + Intergenic
1111714350 13:91860790-91860812 TATGGTATACAGGCCGGGCACGG - Intronic
1111857776 13:93661492-93661514 AAGGTAATACAGGCAGAGCACGG - Intronic
1112071985 13:95863151-95863173 AAAGGAACACAGGCCAGGCATGG - Intronic
1112271520 13:97974598-97974620 TAAGAATTACAGGCCGGGCAAGG - Intronic
1112343116 13:98568574-98568596 TGGGGAATGAAGGCCGGGGATGG + Intronic
1112554357 13:100452911-100452933 AAGGAAATACAGGCCTGGCTCGG + Intronic
1112554585 13:100455018-100455040 CAGGAAATACAGGCCTGGCTTGG + Intronic
1112747271 13:102541000-102541022 TAGAGAATATTGGCCAGGCATGG + Intergenic
1113337827 13:109393797-109393819 TAGGAAATCAAGGCTGGGCATGG - Intergenic
1114955945 14:27819497-27819519 AATGGAATACAGGCCAGGCGTGG + Intergenic
1115487627 14:33927447-33927469 CAGCGTAGACAGGCCGGGCATGG - Intronic
1115524716 14:34268259-34268281 TAGGGAATTCAGGCTGGACATGG + Intronic
1115535021 14:34364710-34364732 AAGGGAAAAAAGGCCGGGCACGG + Intronic
1116596774 14:46858715-46858737 AAGGTATTATAGGCCGGGCACGG - Intronic
1116824969 14:49664056-49664078 TATATAATTCAGGCCGGGCATGG + Intronic
1117366568 14:55035149-55035171 GAGCTAATGCAGGCCGGGCACGG - Intronic
1117376389 14:55121838-55121860 TAGAGGACACAGGCTGGGCACGG - Intergenic
1117388363 14:55239153-55239175 AAGGAGATCCAGGCCGGGCATGG - Intergenic
1117714484 14:58566774-58566796 TAAGAAACAGAGGCCGGGCACGG + Intergenic
1118242213 14:64071202-64071224 TAGGAAATTCAGGCCGAGCGCGG + Intronic
1118280668 14:64425499-64425521 AAGGGAAAACAGGCCGGGCACGG - Intronic
1118431692 14:65725580-65725602 TGGGGAACACAGGCCAGTCAAGG - Intronic
1119067684 14:71546626-71546648 AAATGAATGCAGGCCGGGCACGG - Intronic
1119161611 14:72457571-72457593 TTGAGAATATAGGTCGGGCATGG - Intronic
1119202249 14:72764779-72764801 TCAGGAAAACAGGCCGGGCGCGG - Intronic
1119269676 14:73291666-73291688 AAAGAAATACTGGCCGGGCATGG - Intronic
1119289216 14:73481548-73481570 TAGTAAAAAAAGGCCGGGCATGG + Intronic
1119466834 14:74864851-74864873 AAGCAAATTCAGGCCGGGCAAGG + Intronic
1119480997 14:74957703-74957725 TAATGAATACAGGCTGGGCGCGG - Intergenic
1119830934 14:77702006-77702028 TAGGTACTAGAGGCCGGGCGTGG + Intronic
1119874361 14:78044920-78044942 AATGGAATATTGGCCGGGCATGG + Intergenic
1119986299 14:79142136-79142158 AAGGGCAGACAGGCCAGGCACGG + Intronic
1120419174 14:84261014-84261036 TAGAGAATAGAGGCTGGGCACGG + Intergenic
1120639467 14:86992646-86992668 TTCGGTATACAGGCAGGGCATGG - Intergenic
1121158245 14:91707895-91707917 GTGGAAATACAGGCTGGGCATGG - Intronic
1121209202 14:92194634-92194656 TAATCAGTACAGGCCGGGCACGG + Intergenic
1121537526 14:94701058-94701080 GAGAGAATCCAGGCCAGGCACGG + Intergenic
1122096358 14:99376049-99376071 TAGGAAAGATAGGCCAGGCACGG + Intergenic
1122659098 14:103282488-103282510 TAAAGAATGCAGGCCGGGCGTGG + Intergenic
1122752170 14:103944853-103944875 AAGGGAAAAGAAGCCGGGCACGG - Intronic
1123020235 14:105394500-105394522 TAGGGTGGGCAGGCCGGGCAGGG + Intronic
1123463402 15:20494933-20494955 TGGAGACTACAGGCAGGGCATGG + Intergenic
1123736136 15:23185160-23185182 TGTGGTATATAGGCCGGGCACGG - Intergenic
1123807626 15:23891069-23891091 TAAGAAATATTGGCCGGGCATGG + Intergenic
1123866385 15:24523483-24523505 TAAAGAATTCAGGCCGGGCGCGG + Intergenic
1124072142 15:26405527-26405549 TAGAAAATATTGGCCGGGCACGG + Intergenic
1124295857 15:28503503-28503525 TGTGGTATATAGGCCGGGCACGG + Intergenic
1124805151 15:32874309-32874331 TAGCTAATATAGGCCGGGCTTGG - Intronic
1124813108 15:32961422-32961444 AAAGGATTACAGGCCGGGTACGG - Intronic
1125478813 15:40066098-40066120 TAGGGAATACAGGCCGGGCACGG + Intergenic
1125486538 15:40115167-40115189 TAGGGCTGACGGGCCGGGCATGG + Intergenic
1125582869 15:40799360-40799382 TAGAGGATACAGGCAGGGCATGG - Intronic
1125642448 15:41242651-41242673 TAAGCAAAATAGGCCGGGCATGG + Intronic
1125648460 15:41293183-41293205 AAAGGAGAACAGGCCGGGCACGG - Intergenic
1125705561 15:41732436-41732458 TAAGGATAACAGGCCGGGCACGG - Intronic
1125751022 15:42028695-42028717 AAGAGAGTACAGGCTGGGCACGG - Intronic
1126031823 15:44506703-44506725 TAAAGAGTACAGGCAGGGCACGG - Intronic
1126160791 15:45611725-45611747 AAGGGAATACAGGCCTGGCGCGG + Intronic
1126590076 15:50330192-50330214 TAGGGAATGGTGGCTGGGCATGG - Intronic
1126715010 15:51506357-51506379 TAAGAAATACAGGCTGGGCATGG - Intronic
1127186244 15:56483878-56483900 TTAGAAGTACAGGCCGGGCACGG + Intergenic
1127432361 15:58923064-58923086 CATGGAAAACAGGTCGGGCATGG + Intronic
1127479214 15:59363265-59363287 AAAGTAATACTGGCCGGGCATGG - Intronic
1127484016 15:59402842-59402864 AAAGGAATAGAGGCCGGGCGTGG - Intronic
1128119014 15:65132538-65132560 TACAAAATACAGGCCGGGCGCGG - Intronic
1128131468 15:65229969-65229991 TAAGAAAAACAGGCCAGGCATGG + Intergenic
1128365850 15:67002074-67002096 TATGGGATACAGGCCGGGCGTGG - Intergenic
1128480083 15:68029731-68029753 TAGGGCATTCAGGCTGGGCGTGG + Intergenic
1128504382 15:68256397-68256419 AAGGGAAAAATGGCCGGGCATGG - Intronic
1128562998 15:68680921-68680943 TAGGGAAAAGGGGCCGGGCGCGG + Intronic
1128728651 15:70006221-70006243 TAGGGCACACAGCCAGGGCAAGG + Intergenic
1129181403 15:73879506-73879528 AAGGCAAAACAGGCCAGGCATGG - Intronic
1129432622 15:75511532-75511554 TAGCAAAAACAGGCCAGGCATGG - Intronic
1129435513 15:75537059-75537081 TAGTGATTGCAGGCCAGGCATGG + Intronic
1129453899 15:75666139-75666161 AAGCAAATACAGGCCTGGCACGG + Intergenic
1129506877 15:76088801-76088823 AAGGGAAAAAAGGCGGGGCATGG + Intronic
1129535737 15:76312227-76312249 TAGGGCATACTGGCCGGGCGCGG - Intergenic
1129767877 15:78181781-78181803 AAGGGAAACTAGGCCGGGCACGG - Intronic
1129855736 15:78823550-78823572 AATAGAATACAGGCCAGGCACGG + Intronic
1130027785 15:80284762-80284784 TAGGGAAAACAGGCCGGGCGAGG - Intergenic
1130098648 15:80875323-80875345 TAAGGACTACTGGCTGGGCATGG - Intronic
1130396510 15:83507296-83507318 AAGTGTACACAGGCCGGGCACGG - Intronic
1131087933 15:89593412-89593434 TAGAAAATCCAGGCCCGGCATGG + Intronic
1131170578 15:90175265-90175287 TAGGACAAACAGGCCGGGCACGG - Intronic
1131183203 15:90254541-90254563 TGAGGAATGCAGGCTGGGCACGG + Intronic
1131225088 15:90617819-90617841 GCAGGAATCCAGGCCGGGCACGG - Intronic
1131551833 15:93364014-93364036 TAAGTAATACAGACCGGGCACGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132400764 15:101503499-101503521 CAAAGAATACGGGCCGGGCACGG + Intronic
1132511466 16:344140-344162 AAGGGAAAAAAGGCCGGGCGTGG + Intronic
1132888511 16:2193305-2193327 TAAGAATTTCAGGCCGGGCATGG - Intronic
1132917439 16:2358887-2358909 TAGTGAATGCAGGCCAGGCGCGG - Intergenic
1132920819 16:2391015-2391037 TAGAGAAAAAAGGCCAGGCACGG - Intergenic
1133273172 16:4621064-4621086 AAATGAATCCAGGCCGGGCACGG + Intronic
1133523841 16:6584657-6584679 AAGAAAACACAGGCCGGGCATGG - Intronic
1134006802 16:10823304-10823326 AAGGGAACTCAGGCAGGGCATGG + Intergenic
1134015070 16:10882605-10882627 TACAGATTCCAGGCCGGGCATGG + Intronic
1134076489 16:11295654-11295676 GAGGGAATGAAGGCCAGGCATGG - Intronic
1134116736 16:11554490-11554512 AAGAGAATCCAGGCCGGGCACGG + Intronic
1134358030 16:13502582-13502604 TAGGAAAGACAGGCCGGGCGCGG + Intergenic
1134436144 16:14259490-14259512 CTGGGATTACAGGCAGGGCAAGG - Intronic
1134588048 16:15429068-15429090 AAAGTAATACAGGCCGGGCTTGG + Intronic
1134746929 16:16595670-16595692 AAGGAAAGCCAGGCCGGGCATGG + Intergenic
1134998547 16:18757993-18758015 AAGGAAAGCCAGGCCGGGCATGG - Intergenic
1135000999 16:18776463-18776485 AGGGGGATACAGGCCGGTCATGG + Intergenic
1135099284 16:19592368-19592390 TAGGAAAAACAGGCCAGGCATGG - Intronic
1135337494 16:21615517-21615539 TAGGCACTAGAGGCTGGGCATGG - Intronic
1135341276 16:21650214-21650236 AAAGGAATAGAGGCTGGGCATGG + Intronic
1135406246 16:22200080-22200102 TTTGTAATATAGGCCGGGCACGG + Intergenic
1135750268 16:25052963-25052985 TAGGAAACACAGGCTAGGCATGG - Intergenic
1135751524 16:25062329-25062351 TGGGGACTACAGGCTGGGCGTGG - Intergenic
1135766763 16:25184418-25184440 TAAGAAATCCAGGCCGGGCGTGG - Intergenic
1136038466 16:27559389-27559411 TAGTGATTTCAGGCCAGGCATGG + Intronic
1136456009 16:30379895-30379917 GAAGGAAGGCAGGCCGGGCACGG - Intronic
1136480456 16:30538554-30538576 TAAGAAATACAGGCCGGGCGTGG - Intronic
1137722733 16:50637274-50637296 GAGGTTATACTGGCCGGGCACGG + Exonic
1137807340 16:51319849-51319871 GAGGTAATGCTGGCCGGGCATGG + Intergenic
1137820194 16:51436777-51436799 CAGGGAATACAGTCCCTGCAAGG + Intergenic
1138359912 16:56419311-56419333 TAAGGGGTACAGGCCTGGCATGG - Intronic
1138364723 16:56465288-56465310 ATAGAAATACAGGCCGGGCACGG - Intronic
1138623613 16:58231747-58231769 AAAGAATTACAGGCCGGGCATGG - Intronic
1138789981 16:59892444-59892466 AAGGAAATAGAGGCCAGGCATGG - Intergenic
1138904897 16:61319260-61319282 GAGTGATTAGAGGCCGGGCACGG - Intergenic
1139099332 16:63746299-63746321 TACTAAAAACAGGCCGGGCACGG + Intergenic
1139108918 16:63864647-63864669 AAGGAGATGCAGGCCGGGCACGG + Intergenic
1139477955 16:67212347-67212369 AAGGGAATCCAAGCCAGGCACGG + Intronic
1139619592 16:68126922-68126944 AATTTAATACAGGCCGGGCACGG + Intronic
1139627833 16:68205507-68205529 TAAGAAACACAGGCCAGGCATGG - Intronic
1139773605 16:69298810-69298832 TTGGTAATACTGGCCGGGTACGG - Intronic
1139913250 16:70411702-70411724 TAGTTAATTCAGGCCAGGCACGG + Intronic
1140065860 16:71610680-71610702 TAGCTAATACAGGCCAGGCGCGG + Intergenic
1140114352 16:72028700-72028722 AAGAGAAGGCAGGCCGGGCATGG + Intergenic
1140176016 16:72660848-72660870 TAGGCAAAACAGGTCAGGCATGG + Intergenic
1140466232 16:75185304-75185326 TAGGAAATTCTGGCCGGGCACGG + Intergenic
1140614625 16:76647007-76647029 TAGGGTGTCTAGGCCGGGCATGG - Intergenic
1140736232 16:77900401-77900423 TAGGAAAAAAGGGCCGGGCAAGG + Intronic
1141080968 16:81052087-81052109 TTAGAAATACAGGCTGGGCACGG - Intergenic
1141124549 16:81391866-81391888 AAAGGGCTACAGGCCGGGCATGG - Intergenic
1141637218 16:85320583-85320605 GAGAGGATACAGGCCGGGCGTGG - Intergenic
1142588701 17:990901-990923 TAGAGACTAATGGCCGGGCATGG - Intergenic
1142607387 17:1089667-1089689 AAGGAAATGCAGGCCGGGCGCGG + Intronic
1142656378 17:1397187-1397209 TGGGGAAGAAAGGCCGGGCGGGG - Intronic
1142792102 17:2275129-2275151 TAAAGAATACGAGCCGGGCATGG + Intronic
1142793431 17:2288021-2288043 TGGGTAAGACAGGCAGGGCATGG + Intronic
1143053874 17:4148224-4148246 TAGGAACTGCAGGCTGGGCATGG + Intronic
1143120724 17:4604959-4604981 ATCGGAATACTGGCCGGGCACGG - Intronic
1143227140 17:5315558-5315580 TAGTAAATTCAGGCCGGGCATGG + Intronic
1143505067 17:7359515-7359537 TAGGCAGGACTGGCCGGGCATGG - Intergenic
1143592320 17:7893059-7893081 AAAGAAATACAGGCCAGGCACGG - Intronic
1143657647 17:8305653-8305675 TAAGAAATACAGGCCAGGCGCGG + Intergenic
1143717861 17:8787727-8787749 TAGACAATACAGGCCGGGTGCGG - Intergenic
1143782276 17:9235253-9235275 TAGGGACTGCTGGCTGGGCACGG - Intronic
1144148341 17:12419895-12419917 TAGGGAAACCAGGCAGGGCTTGG - Intergenic
1144314983 17:14051245-14051267 TAAGAAATAAAGGCTGGGCATGG + Intergenic
1144381545 17:14703485-14703507 CTGGGACTACAGGCCAGGCATGG + Intergenic
1144509617 17:15864598-15864620 TAGGGAATGTGGGCTGGGCAGGG + Intergenic
1144548643 17:16220057-16220079 TAAAAAATATAGGCCGGGCATGG + Intronic
1144561207 17:16321528-16321550 TAGAAAATATGGGCCGGGCATGG - Intronic
1144579972 17:16452998-16453020 AAGAGAATAGAGGCCGGGCGCGG + Intronic
1144698944 17:17324163-17324185 TATGGAATCCAGGCCAGGCACGG - Intronic
1144929515 17:18848094-18848116 AATAAAATACAGGCCGGGCACGG - Intronic
1145037094 17:19548775-19548797 AAGAGAATCCTGGCCGGGCATGG - Intronic
1145173728 17:20682241-20682263 TAGGGAATGCGGGCTGGGCAGGG + Intergenic
1145926007 17:28647278-28647300 TTAAGAATTCAGGCCGGGCACGG + Intergenic
1145932299 17:28694707-28694729 AAGGGAAGTCAGGCCAGGCATGG + Intronic
1145950822 17:28815502-28815524 GATGTAATAAAGGCCGGGCACGG - Intronic
1146053610 17:29570194-29570216 TAGGTATTTCAGGCCAGGCATGG - Intronic
1146100264 17:29973764-29973786 AAGGAAATACAGGCCAGGCGCGG - Intronic
1146100712 17:29979059-29979081 TAGGAAATCCTGGCTGGGCACGG + Intronic
1146138419 17:30343619-30343641 GATGGTATACAGGCAGGGCACGG - Intergenic
1146720564 17:35120577-35120599 TAAAAAATAGAGGCCGGGCACGG - Intronic
1146782395 17:35686672-35686694 TAAGAAAAACTGGCCGGGCATGG + Intronic
1146827645 17:36037305-36037327 TAAGAATTATAGGCCGGGCATGG + Intergenic
1146852808 17:36238099-36238121 TATCTAATACAGGCCGGGCACGG + Intronic
1146917694 17:36688665-36688687 AAAGGTAAACAGGCCGGGCATGG - Intergenic
1147011155 17:37449309-37449331 CAGTGAAATCAGGCCGGGCACGG - Intronic
1147071593 17:37962615-37962637 TATCTAATACAGGCCGGGCGCGG + Intergenic
1147083119 17:38042139-38042161 TATCTAATACAGGCCGGGCGCGG + Intronic
1147099062 17:38166112-38166134 TATCTAATACAGGCCGGGCGCGG + Intergenic
1147288881 17:39425483-39425505 TAGGAACTACAGGCCGTGCCTGG - Intronic
1148116625 17:45179153-45179175 ATGGCTATACAGGCCGGGCATGG + Intergenic
1148143829 17:45347257-45347279 TAGAGAGTACTGGCCGGTCATGG + Intergenic
1148154734 17:45416835-45416857 AAATGAATACAGGCCGGGCGCGG - Intronic
1148260137 17:46174944-46174966 TAAGTAATTCAGGCTGGGCATGG - Intronic
1148379599 17:47185471-47185493 TAATGATTACAGGCCGGGCGCGG - Intronic
1148600134 17:48887989-48888011 AATGGAATGCAGGCTGGGCACGG + Intergenic
1149120876 17:53162348-53162370 AATGGAAAAGAGGCCGGGCACGG - Intergenic
1149566953 17:57647136-57647158 TAAGAAATTCAGGCCAGGCACGG + Intronic
1149588567 17:57810675-57810697 TGGGGGATACAGTCCAGGCACGG + Intergenic
1149600569 17:57890628-57890650 GAAGGAATCCAGGCCCGGCAGGG + Intronic
1149724722 17:58881866-58881888 AAAGAAATACAGGCCAGGCATGG + Intronic
1149767465 17:59291247-59291269 TAATTCATACAGGCCGGGCATGG - Intergenic
1150080599 17:62235155-62235177 TATCTAATACAGGCCGGGCGCGG + Intergenic
1150089805 17:62313450-62313472 TAGGCATTAGTGGCCGGGCACGG + Intergenic
1150268949 17:63850056-63850078 TAAGGAACAGCGGCCGGGCATGG + Intergenic
1150320622 17:64211249-64211271 TAAGTAATAGAGGCTGGGCATGG - Intronic
1150554356 17:66240368-66240390 TACAGCATAGAGGCCGGGCACGG + Intronic
1150642820 17:66961110-66961132 CAGTGAATGTAGGCCGGGCACGG + Intergenic
1150924204 17:69515445-69515467 TAGCAAATGCTGGCCGGGCACGG - Intronic
1150959624 17:69899612-69899634 AAGAGAAGACAGGCCAGGCATGG + Intergenic
1151532519 17:74715735-74715757 CAGAGAATTCAGGCCGGGCACGG + Intronic
1151777725 17:76218641-76218663 AAGGAAAAACAGGCCAGGCATGG + Intronic
1151871135 17:76837719-76837741 GAGGAAATTCAGGCCAGGCATGG + Intergenic
1151924421 17:77184074-77184096 TGGGGAAATAAGGCCGGGCATGG - Intronic
1151960136 17:77401453-77401475 AAGGAAATCAAGGCCGGGCACGG + Intronic
1152156996 17:78640963-78640985 AAGGTCATACAGGCCAGGCATGG + Intergenic
1152664783 17:81561245-81561267 AAGGAAATGCAGGTCGGGCATGG - Intronic
1152881497 17:82818774-82818796 AAGTGAAAACAGGCTGGGCACGG + Intronic
1152972201 18:173399-173421 CAGACAATATAGGCCGGGCATGG - Intronic
1153033394 18:735878-735900 TAAAGATTACAGGCCGGGCATGG + Intronic
1153294827 18:3535415-3535437 TAGGGAAAAAGGGCCGGGCGTGG + Intronic
1153549943 18:6252019-6252041 AAAGCAAGACAGGCCGGGCACGG + Intronic
1153882705 18:9434675-9434697 AAGGGGTTACAGGCCGGGCGCGG + Intergenic
1154133771 18:11758880-11758902 TAGGAAAAATAGGCCGGGCATGG + Intronic
1154167910 18:12029709-12029731 TATGGAATGGAGGCCGGGCATGG - Intronic
1154412877 18:14150798-14150820 TAGGCAAGCCAGGCTGGGCAGGG + Intergenic
1154473830 18:14731871-14731893 TAAGAAAATCAGGCCGGGCACGG + Intronic
1154955131 18:21246010-21246032 TAGGCATTATAGGCCAGGCATGG - Intronic
1155046308 18:22106376-22106398 TAGAGAATGTTGGCCGGGCATGG - Intergenic
1155168712 18:23251160-23251182 TATGGCATGTAGGCCGGGCACGG + Intronic
1155296200 18:24386667-24386689 AATGAAGTACAGGCCGGGCATGG + Intronic
1155304728 18:24467832-24467854 AAGTCAATTCAGGCCGGGCACGG - Intronic
1155948767 18:31885566-31885588 TAAGAAATATGGGCCGGGCACGG + Intronic
1155979473 18:32165605-32165627 AGAGGAATCCAGGCCGGGCACGG - Intronic
1157063440 18:44320480-44320502 TAGAGAAAATAGGCCGGGCGTGG - Intergenic
1157123890 18:44937160-44937182 TAGGCACTACTGGCCGGGCGCGG + Intronic
1157226371 18:45868657-45868679 AAGGGAATATAGGCCGGGCGCGG - Intronic
1157260285 18:46171124-46171146 AAAAAAATACAGGCCGGGCACGG - Intergenic
1157460272 18:47885669-47885691 TGAAGAATACAGGCTGGGCATGG + Intronic
1157706292 18:49809947-49809969 TAGGGGAAACGGACCGGGCAAGG + Intronic
1158717551 18:59894215-59894237 TAAGGAATGCAGGCCGGACACGG + Intergenic
1158757569 18:60345049-60345071 TAAGGAATTCTGGCCGGGCATGG - Intergenic
1158763228 18:60415535-60415557 TGAGGAATTGAGGCCGGGCATGG + Intergenic
1158958403 18:62565271-62565293 TAGGGAATACAAACCAGCCATGG + Intronic
1158977648 18:62726872-62726894 TATAAAATACTGGCCGGGCATGG - Intronic
1159030088 18:63221988-63222010 TATAGAAAAGAGGCCGGGCATGG + Intronic
1159055628 18:63460393-63460415 TAGAAAATACAGGCCAGGCATGG - Intergenic
1159250338 18:65867323-65867345 TTTAGAATACAGGCCGGGCACGG - Intronic
1159981232 18:74782891-74782913 TAAGGGAAATAGGCCGGGCACGG - Intronic
1161019075 19:1999374-1999396 GAGGAGAAACAGGCCGGGCACGG + Intronic
1161121840 19:2531523-2531545 TCCGCAATACAGGCCGGGCGCGG + Intronic
1161255300 19:3305453-3305475 TAGGAATTACTGGCCGGGCGCGG + Intergenic
1161385285 19:3988573-3988595 TTGGGAAAACGGGCCGGGCACGG + Intergenic
1161444878 19:4312511-4312533 TAATGAATATAGGCCGGGCGCGG + Intronic
1161645994 19:5453817-5453839 AAGGGAGAAAAGGCCGGGCATGG - Intergenic
1161659162 19:5535453-5535475 GAGAGGATACAGGCTGGGCATGG + Intergenic
1161746811 19:6065354-6065376 TAAGAAAAAAAGGCCGGGCACGG + Intronic
1161969635 19:7570201-7570223 AAGTGAAAACTGGCCGGGCATGG - Intergenic
1162050306 19:8028775-8028797 TAGGGAAAACAGGGCAGGCCTGG + Intronic
1162140415 19:8582177-8582199 AAGTGAAGATAGGCCGGGCATGG + Intronic
1162264528 19:9560161-9560183 TATGTAAAACAGGCCAGGCATGG - Intergenic
1162347946 19:10131780-10131802 TAGGCTACAAAGGCCGGGCACGG + Intergenic
1162433033 19:10640793-10640815 TAGGCTCTAGAGGCCGGGCATGG + Intronic
1162481877 19:10931917-10931939 TAGGGAACGAGGGCCGGGCACGG - Intronic
1162499651 19:11045028-11045050 AAGGGCATACTGGCCGGGCACGG + Intronic
1162649671 19:12078117-12078139 TAGAGAATAACGGCCGGGCACGG - Exonic
1162682357 19:12355675-12355697 AAGAAAATAAAGGCCGGGCACGG + Intronic
1162784169 19:13023861-13023883 TGGGGAATAGGGGCCGGGCTTGG - Intronic
1162904162 19:13813628-13813650 TAGCAAGTACAGGCCAGGCATGG + Intronic
1162914863 19:13869302-13869324 AGGAGAATTCAGGCCGGGCACGG - Intronic
1163119615 19:15209398-15209420 TAGAGAAGACAGGCCAGGCGCGG + Intergenic
1163190709 19:15674807-15674829 TAGGGAAGACAGGCAGGAAAAGG - Intronic
1163495537 19:17644481-17644503 AATGGAATCCAGGCTGGGCATGG - Intronic
1163581228 19:18140107-18140129 TGGCTAAAACAGGCCGGGCACGG - Intronic
1163688773 19:18726954-18726976 AAGGCAAAACAGGCCAGGCACGG + Intronic
1163755341 19:19103383-19103405 AAGAGAAAACAGGCCGGGCGCGG - Intronic
1163957278 19:20655630-20655652 GAGGGAATAGCGGCCAGGCACGG + Intronic
1164119116 19:22249700-22249722 AACTGAATACAGGCCAGGCATGG - Intergenic
1164177373 19:22787191-22787213 CATAGAATACTGGCCGGGCATGG + Intergenic
1164947147 19:32305510-32305532 CAAAGAATATAGGCCGGGCATGG + Intergenic
1165378789 19:35463065-35463087 TCGGGAAGACAGGGCGGGAAGGG - Intergenic
1165414221 19:35681856-35681878 TAAAAAATACAGGCCGGGCGCGG - Intergenic
1165675678 19:37720436-37720458 TGATGAATACAGGCTGGGCACGG + Intergenic
1165690794 19:37861793-37861815 TAATGATTACAGGCCGGGCGCGG + Intergenic
1165747728 19:38240267-38240289 TGGGGAAAATAGGCCAGGCACGG + Intergenic
1165769898 19:38373834-38373856 TTGTGAATACTGGCCAGGCAAGG + Intergenic
1166058629 19:40310244-40310266 AAAGGAATACAGGCCAGCCACGG + Intergenic
1166155188 19:40905840-40905862 TAGAGAATCTAGGCCAGGCATGG - Intergenic
1166292899 19:41874557-41874579 TAAGTAACACAGGCAGGGCAGGG + Intergenic
1166685778 19:44795245-44795267 TTGGGATTGCAGGCCGGGCATGG - Intronic
1166755194 19:45186434-45186456 CTGGGATTACAGGCTGGGCATGG - Intronic
1166869223 19:45861098-45861120 TAAAAAAAACAGGCCGGGCATGG + Intronic
1166908608 19:46134028-46134050 TAGGGTATGCAGGCTGGGCTGGG + Intergenic
1167025339 19:46912332-46912354 AAGAGAACACTGGCCGGGCACGG - Intergenic
1167033350 19:46978252-46978274 TAGGGAAGAGAGGCCAGGAAAGG + Intronic
1167051728 19:47083430-47083452 TAAGAAATACTGCCCGGGCACGG + Intronic
1167115185 19:47484988-47485010 TATGAACTATAGGCCGGGCAAGG - Intergenic
1167187930 19:47960655-47960677 TAGCCAAAACAGGCTGGGCATGG + Intergenic
1167278993 19:48555380-48555402 TAGAGTAGATAGGCCGGGCACGG - Intronic
1167345099 19:48940561-48940583 TAGTGACTTCAGGCTGGGCATGG + Intronic
1167511315 19:49896722-49896744 GAGGGAAAAGAGGCCGGGCGCGG - Intronic
1167625872 19:50588810-50588832 TAGGGAAAGTAGGCCGGGCGCGG + Intergenic
1167627571 19:50602748-50602770 TAGCAAAGACAGGCCGGGCACGG - Intergenic
1167759191 19:51433915-51433937 AAGAAAATACAGGCCGGGCACGG - Intergenic
1167859107 19:52269045-52269067 AAAGCAATAGAGGCCGGGCACGG - Intergenic
1167908476 19:52682134-52682156 TAGTAAAAACAGGCCAGGCACGG - Intronic
1167954298 19:53051794-53051816 TAGTAAATACAGGCTGGGCGTGG + Intergenic
1167995977 19:53402548-53402570 GAGAAAATATAGGCCGGGCACGG - Intronic
1168012116 19:53541394-53541416 GAAGAAATATAGGCCGGGCACGG - Intronic
1168088513 19:54065966-54065988 TAGAAAGTATAGGCCGGGCATGG - Intergenic
1168165965 19:54548069-54548091 AAGTGCAAACAGGCCGGGCACGG - Intergenic
1168224520 19:54984771-54984793 TAGAGAATATAGACCGGGCACGG - Intronic
1168359353 19:55725734-55725756 CAGGGAACCCAGGCCGGGCGCGG + Intronic
1168608874 19:57782967-57782989 TAAGCAGAACAGGCCGGGCACGG - Intronic
925107248 2:1302247-1302269 TAGTAAACACAGGCCGGGCGCGG - Intronic
925890844 2:8433413-8433435 GAGTGAAAACAGGCCAGGCACGG - Intergenic
925967465 2:9079264-9079286 AAGGGAATTGAGGCTGGGCAAGG + Intergenic
925982320 2:9186949-9186971 TATGAAATATAGGCTGGGCACGG + Intergenic
926017945 2:9470921-9470943 AAGTAAATACAGGCTGGGCATGG + Intronic
926716015 2:15924260-15924282 TAAGAAATAAAGGCCGGGCACGG + Intergenic
927264406 2:21128610-21128632 AAAAGAATACAGGCCGGGCATGG - Intronic
927571849 2:24166999-24167021 TTGGGGTTACAGGCCGGGAAAGG + Intronic
927573851 2:24184087-24184109 TATAGTTTACAGGCCGGGCACGG + Intronic
927835849 2:26398333-26398355 AAGCTCATACAGGCCGGGCACGG - Intergenic
928109886 2:28498007-28498029 TTAAGAATAAAGGCCGGGCACGG - Intronic
928131372 2:28653738-28653760 TTAGGCATTCAGGCCGGGCACGG - Intergenic
928605392 2:32941153-32941175 AAGGAATTACAGGCCAGGCACGG - Intergenic
928713026 2:34028845-34028867 TAGGTAATATCGGCCGGGCATGG + Intergenic
928791313 2:34957922-34957944 TACAGAAAACAGGCCGGGCATGG - Intergenic
928823894 2:35395537-35395559 AAGATAATACAGGCCGGGCGCGG + Intergenic
929075935 2:38078685-38078707 AAGGCATCACAGGCCGGGCACGG - Intronic
929137285 2:38637248-38637270 AAGGAAAGAAAGGCCGGGCACGG + Intergenic
929154135 2:38774141-38774163 TAGAAAATCCAGGCCGGGCATGG - Intronic
929480508 2:42302822-42302844 CAGGGAAAAAAGGCTGGGCATGG - Intronic
929696240 2:44118256-44118278 AATGGAAAATAGGCCGGGCACGG - Intergenic
929999638 2:46852283-46852305 TTGGGAGCCCAGGCCGGGCATGG + Intronic
930068303 2:47344723-47344745 TAGGAAATACTGGCTGGGCGTGG - Intergenic
930291460 2:49498497-49498519 TGGGGTGGACAGGCCGGGCACGG - Intergenic
930587009 2:53279099-53279121 TAAGACATACAGGCCAGGCACGG + Intergenic
930671690 2:54158330-54158352 TAAGAAAAGCAGGCCGGGCACGG - Intronic
930777112 2:55184067-55184089 GAGAGAAAACAGGCCGAGCATGG - Intronic
930864719 2:56111176-56111198 TATGGAAGGCAGGCCGGGCGTGG - Intergenic
930888955 2:56360961-56360983 TAGGGAGTAGAGGCCAGGCGTGG + Intronic
930980402 2:57518931-57518953 TAGGCAATGTAGGCTGGGCAGGG + Intergenic
931192456 2:60017828-60017850 TATAGAAAACCGGCCGGGCACGG - Intergenic
931199026 2:60079191-60079213 TAGGGACTACAGTACAGGCAAGG + Intergenic
931277082 2:60753562-60753584 AATAAAATACAGGCCGGGCACGG + Intergenic
931287135 2:60841704-60841726 AAGTGAAAACAGGCCGGGCGCGG + Intergenic
931428830 2:62194385-62194407 TAGGAAGTAGAGGCCGGGCGCGG - Intergenic
931519664 2:63081991-63082013 TAAAAAATACAGGCCGGGCACGG - Intergenic
931531460 2:63219708-63219730 TAGTAAAAACAGGCCGGACACGG + Intronic
931681652 2:64754202-64754224 TAGAAAATATAGGCCGGGCGCGG - Intergenic
931762343 2:65429990-65430012 TTGGGAATACAGGCCTGACCTGG - Intronic
932003901 2:67908882-67908904 TAGTAAATAGAGGCCGAGCACGG + Intergenic
932225904 2:70040543-70040565 TAGCAAATACCGGCTGGGCACGG + Intergenic
932241814 2:70163156-70163178 TAGAAAATTCAGGCCGCGCACGG - Intronic
932328866 2:70885614-70885636 TAGTGTATTTAGGCCGGGCACGG - Intergenic
932393984 2:71425943-71425965 TAAGAAATACAGGCCGGGCGTGG - Intronic
932632853 2:73361338-73361360 AAGAAAAAACAGGCCGGGCATGG - Intergenic
932639667 2:73431109-73431131 TAGTGAATAGAGGCCAGGGATGG - Intronic
932695707 2:73954377-73954399 AAGGCAACTCAGGCCGGGCACGG + Intronic
932842991 2:75101655-75101677 TTGAAAATAAAGGCCGGGCACGG + Intronic
933125028 2:78593748-78593770 TATGGAATTTAGGGCGGGCATGG - Intergenic
933263760 2:80158617-80158639 AATGTCATACAGGCCGGGCATGG + Intronic
933315591 2:80710644-80710666 TAAAGAATCCAGGCCGGGCGCGG + Intergenic
933417769 2:82008748-82008770 TAGGTAATACTGGCTGGGCACGG + Intergenic
933418288 2:82015067-82015089 ATGAGAATTCAGGCCGGGCATGG - Intergenic
933762684 2:85683511-85683533 CAGAGAAAACAGGCCTGGCATGG + Intergenic
934075683 2:88426927-88426949 GATAGAACACAGGCCGGGCATGG + Intergenic
934575620 2:95398994-95399016 AAGGGACTACAGGCCAGGCGTGG - Intergenic
934584923 2:95483526-95483548 CAGGCACTAGAGGCCGGGCACGG + Intergenic
934594530 2:95593194-95593216 CAGGCACTAGAGGCCGGGCACGG - Intronic
934788243 2:97032436-97032458 CATGCAATAGAGGCCGGGCACGG + Intergenic
935012011 2:99144309-99144331 AACGGAACACAGGCCGGGCGCGG - Intronic
935034170 2:99352483-99352505 AAGGCAAGACAGGCTGGGCACGG - Intronic
935295347 2:101644550-101644572 AAGGCAATATAGGCTGGGCACGG + Intergenic
935566887 2:104618703-104618725 TAGGAAACTCAGGCTGGGCACGG + Intergenic
935717257 2:105950231-105950253 TATAGAAAGCAGGCCGGGCATGG + Intergenic
936407867 2:112223849-112223871 TAAGGAATAAAGGCCAGGCACGG + Intronic
936436552 2:112511859-112511881 TAAGAAATACTGGCTGGGCATGG - Intronic
936549233 2:113420999-113421021 AAGAGAAAAGAGGCCGGGCATGG + Intergenic
936704230 2:115052659-115052681 AATGGAAAACAGGCCGGGCGTGG + Intronic
937303976 2:120859941-120859963 AAGGGAGTATTGGCCGGGCATGG - Intronic
937837002 2:126481658-126481680 TAGAAATTGCAGGCCGGGCATGG - Intergenic
937856352 2:126674459-126674481 GGGGGAATACAGGCTCGGCAAGG + Intronic
937941031 2:127286258-127286280 TAAGAATTACTGGCCGGGCACGG + Intronic
938012855 2:127842626-127842648 TACGCAGTGCAGGCCGGGCACGG + Intergenic
938131501 2:128719568-128719590 GAGTGAATGCCGGCCGGGCATGG + Intergenic
938655347 2:133425979-133426001 TAGAAAATGCAGGCCAGGCACGG + Intronic
938778594 2:134563762-134563784 TAGCCAAGACAGGCCAGGCACGG + Intronic
938837497 2:135121800-135121822 AATATAATACAGGCCGGGCACGG + Intronic
939337480 2:140849064-140849086 TAGGGGAGGGAGGCCGGGCATGG + Intronic
939534780 2:143414641-143414663 TATGAAAAACAGGCAGGGCATGG + Intronic
939684022 2:145175166-145175188 AAGAAAATACAGGCCGGGCGCGG - Intergenic
939856305 2:147363018-147363040 TAGGAAACACTGGCCAGGCAAGG + Intergenic
940211300 2:151258850-151258872 TATGGAATGCAGGCCGGGCACGG + Intronic
940312799 2:152296154-152296176 TAGAGATTACTGGCCAGGCATGG + Intergenic
940534995 2:154929979-154930001 AAGGGAAAACAGGCTGGGCGCGG - Intergenic
940653353 2:156459394-156459416 AAGGGAATATAGGCTGGGCGCGG + Intronic
940949338 2:159654682-159654704 AAGAAACTACAGGCCGGGCATGG + Intergenic
941838925 2:170057407-170057429 TAGGAAAAATAGGCCAGGCAAGG - Intronic
941893534 2:170606728-170606750 AATAAAATACAGGCCGGGCACGG + Intronic
942652262 2:178181259-178181281 AAAGGAACAGAGGCCGGGCATGG - Intergenic
943287182 2:186016805-186016827 TAAGGGATTCAGGCCAGGCACGG + Intergenic
943584246 2:189719037-189719059 TAGTGAAAATAGGCCGGGCGCGG - Intronic
943878145 2:193101703-193101725 CACATAATACAGGCCGGGCACGG - Intergenic
943887179 2:193234258-193234280 AAGGCAATTCAGGCCGGGCACGG + Intergenic
945219848 2:207472423-207472445 TAACTAATTCAGGCCGGGCATGG - Intergenic
945236678 2:207637857-207637879 TAGTGGATAGAGGCCGGGCATGG - Intergenic
945248033 2:207738509-207738531 TAAAGAATACTGGCCGGGTATGG - Intronic
945596497 2:211801967-211801989 ACTGGAATACAGGCCGGGCACGG + Intronic
945661083 2:212686031-212686053 TAATGAATATAGGCAGGGCACGG - Intergenic
945670623 2:212798583-212798605 TAAGAAATGCAGGCCGGGCACGG + Intergenic
945944518 2:215982028-215982050 TAAGAAACACTGGCCGGGCACGG + Intronic
946113545 2:217441328-217441350 TAAGAAATACAGGCCGGGCATGG - Intronic
946442904 2:219711975-219711997 GAGGAAATCCAGGCTGGGCACGG + Intergenic
946907879 2:224433342-224433364 TAGGGATGATAGGCCGGGCGCGG - Intergenic
946985815 2:225271805-225271827 TAGAAAATACTGGCTGGGCATGG + Intergenic
947179639 2:227400727-227400749 TAGAGAGTTCGGGCCGGGCATGG - Intergenic
947662746 2:231882218-231882240 TTTGAAATTCAGGCCGGGCATGG - Intergenic
947995005 2:234519834-234519856 AAGAGACTCCAGGCCGGGCACGG - Intergenic
948057957 2:235023254-235023276 ATGGGAATTCAGGCTGGGCACGG + Intronic
948217695 2:236244114-236244136 AAAGAAAAACAGGCCGGGCACGG - Intronic
948968289 2:241402078-241402100 TTGGTAAAATAGGCCGGGCACGG - Intronic
1168815659 20:734913-734935 TAGTGACTCTAGGCCGGGCAGGG + Intergenic
1168988477 20:2072571-2072593 TAGAGAAAAGAGGCTGGGCACGG + Intergenic
1169057703 20:2637096-2637118 AACTGAAAACAGGCCGGGCATGG + Intronic
1169059124 20:2648386-2648408 TAAGATATACAGGCCAGGCATGG + Intergenic
1169256042 20:4099851-4099873 AAGGGAAGAAGGGCCGGGCACGG - Intergenic
1169335791 20:4755483-4755505 AAGGGCATCCAGGCCGGGCGTGG - Intergenic
1169756218 20:9046076-9046098 AAGGGAATTAAGGCCAGGCACGG + Intergenic
1170921799 20:20686253-20686275 TAGGGCTAACAGGCCAGGCATGG + Intronic
1171978369 20:31609678-31609700 AAGTGAACACAGGCCGGGCACGG - Intergenic
1172047810 20:32093233-32093255 AAGATAAAACAGGCCGGGCATGG - Intronic
1172222823 20:33285421-33285443 TAGCTAATACAGGCTGGGCGCGG + Intronic
1172375193 20:34433388-34433410 TAAGAAATCCAGGCAGGGCATGG + Intronic
1172378234 20:34464276-34464298 AAGAAAAAACAGGCCGGGCACGG - Intronic
1172378623 20:34468498-34468520 AAAGAAATACAGGCCGGGCATGG + Intronic
1172669312 20:36623782-36623804 TACAGAATACAGGCCAGGCGTGG - Intronic
1173094618 20:40013251-40013273 GAGGAAATACAGGGAGGGCATGG - Intergenic
1173371513 20:42440765-42440787 TAACTAATACAGGCCGGGCATGG - Intronic
1173621724 20:44442018-44442040 AGGTGAATAGAGGCCGGGCATGG + Intergenic
1173670038 20:44792580-44792602 TAGTAAGTTCAGGCCGGGCACGG - Intronic
1174007725 20:47423910-47423932 TAGGGCCTTCAGGCCTGGCATGG + Intergenic
1174323700 20:49762323-49762345 AAAGGAATAAAGGCCGGGCGCGG + Intergenic
1174464361 20:50705823-50705845 TATGAACTACTGGCCGGGCACGG + Intergenic
1174494568 20:50930770-50930792 TCGGGAAGCCAGGCAGGGCAGGG + Intronic
1174616066 20:51836479-51836501 TAGGGAATCTCGGCCAGGCATGG - Intergenic
1174644619 20:52074857-52074879 TATACAATACAGGCTGGGCACGG - Intronic
1174749346 20:53096431-53096453 AAAACAATACAGGCCGGGCATGG - Intronic
1174918744 20:54679966-54679988 TAGGAAATAGTGGCCGGGCGCGG - Intergenic
1175089729 20:56492427-56492449 TGGGAATTACAGGCCAGGCACGG + Intronic
1175131855 20:56795253-56795275 GAGGGGAAACAGGCTGGGCATGG - Intergenic
1175175088 20:57106673-57106695 AAGGGAATAGATGCTGGGCAGGG + Intergenic
1175269896 20:57726336-57726358 TATGGAATTCAGTCCAGGCACGG + Intergenic
1175435347 20:58943524-58943546 AAGGGAATATTGGCTGGGCAAGG + Intergenic
1175716095 20:61254547-61254569 TGGGGAAGCCAGGCCGGCCAGGG - Intronic
1176740555 21:10597703-10597725 TAGGGAAGCTAGGCCAGGCATGG - Intronic
1176860132 21:14007456-14007478 TAGGCAAGCCAGGCTGGGCAGGG - Intergenic
1176939666 21:14909516-14909538 TAGTAAGTACAGGCCAGGCATGG - Intergenic
1177392250 21:20490970-20490992 TAAGAGAAACAGGCCGGGCACGG - Intergenic
1177494240 21:21868427-21868449 GAAGGCATACTGGCCGGGCACGG - Intergenic
1178318497 21:31586996-31587018 AAGGCAATCAAGGCCGGGCATGG + Intergenic
1178674935 21:34623011-34623033 TATGGCAGATAGGCCGGGCACGG - Intergenic
1178865946 21:36327440-36327462 TAGGAAATAAAGGCCAAGCACGG - Intronic
1178970815 21:37175295-37175317 TAGCATATACAGGCCGGGCACGG + Intronic
1179051666 21:37893494-37893516 TAGGGGGAACAGGCTGGGCACGG - Intronic
1179320029 21:40282295-40282317 TAGGTAATCTAGGCCGGGCGCGG + Intronic
1179326251 21:40348849-40348871 TAAGAGATACAGGCCAGGCATGG + Intronic
1179450602 21:41465946-41465968 TAGGGAGAGCAGGCTGGGCAGGG + Exonic
1179556173 21:42178101-42178123 TAAGAAATTCAGGCCAGGCATGG - Intergenic
1179637939 21:42725527-42725549 TAGAGACCAGAGGCCGGGCATGG - Intronic
1180107211 21:45627520-45627542 TAAGAAATTTAGGCCGGGCATGG + Intergenic
1180213385 21:46309704-46309726 TAGAAAATGCAGGCCAGGCATGG + Intronic
1180673121 22:17568849-17568871 TACTTTATACAGGCCGGGCACGG - Intronic
1180690051 22:17706298-17706320 AAGAGAAAACAGGCTGGGCAAGG - Intronic
1180752879 22:18137336-18137358 TAAAAAATGCAGGCCGGGCACGG + Intronic
1180887280 22:19255617-19255639 AAAAGAATTCAGGCCGGGCATGG + Intronic
1181289855 22:21783460-21783482 TTGGAATTACAGGCTGGGCATGG - Intronic
1181720221 22:24768540-24768562 AAGGGAAAACAGGCCAGGCGTGG - Intronic
1182539771 22:31032527-31032549 AAGGGAGTTGAGGCCGGGCAAGG - Intergenic
1182552941 22:31111109-31111131 TACCTAATACAGGACGGGCATGG + Intronic
1182963555 22:34500044-34500066 TAGTCAATATTGGCCGGGCATGG - Intergenic
1183611429 22:38909340-38909362 AAAGGAATGGAGGCCGGGCATGG - Intergenic
1183766306 22:39879170-39879192 GAAGATATACAGGCCGGGCACGG + Intronic
1183834254 22:40439210-40439232 TAGAGAAGAGAGGCTGGGCATGG + Intronic
1183870612 22:40739203-40739225 GAGGGCATACAGGCCCGGCGCGG + Intergenic
1183937239 22:41270123-41270145 TAGATAAAATAGGCCGGGCACGG - Intronic
1183947736 22:41336235-41336257 TAATCAACACAGGCCGGGCACGG + Intronic
1183981363 22:41542372-41542394 GAAGGAATACAGGCCGGGCGTGG - Intronic
1184359825 22:44008693-44008715 TAGAGATGACAGGCTGGGCATGG + Intronic
1184373112 22:44095216-44095238 TACAGAAAACAGGGCGGGCACGG + Intronic
1184524754 22:45015270-45015292 AAAATAATACAGGCCGGGCACGG - Intergenic
1184572274 22:45333031-45333053 AAGTGAAGACAGGCCGGGCGCGG - Intronic
1184659067 22:45957391-45957413 TACAGAAAACAGGCCGGGCACGG + Intronic
1184825081 22:46944686-46944708 AATGGAGTACAGGCTGGGCACGG - Intronic
1185191473 22:49439410-49439432 AAGGAAACATAGGCCGGGCATGG - Intronic
949108310 3:226735-226757 TAGGTACTACAGGTCGGGCGCGG - Intronic
949166159 3:943887-943909 AAAGGAATGCAGGCTGGGCACGG + Intergenic
949674048 3:6432556-6432578 TAAGGAATGTAGGCTGGGCATGG + Intergenic
949694729 3:6681226-6681248 TACTGAAAACAGGCCGGGCATGG - Intergenic
949735534 3:7167677-7167699 AAAAGAATGCAGGCCGGGCACGG + Intronic
950375999 3:12572873-12572895 TTGGCAAAATAGGCCGGGCATGG - Intronic
950613389 3:14140140-14140162 TTGGGAAAACAGGCCCGGGAAGG + Intronic
950762801 3:15248700-15248722 TAGAGAATACAGCCTGGGCATGG + Intronic
950865637 3:16186973-16186995 TAGTGATTTCAGGCCGGGCGTGG + Intronic
950997058 3:17513041-17513063 AAATCAATACAGGCCGGGCATGG + Intronic
951202784 3:19893229-19893251 TAGAGAATATGGGCTGGGCATGG - Intronic
952281404 3:31926817-31926839 AAGGGAAAGTAGGCCGGGCATGG + Intronic
952436201 3:33275113-33275135 AAAAAAATACAGGCCGGGCAAGG - Intergenic
952474602 3:33694783-33694805 AAGAAAATACAGGCTGGGCATGG + Intronic
952622397 3:35361557-35361579 TAGAGATTTCTGGCCGGGCACGG + Intergenic
952811247 3:37405384-37405406 TAGAAAAAACAGGCTGGGCAAGG - Intronic
952881465 3:37988570-37988592 AAGTGGATACAGGCCGGGCGTGG + Intronic
953029305 3:39168005-39168027 AAGGGGATACAAGCAGGGCATGG - Intergenic
953080649 3:39614241-39614263 TGGCGATTAAAGGCCGGGCACGG + Intergenic
953106268 3:39883154-39883176 TAGGAATTAGAGGCCTGGCAAGG + Intronic
953867659 3:46598256-46598278 CAGGGAAGATAGGCCAGGCACGG + Intronic
953909115 3:46882993-46883015 TAGGGAGTCAGGGCCGGGCAGGG - Intronic
954463057 3:50638599-50638621 CTGGGAATACAGGCAGTGCAAGG - Intronic
955142278 3:56281145-56281167 TATAGAGGACAGGCCGGGCACGG + Intronic
955733890 3:62016454-62016476 TAGTTAATACAGGCCGGGCGCGG - Intronic
956732765 3:72211951-72211973 GAGGGAATACCAGCCAGGCACGG + Intergenic
957239418 3:77639118-77639140 TAGGGGAAAGGGGCCGGGCATGG - Intronic
958018670 3:87971275-87971297 TAGGTAACAATGGCCGGGCATGG + Intergenic
959340605 3:105125225-105125247 TAGAGATTAGAGGCCGGGCACGG + Intergenic
960102055 3:113754231-113754253 TAGGAAAAACAGGCTGGGCATGG + Intronic
960150230 3:114241805-114241827 TGGGGAATACAGGCCTGGATTGG - Intergenic
960306070 3:116062216-116062238 TGTGAAATCCAGGCCGGGCATGG + Intronic
961211641 3:125130292-125130314 AAGTGAATATAGGCCAGGCATGG + Intronic
961467667 3:127091400-127091422 TCGGGAATTCAGACAGGGCAAGG + Intergenic
961616350 3:128184873-128184895 TAAGAAATACAGGTCTGGCATGG + Intronic
961835371 3:129653735-129653757 TAGCAAGAACAGGCCGGGCATGG - Intronic
961960379 3:130848387-130848409 AGAGGAATACAGGCCAGGCATGG - Intergenic
962227350 3:133625253-133625275 TATTGAATAGCGGCCGGGCACGG - Intronic
962533324 3:136303892-136303914 AAGCAAATACAGGCCAGGCACGG - Intronic
962577220 3:136765957-136765979 TAATGAATATAGGCCAGGCATGG + Intergenic
963142785 3:141961531-141961553 CTGAGAATTCAGGCCGGGCACGG - Intronic
963796656 3:149637519-149637541 TACTGAATATGGGCCGGGCACGG - Intronic
963957312 3:151269117-151269139 AAGGAAATACAGGCTGGGCGCGG + Intronic
963981890 3:151547061-151547083 TGGAGAAAAGAGGCCGGGCACGG - Intergenic
964129066 3:153267512-153267534 AAGGTAATTGAGGCCGGGCACGG + Intergenic
964311983 3:155403686-155403708 GAAGGAATACAGGCCAGGCATGG - Intronic
964436729 3:156660970-156660992 TAGATATTAAAGGCCGGGCACGG + Intergenic
964764505 3:160166699-160166721 AATGAAATAAAGGCCGGGCATGG + Intergenic
964826337 3:160832263-160832285 TGGGGAACTCAGGCCAGGCAAGG + Intronic
965527913 3:169740877-169740899 TTATGAATAGAGGCCGGGCATGG + Intergenic
965833863 3:172829604-172829626 GAGGGAATCCTGGCTGGGCACGG + Intergenic
965945769 3:174239357-174239379 TAGGCAATATAGGCCAGGCTCGG - Intronic
965966760 3:174501010-174501032 TATCCAATACAGGCCGGGCATGG - Intronic
966425712 3:179777739-179777761 GAGAGGATACAGGCCAGGCATGG - Intronic
966759255 3:183402151-183402173 GAAAGAATATAGGCCGGGCACGG + Intronic
966800867 3:183762759-183762781 TAGCACATAGAGGCCGGGCATGG + Intronic
966860930 3:184230527-184230549 GGGGCAGTACAGGCCGGGCATGG - Exonic
967049993 3:185774303-185774325 AAGTAAAAACAGGCCGGGCATGG + Intronic
967053627 3:185808183-185808205 TTGCTAATAGAGGCCGGGCATGG + Intronic
967187318 3:186955789-186955811 GAGAGGACACAGGCCGGGCATGG - Intronic
967348952 3:188490652-188490674 TAGGAAAATGAGGCCGGGCATGG - Intronic
967593056 3:191300336-191300358 AAGGGGCTACAGGCCAGGCACGG - Intronic
968004333 3:195229100-195229122 TAAGAGATACAGGCCGGGCGCGG - Intronic
968109151 3:196028886-196028908 TAAAGATTACAGGCCAGGCACGG + Intronic
968115355 3:196085184-196085206 ATGGGAATAAAGGCTGGGCACGG + Intergenic
968178763 3:196574221-196574243 ATGGGAAAATAGGCCGGGCATGG - Intronic
968214691 3:196878880-196878902 AAGGTAATTTAGGCCGGGCATGG - Intronic
968271006 3:197403734-197403756 TAACGAATATGGGCCGGGCATGG - Intergenic
968777009 4:2548359-2548381 TAGGCAAAGTAGGCCGGGCATGG - Intronic
968915347 4:3494835-3494857 TAGGGGAGACAGGCAGGGCAGGG - Intronic
969204312 4:5631369-5631391 AAGGAAATACAGGCCAGGCTTGG - Intronic
969383985 4:6830695-6830717 TAAAGAAAACAGGCCGGGCATGG - Intronic
969400927 4:6954893-6954915 AAGTTAATCCAGGCCGGGCACGG - Intronic
969628735 4:8322919-8322941 TATGGAATGCAGGCCGTACAGGG + Intergenic
969648136 4:8445632-8445654 TATGGAATACAGGGTGGCCAGGG - Intronic
969722944 4:8903191-8903213 TAATAAAGACAGGCCGGGCACGG - Intergenic
970745370 4:19288414-19288436 TAAGGCATCTAGGCCGGGCATGG + Intergenic
971196930 4:24478757-24478779 TAGGGAATTAAGGCCAGGCACGG + Intergenic
971234033 4:24825481-24825503 TTGAAAATACAGGCCGGGCATGG + Intronic
971235613 4:24839467-24839489 TAGAAAGTAAAGGCCGGGCACGG - Intronic
971337368 4:25736117-25736139 TAGAACATACTGGCCGGGCACGG - Intergenic
971407460 4:26335468-26335490 TAATGGATGCAGGCCGGGCACGG - Intronic
971531701 4:27696654-27696676 CAAGAAATAAAGGCCGGGCACGG - Intergenic
971598472 4:28562669-28562691 TGAGTAATACAGGCCGGGCGCGG + Intergenic
971713189 4:30143624-30143646 TAGAAAATATTGGCCGGGCATGG - Intergenic
972092429 4:35304116-35304138 TAAGAAATAAGGGCCGGGCATGG + Intergenic
972261697 4:37415412-37415434 TAGGCAAAAGAGGCCAGGCACGG + Intronic
972491917 4:39595903-39595925 TAGTAATTACAGGCCTGGCATGG - Intronic
972493341 4:39609268-39609290 TGTACAATACAGGCCGGGCACGG - Intronic
972964354 4:44491153-44491175 CAGCAAATACAGGCTGGGCATGG + Intergenic
972979114 4:44674219-44674241 TAGGTAAGACAGGCCGGGCGCGG - Intronic
973221436 4:47731578-47731600 TAGCAAATGCTGGCCGGGCACGG + Intronic
973320523 4:48805971-48805993 TTGGAAAAACAGGCCGGGCATGG + Intronic
973531220 4:51838671-51838693 TAGTGAAATCAGGCTGGGCATGG - Intergenic
974000190 4:56504873-56504895 AGTGAAATACAGGCCGGGCACGG + Intergenic
974052467 4:56953637-56953659 AAGTGAATCCAGGCCGGGCACGG - Intergenic
974090541 4:57306021-57306043 AAAAGAATTCAGGCCGGGCATGG - Intergenic
974465309 4:62248132-62248154 TAGAGAAGACAGGCCAAGCAAGG - Intergenic
974670371 4:65022442-65022464 TAAGATATATAGGCCGGGCACGG + Intergenic
976262586 4:83159904-83159926 TAAAGAAGAGAGGCCGGGCATGG + Intergenic
976306872 4:83568793-83568815 ATGTGAATACAGGCCGGGCGTGG - Intronic
976605466 4:86978470-86978492 AAGTGAATGTAGGCCGGGCATGG - Intronic
977793853 4:101139052-101139074 TAAGGAAACTAGGCCGGGCATGG + Intronic
977940933 4:102857980-102858002 AAGAAAATACAGGCCGGGCACGG - Intronic
978340091 4:107713467-107713489 TATGAAAGACAGGCCAGGCATGG + Intronic
978341961 4:107728601-107728623 TAGAGAACTCAGGCTGGGCACGG + Intergenic
979036485 4:115726101-115726123 TGGTGGATACAGGCCAGGCACGG + Intergenic
979244850 4:118490338-118490360 TAGTCGATACAGGCCAGGCACGG - Intergenic
979476187 4:121160186-121160208 AAGGAATTACAGGCTGGGCACGG + Intronic
979977477 4:127214461-127214483 TAGGGAAAAAAGGAGGGGCATGG + Intergenic
980678022 4:136115567-136115589 TAGGGTTTCTAGGCCGGGCATGG - Intergenic
981600231 4:146480435-146480457 TAGGCAATCCAGGGCTGGCATGG + Intronic
981985919 4:150855633-150855655 TAGGGAGTACAGTTTGGGCAGGG - Intronic
982276618 4:153642216-153642238 GAAGGAAAACAGGCGGGGCAAGG - Intergenic
982615136 4:157632356-157632378 AAGGAAATTTAGGCCGGGCACGG + Intergenic
982649394 4:158067658-158067680 TAGAGATTAGAGGCCGGGTACGG - Intergenic
982777312 4:159455089-159455111 CAAGCAAAACAGGCCGGGCACGG + Intergenic
982793328 4:159617156-159617178 TAAGGTATACAGGCTGGGCTGGG + Intergenic
982885792 4:160781227-160781249 TGGGGAATGCAGGCAGGGCTGGG - Intergenic
983335805 4:166390664-166390686 TTTGGAAAACAGGCCGGGCGCGG + Intergenic
983514355 4:168640916-168640938 TAGAGATTCCAGGCCGGGCACGG + Intronic
983576304 4:169264929-169264951 TAGGGAATGGGGGCTGGGCAGGG - Intronic
984385605 4:179053319-179053341 TAAGGAGTCCTGGCCGGGCATGG + Intergenic
984691458 4:182731213-182731235 TAGGTTATAGAGTCCGGGCACGG + Intronic
985083854 4:186293326-186293348 AAATGAAAACAGGCCGGGCACGG + Intergenic
985316398 4:188662593-188662615 TGAGGGATACAGGCCGGGCATGG - Intergenic
986271347 5:6233490-6233512 GAAAGAAAACAGGCCGGGCATGG - Intergenic
986568092 5:9135469-9135491 TCGGAAAACCAGGCCGGGCACGG - Intronic
986668365 5:10122773-10122795 ATGGAAATACAGGCCTGGCATGG + Intergenic
987133588 5:14881308-14881330 AAGGTAAAGCAGGCCGGGCACGG + Intergenic
987702474 5:21419013-21419035 AAGAGAATATAGGCGGGGCACGG + Intergenic
987704172 5:21442629-21442651 TAGGAAAAACTAGCCGGGCATGG - Intergenic
987952756 5:24696911-24696933 TAGAGAATAAAGGCAGGGCCAGG - Intergenic
988168547 5:27625775-27625797 AAAGGAACACAGGCCAGGCACGG - Intergenic
988281734 5:29157111-29157133 TAGTAAATACAGTCCAGGCAAGG + Intergenic
988898908 5:35710265-35710287 TGGGGAAGACAGGCCAAGCATGG + Intronic
989612531 5:43309213-43309235 GAGGGAATATAGGCAGTGCAAGG - Intronic
990587566 5:57227027-57227049 AAAAGAATACAGGCCGGGCACGG - Intronic
990806574 5:59669400-59669422 GAGGGAACTAAGGCCGGGCACGG - Intronic
991305648 5:65173732-65173754 TATGTAATTCAGGCCAGGCACGG + Intronic
992055702 5:72987164-72987186 TAGTTAAAATAGGCCGGGCACGG - Intronic
992061189 5:73049164-73049186 TAGCAAATTCAGGCCGGGCGCGG - Intronic
992318075 5:75579646-75579668 GAGGGGAAACAGGCCAGGCAAGG - Intronic
992654248 5:78892544-78892566 TAGAGAATGCAGGCTGGGCGTGG - Intronic
992742751 5:79790557-79790579 TGGGGGATACAGGCCGGGTGAGG - Intronic
992802397 5:80305330-80305352 TATGAAATACAGGCCGGGCACGG - Intergenic
992844449 5:80731191-80731213 TGAGGAAGACAGGCCGGACACGG - Intronic
993523029 5:88928245-88928267 AAGTAAATAGAGGCCGGGCACGG - Intergenic
993930023 5:93926421-93926443 TTGGAAATATAGGCCGGGCACGG - Intronic
994384423 5:99113042-99113064 TAGAGACTACAGGCCGGGCGCGG + Intergenic
996138076 5:119869597-119869619 TATCAAATATAGGCCGGGCACGG - Intergenic
996576179 5:124978630-124978652 TATGGAATATAGGTGGGGCACGG + Intergenic
998028238 5:138839489-138839511 AACAGAATACAGGCCAGGCACGG - Intronic
998066819 5:139165951-139165973 TAAGAAATACAGGCCAGGCGTGG - Intronic
998301927 5:141030521-141030543 AATCAAATACAGGCCGGGCACGG - Intergenic
998828727 5:146134656-146134678 TACCAAATACAGGCCAGGCATGG + Intronic
999215273 5:149928524-149928546 TAGCACATACAGGCCGGGCGCGG - Intronic
999264814 5:150259676-150259698 TAAAAAATTCAGGCCGGGCACGG + Intronic
1000094945 5:157963373-157963395 AAAGTAATACAGGCCAGGCATGG - Intergenic
1000350726 5:160350411-160350433 AAAGGAAGGCAGGCCGGGCAAGG + Intronic
1000569395 5:162893872-162893894 CAGGATATACGGGCCGGGCACGG + Intergenic
1000812447 5:165879759-165879781 TAATGAATTCAGGCAGGGCAGGG - Intergenic
1000945081 5:167412368-167412390 TAGGGTTAGCAGGCCGGGCAAGG + Intronic
1001124635 5:169008373-169008395 TAGGGAAGTCAGGCCCGTCATGG - Intronic
1001502712 5:172251022-172251044 TAGCCACTAAAGGCCGGGCACGG + Intronic
1001582277 5:172806936-172806958 TACAGAATACAGGCCGGGCGCGG - Intergenic
1001625781 5:173132018-173132040 TAAAAAATACTGGCCGGGCATGG - Intronic
1002042230 5:176522796-176522818 TAGTGACTATTGGCCGGGCATGG - Intergenic
1002411198 5:179078089-179078111 AAGAGAAGACAGGCCGGGCGCGG - Intronic
1002471142 5:179436882-179436904 TAGGAAGTTGAGGCCGGGCATGG - Intergenic
1002693522 5:181068466-181068488 TAGAAAATACAGGCTGGGCATGG + Intergenic
1002980974 6:2137622-2137644 AAGGGAATATGGGCCGGGCGCGG - Intronic
1002997149 6:2297518-2297540 TAGGGTATACAGGCTGGGCTGGG + Intergenic
1003015729 6:2466020-2466042 AAGATATTACAGGCCGGGCACGG - Intergenic
1003250425 6:4424857-4424879 AAGGGAAAGAAGGCCGGGCACGG + Intergenic
1003391622 6:5718202-5718224 TAGCTGATACTGGCCGGGCATGG - Intronic
1003612726 6:7628195-7628217 TAGACAATTGAGGCCGGGCACGG + Intergenic
1003673021 6:8177352-8177374 TATAGAACACAGGCCAGGCATGG - Intergenic
1004506052 6:16247663-16247685 TAAGAGATACAGGCCGGGCATGG - Intronic
1004789257 6:19005844-19005866 TAGCCAAGATAGGCCGGGCACGG - Intergenic
1004838587 6:19556873-19556895 TGGGATATACAGGCCGGGCGCGG + Intergenic
1005456556 6:26025334-26025356 TAAGAAATATAGGCCCGGCAAGG - Intergenic
1005611236 6:27526900-27526922 TAGAAAAGGCAGGCCGGGCAGGG - Intergenic
1005642795 6:27812860-27812882 TATGGACAACAGGCCGGGCGCGG + Intergenic
1005682392 6:28219440-28219462 TAAGAAATGAAGGCCGGGCATGG + Intergenic
1006010897 6:31042263-31042285 AACAGAAAACAGGCCGGGCACGG - Intergenic
1006099653 6:31678686-31678708 AAGGGAAGAGAGGCTGGGCACGG + Intronic
1006250773 6:32781753-32781775 AAAAGAAAACAGGCCGGGCACGG - Intergenic
1006355027 6:33550712-33550734 TACTGAATATAGGCGGGGCACGG + Intergenic
1007386846 6:41526161-41526183 TGGAAAATACAGGCCAGGCATGG - Intergenic
1007435969 6:41810847-41810869 GAGGAACTACCGGCCGGGCACGG - Intronic
1007466938 6:42059091-42059113 TAGGGACTCAGGGCCGGGCAAGG + Intronic
1007577073 6:42932011-42932033 GACAGAATACAGGCTGGGCACGG - Intronic
1007624788 6:43238835-43238857 AAGCAAAAACAGGCCGGGCATGG - Intergenic
1007683102 6:43647972-43647994 TAGAGAATACAGGATGGGCCGGG + Intronic
1008033396 6:46721336-46721358 AAATGAATGCAGGCCGGGCATGG - Intronic
1008598835 6:53068943-53068965 AAGAGAATACAGTCCAGGCAGGG - Intronic
1008608550 6:53164860-53164882 GAAGACATACAGGCCGGGCATGG + Intergenic
1008798238 6:55332710-55332732 AAGGAAATATAGGCCAGGCACGG - Intronic
1009294745 6:61932508-61932530 GAAGTCATACAGGCCGGGCACGG + Intronic
1009924685 6:70105444-70105466 TAGTGAATACTGGCCAGGCACGG - Intronic
1010241753 6:73622578-73622600 TAGAGAATTCAGGCCGGGCACGG - Intronic
1010519224 6:76811689-76811711 TAAGCAATATAGGCCAGGCACGG - Intergenic
1010699416 6:79024512-79024534 TATGGTATAGAGGCTGGGCACGG + Intronic
1011144728 6:84200986-84201008 TATGCAATGCAGGCCGGGCGCGG + Intronic
1011571706 6:88744548-88744570 TAGTAAGAACAGGCCGGGCACGG - Intronic
1011682886 6:89800135-89800157 AAGGAAAAACAGGCCGGGCACGG + Intronic
1012877517 6:104745729-104745751 TAAGAAATCCTGGCCGGGCACGG - Intronic
1012994518 6:105960138-105960160 TAGTGTGTACAGGCCGGGCGCGG - Intergenic
1013246716 6:108294219-108294241 AAGATAATACAGGCCGGGCTAGG - Intergenic
1013758950 6:113493989-113494011 TAGGAAGGAGAGGCCGGGCAGGG - Intergenic
1013949700 6:115764843-115764865 TAGGCAAAATAGGCCGGGCGCGG + Intergenic
1014436437 6:121426008-121426030 TAGTGAGAACAGGCCGGGCGCGG + Intergenic
1014863717 6:126503486-126503508 AAGAGAAAAGAGGCCGGGCACGG + Intergenic
1016211753 6:141544458-141544480 TGGGGAAAACAGGAGGGGCAGGG + Intergenic
1017125498 6:151060560-151060582 TAGGGAAGTCAGGCCAGGAATGG + Intronic
1017454404 6:154587535-154587557 AAGGGGATACAGGCTGGGCACGG + Intergenic
1017721287 6:157245024-157245046 TAAGGATTAGAGGTCGGGCAAGG + Intergenic
1017796793 6:157851877-157851899 AAGGACAAACAGGCCGGGCACGG - Intronic
1018051357 6:160011696-160011718 GAGGGAATCCAGGCTGGGGAAGG - Intronic
1018408983 6:163521809-163521831 TAAAAAATACAGGCCTGGCATGG - Intronic
1018515892 6:164579775-164579797 GAGGAAAAGCAGGCCGGGCATGG - Intergenic
1019366032 7:633471-633493 AAAGTAATACAGGCTGGGCATGG + Intronic
1019375247 7:687803-687825 AAGGCATTACCGGCCGGGCATGG + Intronic
1019674990 7:2305652-2305674 AATACAATACAGGCCGGGCATGG - Intronic
1019680173 7:2343383-2343405 GAGCTCATACAGGCCGGGCATGG + Intronic
1020030650 7:4930347-4930369 AAGACAAAACAGGCCGGGCATGG + Intronic
1020101431 7:5396372-5396394 TAATGACAACAGGCCGGGCAAGG + Intronic
1020196801 7:6046611-6046633 TAATGAAAACAGGCCGAGCACGG + Intronic
1020233282 7:6336388-6336410 AAAAGAATACAGGCCAGGCACGG + Intronic
1020281219 7:6651057-6651079 TAGAGCTGACAGGCCGGGCACGG + Intronic
1020285502 7:6676603-6676625 TAGAAAATACTGGCCGGGCATGG + Intergenic
1020801097 7:12733204-12733226 TAGGGAAAATAGGCCGGGCGCGG - Intergenic
1021107518 7:16654827-16654849 TATAGTATACAGGCTGGGCACGG - Intronic
1021221033 7:17975594-17975616 TAGGGAAGTAAGGCCGGGCATGG + Intergenic
1021469440 7:20984870-20984892 AAGGGGAAAGAGGCCGGGCACGG + Intergenic
1021571717 7:22072731-22072753 AAAGTAATACAGGCTGGGCATGG + Intergenic
1022006582 7:26271352-26271374 TAAGAAATACTGGCCGGGCATGG - Intergenic
1022046972 7:26629398-26629420 TGGAGAACACAGGCCGGGCGTGG - Intergenic
1022345008 7:29506164-29506186 TAAGAAATATAGGCCAGGCACGG + Intronic
1022726712 7:32987887-32987909 TAGAGTGTACAGGCTGGGCACGG + Intronic
1022978363 7:35578941-35578963 TTAGAAATAAAGGCCGGGCATGG + Intergenic
1023304744 7:38814359-38814381 TAAAGAACACAGGCCGGGCGTGG + Intronic
1024004315 7:45214196-45214218 TAGGGACTATGGGCCAGGCATGG - Intergenic
1025046876 7:55699746-55699768 TAGAGTGTACAGGCTGGGCACGG - Intergenic
1025138544 7:56442135-56442157 TAGAAAATATAGGCTGGGCATGG + Intergenic
1025802377 7:64798499-64798521 TAGGGAATTCTGGCCGGGCATGG + Intronic
1025860620 7:65323721-65323743 TAGGTAAAGGAGGCCGGGCACGG - Intergenic
1025993449 7:66513103-66513125 TAAGTAATATAGGCAGGGCAAGG + Intergenic
1026025099 7:66738307-66738329 TAGAGAGGACTGGCCGGGCATGG - Intronic
1026170913 7:67953210-67953232 TAGGGAAGTAGGGCCGGGCACGG + Intergenic
1026249910 7:68660641-68660663 GAAAAAATACAGGCCGGGCACGG + Intergenic
1026253427 7:68690610-68690632 GAGGGAATTTTGGCCGGGCATGG + Intergenic
1026292658 7:69022189-69022211 AATGGAATACAGGCCGGGCACGG - Intergenic
1026468064 7:70671509-70671531 TAGGCACTACAGGCCAAGCAAGG + Intronic
1026531081 7:71197905-71197927 AAGGGGATGCAGGCCAGGCACGG + Intronic
1026687625 7:72524886-72524908 TAAAGAATATAGGCCGGGCATGG - Intergenic
1026722847 7:72846730-72846752 TAAAGAATATAGGCCGGGCATGG - Intergenic
1027145968 7:75694798-75694820 GAAGCAATCCAGGCCGGGCATGG - Intronic
1027216583 7:76187656-76187678 TATGAATTACAGGCCAGGCACGG + Intergenic
1027221837 7:76219136-76219158 AAAGCAATACAGGCCGGGTATGG - Intronic
1027253852 7:76417347-76417369 TAGGGATATGAGGCCGGGCACGG - Intronic
1027537124 7:79417020-79417042 TAGAAAGAACAGGCCGGGCATGG - Intronic
1028332768 7:89616956-89616978 TAAGAAATAGGGGCCGGGCATGG + Intergenic
1028712762 7:93928651-93928673 TAGAAAAATCAGGCCGGGCAGGG + Intergenic
1028746171 7:94329021-94329043 AAAGAAATACAGGCCGGGCGCGG + Intergenic
1029224851 7:99018163-99018185 TATAGAAGACGGGCCGGGCATGG - Intergenic
1029434002 7:100551591-100551613 TTGGGAAAATAGGCCAGGCAAGG + Intronic
1029581843 7:101441606-101441628 TAGGTATGATAGGCCGGGCACGG - Intronic
1029584978 7:101464699-101464721 TAAGAATTAGAGGCCGGGCACGG - Intronic
1029662010 7:101968711-101968733 TAGGCTCTTCAGGCCGGGCATGG - Intronic
1029724547 7:102393756-102393778 TAGGGTATGCAGGCTGGGCTGGG - Intronic
1030069687 7:105688188-105688210 TAGGGTATGCAGGCTGGGCTGGG - Intronic
1030291185 7:107873797-107873819 AAGGAAAGATAGGCCGGGCATGG - Intergenic
1030313253 7:108088989-108089011 TATGGAATACAGGCCATACAGGG + Intronic
1030609001 7:111668608-111668630 CTGGGATTACAGGCCGGGCACGG + Intergenic
1030861979 7:114643099-114643121 TAAAGAATATAGGCCGGGCACGG - Intronic
1031028858 7:116713103-116713125 TAAGGAAAAGAGGCCGGGCGCGG + Intronic
1031407710 7:121406196-121406218 TATGGAAAACCGGCCAGGCACGG + Intergenic
1032144176 7:129363938-129363960 TAGAGAAAATAGGCTGGGCACGG + Intronic
1032233604 7:130099862-130099884 TGGAGAATAGGGGCCGGGCATGG + Intronic
1032413167 7:131714889-131714911 CAGAGAATTCAGGCCAGGCATGG - Intergenic
1032490853 7:132323144-132323166 AAGGGAAGACAGGCTGGACAAGG - Intronic
1032527053 7:132586458-132586480 TATGGCACTCAGGCCGGGCATGG + Intronic
1033112671 7:138595895-138595917 TAGGCAAACTAGGCCGGGCACGG + Intronic
1033298031 7:140159053-140159075 TAAAGGATACAGGCCGGGCTTGG + Intronic
1033865819 7:145689184-145689206 ATGTGAATACTGGCCGGGCACGG + Intergenic
1034672080 7:152866660-152866682 AAGGGAAGGGAGGCCGGGCACGG - Intergenic
1034995283 7:155573070-155573092 GTGGGAAGACTGGCCGGGCATGG + Intergenic
1035424193 7:158756616-158756638 AAGGGATAATAGGCCGGGCATGG + Intronic
1035781749 8:2233343-2233365 CAGAGCACACAGGCCGGGCACGG + Intergenic
1035781765 8:2233435-2233457 CAGAGCACACAGGCCGGGCACGG + Intergenic
1036141687 8:6215042-6215064 TAAGGACTGCAGGCCGGGCGCGG + Intergenic
1036157054 8:6352213-6352235 TACAAAGTACAGGCCGGGCACGG + Intergenic
1036401808 8:8415517-8415539 TAAGGTAACCAGGCCGGGCAAGG - Intergenic
1037015941 8:13906044-13906066 GAAGAAATATAGGCCGGGCACGG - Intergenic
1037454926 8:19053506-19053528 GAGGGAACACAGGCCGGGTGTGG + Intronic
1037610694 8:20473715-20473737 AAGGGACTCCAGGCCGGGCATGG + Intergenic
1037816332 8:22114668-22114690 AAGGGCAGACAGGCGGGGCAAGG + Exonic
1037830659 8:22186752-22186774 TTGGGGAAACAGGCCAGGCATGG - Intronic
1037909708 8:22737001-22737023 AAGCAAATAAAGGCCGGGCATGG + Intronic
1038367981 8:26956504-26956526 TAGGCAAGGCTGGCCGGGCATGG + Intergenic
1038604155 8:28981945-28981967 TACTGAATACTGGCCGGGCGTGG + Intronic
1038726168 8:30084242-30084264 TAGGGTTTCCAGGCCGGGCGTGG + Intergenic
1038891054 8:31724094-31724116 TAGGTAATATTAGCCGGGCATGG + Intronic
1038897781 8:31805536-31805558 AAGTGAATACCGGCCGGGCGCGG + Intronic
1039001387 8:32984435-32984457 AAGGGATTTTAGGCCGGGCACGG + Intergenic
1039065415 8:33603354-33603376 GAGTGGATCCAGGCCGGGCACGG - Intergenic
1039549813 8:38435158-38435180 GAAGCAATACAGGCCAGGCACGG - Intronic
1040480144 8:47818288-47818310 TAGGTAATATTGGCCAGGCACGG + Intronic
1040500690 8:48002495-48002517 TAAGGAATGGAGGCCAGGCATGG + Intergenic
1040930239 8:52726650-52726672 AAGTGAAAAGAGGCCGGGCATGG + Intronic
1041044440 8:53877913-53877935 GAAAGAATACAGGCCGGGCCTGG + Intronic
1041067456 8:54095859-54095881 TCAAGAATACAGGCCGGGTATGG - Intronic
1041079695 8:54204446-54204468 TGGGTAAGACGGGCCGGGCATGG - Intergenic
1041107269 8:54455316-54455338 TAGGGAAACCCGGCCGGGCGCGG + Intergenic
1041110579 8:54478827-54478849 AAAGGAAGACAGGCTGGGCATGG - Intergenic
1041501638 8:58545157-58545179 TTAGCAATAGAGGCCGGGCACGG + Intergenic
1042522325 8:69726789-69726811 TAGGAGGTAGAGGCCGGGCATGG - Intronic
1042870289 8:73391974-73391996 GAGGTAATGAAGGCCGGGCATGG + Intergenic
1043283851 8:78504293-78504315 TAGTAATTACAGGCTGGGCATGG - Intergenic
1043415279 8:80041797-80041819 AAGGTAATACAGGCCAGGCATGG + Intronic
1044066014 8:87701241-87701263 TAAAAAATACAGGCCAGGCATGG + Intergenic
1044177369 8:89144659-89144681 AAGGTAACACAGGCCGGGCGTGG - Intergenic
1044436689 8:92172536-92172558 TTAGGAAGCCAGGCCGGGCACGG + Intergenic
1044591373 8:93917071-93917093 TAGGGAATACGAACCGGGCACGG - Exonic
1044651210 8:94497690-94497712 TAAGAAAAATAGGCCGGGCATGG - Intronic
1044663508 8:94613656-94613678 AATGGAATACTGGCCGGGCACGG + Intergenic
1044678656 8:94755076-94755098 TAGGAATGTCAGGCCGGGCACGG - Intronic
1044844084 8:96363171-96363193 AAGTGAAAACAGGCCAGGCATGG - Intergenic
1044886853 8:96788448-96788470 AATGGAGTCCAGGCCGGGCATGG - Intronic
1044935182 8:97287054-97287076 TTAAGAAAACAGGCCGGGCATGG - Intergenic
1045096496 8:98803299-98803321 TAGTAAAAACAGGCCAGGCATGG + Intronic
1045119081 8:99015611-99015633 TAAGTACTCCAGGCCGGGCACGG + Intronic
1045158107 8:99502272-99502294 AAAGCAATCCAGGCCGGGCATGG - Intronic
1045291966 8:100841386-100841408 TAGAAAGTAAAGGCCGGGCACGG - Intergenic
1046242314 8:111512347-111512369 AACTAAATACAGGCCGGGCACGG + Intergenic
1046746404 8:117880879-117880901 GAGTCAAAACAGGCCGGGCACGG - Intronic
1046921854 8:119739174-119739196 TGGAGAAGAGAGGCCGGGCAAGG - Intronic
1046927786 8:119811514-119811536 TAACCAAAACAGGCCGGGCACGG + Intronic
1047006021 8:120621248-120621270 GAGGGAATAAAGGCCGGGCATGG - Intronic
1047082787 8:121482096-121482118 AAGGGAATTTAGGCCGGGCGCGG - Intergenic
1047136560 8:122085483-122085505 TAGCACATACAGGCCGGGCATGG + Intergenic
1047284336 8:123473579-123473601 TCAAAAATACAGGCCGGGCATGG - Intergenic
1048024980 8:130578007-130578029 TTGGGATTACAGGCCGGGCGCGG - Intergenic
1048676607 8:136790559-136790581 TAGGAAATACAGGCACAGCATGG + Intergenic
1049549598 8:143250999-143251021 TGGGGCACAGAGGCCGGGCAGGG - Exonic
1049737242 8:144215579-144215601 AATGAAACACAGGCCGGGCATGG + Intronic
1049903707 9:195848-195870 AAGAGAAAAGAGGCCGGGCATGG - Intergenic
1050210624 9:3251623-3251645 TGGTAAATACAGGCCAGGCATGG - Intronic
1050238252 9:3605845-3605867 CAAGAAATAGAGGCCGGGCAAGG - Intergenic
1050365727 9:4871889-4871911 GAGAAAATACAGGCCAGGCATGG - Intronic
1050520908 9:6498736-6498758 TAGGGTATACAGGCAGTGAAGGG - Intronic
1050591839 9:7168772-7168794 AAGAGTAAACAGGCCGGGCATGG + Intergenic
1051676849 9:19567254-19567276 TAAGGAATATGGGCCGGGCACGG + Intronic
1051924348 9:22305670-22305692 TAAGAATTACAAGCCGGGCACGG + Intergenic
1052536685 9:29756417-29756439 GAGGGCATTCAGGCTGGGCATGG - Intergenic
1052564119 9:30124833-30124855 TAGGGAAAACAGGCAGGGGTAGG + Intergenic
1052574661 9:30277196-30277218 TCTGAAATACAGGCAGGGCATGG + Intergenic
1052617758 9:30864366-30864388 TAGAGAAAACTGGCCAGGCATGG - Intergenic
1052682834 9:31716285-31716307 TGTGGAATAGAGGCCTGGCATGG + Intergenic
1052758897 9:32569506-32569528 AAGAAAAAACAGGCCGGGCACGG - Intronic
1052806213 9:33015645-33015667 AAGAAAATACAGGCCGGGCGTGG - Intronic
1052936496 9:34097640-34097662 TAAAGAATACTGGCCAGGCATGG + Intronic
1053145585 9:35709920-35709942 TAGTGATTACAGGCCAGGCGCGG + Intronic
1053324524 9:37131353-37131375 AAAAAAATACAGGCCGGGCATGG + Intronic
1053376226 9:37608998-37609020 TAGGCATCTCAGGCCGGGCATGG + Intronic
1053495368 9:38545067-38545089 GAGGGAGTACAGGGCTGGCAGGG + Intronic
1053527856 9:38847685-38847707 AAGGAAAGACAGGCCGGGCGTGG - Intergenic
1053544996 9:39013752-39013774 TAAGGTATACAGGCCTGGCGCGG - Intergenic
1053746713 9:41206152-41206174 AAGAGAAAAGAGGCCGGGCATGG - Intergenic
1053752008 9:41266594-41266616 GAGGGAACACAGGCCAGGCCAGG - Intergenic
1054200078 9:62072121-62072143 AAGGAAAGACAGGCCGGGCGTGG - Intergenic
1054257529 9:62830924-62830946 GAGGGAACACAGGCCAGGCCAGG - Intergenic
1054333784 9:63784798-63784820 GAGGGAACACAGGCCAGGCCAGG + Intergenic
1054638277 9:67516239-67516261 AAGGAAAGACAGGCCGGGCGTGG + Intergenic
1054681632 9:68225130-68225152 AAGAGAAAAGAGGCCGGGCATGG + Intergenic
1055537215 9:77261187-77261209 AAAAGAATACAGGCCGGGCACGG - Intronic
1056218560 9:84428880-84428902 AAGCTAATAGAGGCCGGGCACGG - Intergenic
1056250526 9:84743089-84743111 AAGCTAATATAGGCCGGGCATGG - Intronic
1056383462 9:86076573-86076595 TAAGAAAACCAGGCCGGGCACGG + Intronic
1056403221 9:86248422-86248444 TAGAAAAAACAGGCTGGGCACGG - Intronic
1056428710 9:86505396-86505418 TATAGTTTACAGGCCGGGCACGG + Intergenic
1056903194 9:90620464-90620486 AAAGCAATACAGGCTGGGCACGG + Intronic
1056948715 9:91024687-91024709 TGGGGCATCCAGGCAGGGCATGG + Intergenic
1057041537 9:91851684-91851706 TAGGGTTTTCTGGCCGGGCATGG + Intronic
1057053185 9:91941285-91941307 TAAAGAATTAAGGCCGGGCACGG - Intronic
1057165823 9:92924587-92924609 TAAGAAATTGAGGCCGGGCACGG - Intergenic
1057351932 9:94305907-94305929 TAGTGACTCCAGGCCAGGCATGG + Intergenic
1057382351 9:94580505-94580527 AAGGCAATCCAGGCTGGGCATGG - Intronic
1057395492 9:94676326-94676348 TAATGAATGCAGGCAGGGCATGG - Intergenic
1057836986 9:98453314-98453336 AAGGGCATAGAGGCCGGGCATGG - Intronic
1057840341 9:98481148-98481170 TAGAGAATCCAGGCTGGGCTGGG - Intronic
1058042024 9:100313222-100313244 TAAGAAATAGTGGCCGGGCATGG + Intronic
1058421185 9:104834956-104834978 GAGGGAAGAAAGGCCGGGCGCGG + Intronic
1058701457 9:107604061-107604083 TAGGAAATTTAGGCCAGGCATGG - Intergenic
1058870625 9:109198614-109198636 TGGGAACTACAAGCCGGGCACGG + Intronic
1059347538 9:113639829-113639851 AAGAGAAAAAAGGCCGGGCACGG + Intergenic
1060046576 9:120346265-120346287 TAGGGAATATGGGGCGGGGAGGG + Intergenic
1060197082 9:121630896-121630918 TACATAAAACAGGCCGGGCATGG - Intronic
1060942685 9:127552090-127552112 TGGGGAAGACAGGCCCAGCATGG - Intronic
1060972404 9:127745783-127745805 TTGCTAATTCAGGCCGGGCATGG - Intronic
1061097775 9:128469702-128469724 TAACAAAAACAGGCCGGGCATGG + Intronic
1061365396 9:130170308-130170330 GAGGGAAGGCAGGCCAGGCATGG - Intergenic
1061484231 9:130912144-130912166 GAGGAATTCCAGGCCGGGCATGG + Intronic
1061514991 9:131084171-131084193 AACTGAATACAGGCCAGGCACGG - Intronic
1062471488 9:136707625-136707647 TAGTGAATCCAGGTCGGGCGAGG + Intergenic
1062648478 9:137563240-137563262 AGAGGAATACAGGCCAGGCACGG + Intronic
1202782843 9_KI270718v1_random:16931-16953 AAGAGAAAAGAGGCCGGGCATGG - Intergenic
1185446424 X:260204-260226 TAGTTAATTCTGGCCGGGCACGG + Intergenic
1185879614 X:3729475-3729497 GATGGAATTGAGGCCGGGCACGG + Intergenic
1186141521 X:6579370-6579392 TATAAAGTACAGGCCGGGCATGG - Intergenic
1186399152 X:9240924-9240946 TAAAGAATGCAGGCCGGGCATGG - Intergenic
1186734715 X:12449695-12449717 TAGGCAGTTCAGGCCAGGCAGGG + Intronic
1186758223 X:12695691-12695713 TAAGAGTTACAGGCCGGGCACGG - Intronic
1186993923 X:15099792-15099814 AAAAGAATACAGGCTGGGCATGG + Intergenic
1187417002 X:19102203-19102225 GAGGGAGTCCAGGCCGGGCGTGG - Intronic
1187525412 X:20049560-20049582 AAAGAAATACAGGCCAGGCATGG - Intronic
1187865345 X:23718613-23718635 TAGGCAGAACAGGCCGGGCACGG + Intronic
1187879802 X:23836287-23836309 AAGGAAATTAAGGCCGGGCATGG - Intronic
1188007652 X:25027429-25027451 AAGGTAATCCTGGCCGGGCACGG + Intergenic
1188343010 X:29028574-29028596 TAGGGCACAAAGGCCTGGCACGG - Intronic
1188345343 X:29057717-29057739 TAGGCTAAACAGGCCGCGCACGG - Intronic
1188920731 X:35973477-35973499 TTGGGCAAAGAGGCCGGGCACGG - Intronic
1189407478 X:40737652-40737674 AATGAAATTCAGGCCGGGCATGG - Intergenic
1189495824 X:41507914-41507936 ATGGGACTTCAGGCCGGGCACGG - Intergenic
1190042101 X:47079719-47079741 AAAGAAACACAGGCCGGGCATGG - Intronic
1190121265 X:47661144-47661166 GAGTGAATCCAGGCCGGGCATGG - Intergenic
1190229089 X:48567893-48567915 TAGTGAATGCAGGCCGGGTGTGG + Intergenic
1190307761 X:49095348-49095370 CAGAAAATACAGGCTGGGCACGG + Intronic
1190536624 X:51434846-51434868 AGGGCAACACAGGCCGGGCACGG - Intergenic
1190558173 X:51658795-51658817 TAAAAAATAGAGGCCGGGCACGG - Intergenic
1190974201 X:55384038-55384060 TAGGGAAAAAAGGCCAGGCATGG + Intergenic
1191093009 X:56643849-56643871 TAGTTAATTCAGGCTGGGCACGG - Intergenic
1191775168 X:64805966-64805988 TATGGAAGACAGGCTGGGCCAGG + Intergenic
1192213627 X:69143050-69143072 GAGGCAATGCAGGCCGGGCGGGG + Intergenic
1192272345 X:69593796-69593818 TAGAGAGCCCAGGCCGGGCACGG + Intergenic
1192470919 X:71398047-71398069 TAGAGATTACTGGCCGGGCGCGG + Intronic
1192489448 X:71562171-71562193 TCTGAAATACAGGCCGGGTATGG + Intronic
1192775995 X:74245603-74245625 TAGGGAAAACTGGTCGGGCTCGG + Intergenic
1193116181 X:77777844-77777866 TAGGTAATACTGGCCAGGCGCGG + Intronic
1193117674 X:77791155-77791177 AAGGAAATTAAGGCCGGGCATGG + Intergenic
1193150343 X:78118289-78118311 AAGGAACTACAGGCTGGGCATGG + Intronic
1193369121 X:80672316-80672338 AAGGGTATATAGGCCGGGCACGG + Exonic
1193762173 X:85480649-85480671 TAGCCAAAATAGGCCGGGCACGG + Intergenic
1194113293 X:89865805-89865827 AAATGAATGCAGGCCGGGCACGG + Intergenic
1194804660 X:98312613-98312635 TTGTAAATGCAGGCCGGGCATGG + Intergenic
1195056833 X:101154275-101154297 TAAAGAATCCAGGCCGGGCATGG + Intronic
1195375951 X:104228421-104228443 TAGAAAATACAGGCCAGGCACGG - Intergenic
1195661377 X:107382333-107382355 AAAGAAATACAGGCCAGGCATGG - Intergenic
1195952542 X:110291230-110291252 TAGAAAATACAAGCCGGGCGTGG + Intronic
1196646472 X:118123344-118123366 TTGGGAAAACAAGCTGGGCATGG + Intergenic
1196702685 X:118688613-118688635 TAGAAAATACAGGCTGGGCGTGG + Intergenic
1196750128 X:119108572-119108594 AAGTGAATATAGGCCAGGCACGG + Intronic
1197167701 X:123396048-123396070 AGGGGATAACAGGCCGGGCATGG + Intronic
1197224816 X:123946177-123946199 TAAGAAGTACAGGCCGGGCGCGG - Intergenic
1197399112 X:125966794-125966816 GAAGACATACAGGCCGGGCATGG - Intergenic
1197835843 X:130692877-130692899 GAGGGAATACGGGCTGGGCCTGG - Intronic
1197857784 X:130935163-130935185 TTGACAATTCAGGCCGGGCACGG + Intergenic
1197889587 X:131255942-131255964 TCTGGAATACACGCCGGGCGTGG + Intergenic
1197943292 X:131812086-131812108 TAGAAAAAAAAGGCCGGGCACGG + Intergenic
1198092181 X:133342325-133342347 TAGATATTGCAGGCCGGGCATGG - Intronic
1198405395 X:136307002-136307024 AAAGGAATAAAGGCTGGGCATGG - Intronic
1198521876 X:137461235-137461257 TAGAGAAAAGAGGCTGGGCATGG + Intergenic
1198780818 X:140233578-140233600 AAAGAAATACAGGCCGGGCGCGG - Intergenic
1198813603 X:140562034-140562056 GAGGAAATCAAGGCCGGGCATGG - Intergenic
1199134481 X:144234513-144234535 GAGGAAATGTAGGCCGGGCATGG + Intergenic
1199477908 X:148266592-148266614 TAGCAAGTACAGGCCAGGCACGG + Intergenic
1199774605 X:150999994-151000016 AAGTGAGTCCAGGCCGGGCATGG + Intergenic
1199943470 X:152647438-152647460 TAGGGATTTCAGGGTGGGCAAGG - Intronic
1202083769 Y:21113140-21113162 TTCAGAATACTGGCCGGGCATGG - Intergenic
1202276145 Y:23122125-23122147 TAGAAAACACGGGCCGGGCACGG + Intergenic
1202289883 Y:23298566-23298588 TAGAAAACACGGGCCGGGCACGG - Intergenic
1202429138 Y:24755847-24755869 TAGAAAACACGGGCCGGGCACGG + Intergenic
1202441653 Y:24914242-24914264 TAGAAAACACGGGCCGGGCACGG - Intergenic
1202598833 Y:26571574-26571596 TAGGGAAGCTAGGCCAGGCATGG - Intergenic