ID: 1125478920

View in Genome Browser
Species Human (GRCh38)
Location 15:40066852-40066874
Sequence AACCCCTTTGGGCACCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125478920_1125478925 -1 Left 1125478920 15:40066852-40066874 CCCCAGGGGTGCCCAAAGGGGTT 0: 1
1: 0
2: 0
3: 3
4: 114
Right 1125478925 15:40066874-40066896 TTGTGAATCAAGATAGTTTGAGG 0: 1
1: 0
2: 1
3: 18
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125478920 Original CRISPR AACCCCTTTGGGCACCCCTG GGG (reversed) Intergenic
900371209 1:2332993-2333015 AGCCCCTTGGGGGACCCGTGGGG - Intronic
903291359 1:22316211-22316233 ACTCCCTTTAGGGACCCCTGGGG - Intergenic
903366258 1:22807094-22807116 AGCCACTTGGGGCACCTCTGAGG + Intronic
906106571 1:43297447-43297469 ATCCCCTGTGGCCACCCCAGCGG - Intergenic
906933938 1:50195555-50195577 CACCCCTCTGGACACTCCTGGGG - Exonic
907975518 1:59427693-59427715 AACCCCTCTGTGCAGCCTTGAGG + Intronic
918368144 1:183831169-183831191 AACCCCCTAGAGCACCCCTCTGG - Intronic
920343622 1:205291893-205291915 AACCCCTGGGGGAACCCCTGGGG - Intergenic
922726713 1:227926209-227926231 ATCCCCATAGGCCACCCCTGGGG + Intronic
1068133045 10:52919072-52919094 AACTCCTTTGGGGACTCCTTGGG - Intergenic
1071553758 10:86586645-86586667 ATCCCCTTTTGGCACAGCTGGGG - Intergenic
1071582984 10:86790900-86790922 CACCACTTTGGGGGCCCCTGAGG - Intronic
1075702940 10:124481074-124481096 AAGCCCTGTGGGAAGCCCTGGGG + Intronic
1076001140 10:126913942-126913964 AACCTCTTTGGGCCCTTCTGAGG + Intronic
1076480204 10:130779912-130779934 CACCCCGGTGGTCACCCCTGTGG + Intergenic
1077325805 11:1963534-1963556 TTCCCCTGAGGGCACCCCTGAGG + Intronic
1081852787 11:46285373-46285395 AACCCTCTTGAGCAGCCCTGGGG + Intronic
1083681419 11:64353532-64353554 ATCCCCTTTGGGCGTTCCTGGGG + Intronic
1084680944 11:70666004-70666026 ATCCCCTCTGGGCACACATGGGG - Intronic
1086404997 11:86492047-86492069 AGCCCCTTTGGGCCCTACTGAGG - Intronic
1087161416 11:94951402-94951424 AAGGCCTTTGGGCTTCCCTGTGG + Intergenic
1089429464 11:118410524-118410546 AACACCTCTGGTCTCCCCTGTGG + Intronic
1202808785 11_KI270721v1_random:18713-18735 TTCCCCTGAGGGCACCCCTGAGG + Intergenic
1091693924 12:2615651-2615673 AGCCCCTTCGGGCAGCTCTGAGG + Intronic
1092771431 12:11900647-11900669 ATCCCCTTTGGGAAGCCCTGGGG - Intergenic
1099030502 12:77520370-77520392 AACATCTTTGGGGACCACTGAGG + Intergenic
1100074150 12:90757940-90757962 TAGCCCTTTGGGCACCCATCAGG + Intergenic
1103325278 12:120116445-120116467 AGCCCCTCGGCGCACCCCTGGGG + Intronic
1107013160 13:35687579-35687601 ATCCCCTTTAGACAGCCCTGTGG + Intergenic
1109733786 13:66453620-66453642 AACCACTGTGGACACCCATGGGG + Intronic
1121112780 14:91323810-91323832 AACCCCCTTGTGCAGCCCTCAGG + Intronic
1122033467 14:98930785-98930807 AACTCCTTTGGTCACCAGTGAGG - Intergenic
1122435024 14:101689365-101689387 CACCCCTGTGGGCTCCCCAGCGG + Intergenic
1123849712 15:24342539-24342561 ATCCCCTCTGGGAGCCCCTGGGG - Intergenic
1124135852 15:27035790-27035812 AAGCCCCTTGGGCAGCACTGTGG + Intronic
1125149515 15:36515985-36516007 TACCCCTTTGGGGCCCTCTGGGG - Intergenic
1125243679 15:37607667-37607689 AAACACTTTGGCCATCCCTGAGG - Intergenic
1125478920 15:40066852-40066874 AACCCCTTTGGGCACCCCTGGGG - Intergenic
1129742155 15:77994504-77994526 CACCCCTATGGGAACCCCTTTGG + Intronic
1129843329 15:78756976-78756998 CACCCCTATGGGAACCCCTTTGG - Intergenic
1130534049 15:84770487-84770509 AACATCTGTGGGCACCACTGAGG - Intronic
1131225028 15:90617374-90617396 AGCCACTTTGGGCACTACTGTGG - Intronic
1138433142 16:56982206-56982228 CACCGCTGTGGGCATCCCTGAGG + Exonic
1139359783 16:66390431-66390453 CACCCGTGTGGGCACCTCTGTGG + Exonic
1143622444 17:8088181-8088203 CAGGCCTTTGGGCACCCATGTGG - Intergenic
1144419848 17:15086592-15086614 CACCCCCTGGGGCACACCTGGGG - Intergenic
1146398836 17:32488024-32488046 GACCCGTTTGGGCGTCCCTGCGG - Exonic
1148323179 17:46769682-46769704 CACCCCTTCCGGCAGCCCTGTGG - Intronic
1151819507 17:76490038-76490060 CAGCCCCTTGGGCACCGCTGGGG - Intronic
1158177704 18:54676364-54676386 ATTTCCTTTGGGAACCCCTGAGG - Intergenic
1159683344 18:71384096-71384118 CTGCCCTTTGGACACCCCTGCGG + Intergenic
1160524658 18:79527893-79527915 CAGCCCTTCTGGCACCCCTGGGG + Intronic
1161026561 19:2039894-2039916 CACCCCTCAGGGGACCCCTGGGG + Intronic
1163417244 19:17194243-17194265 AACTCCTTTGGGGTCCACTGTGG - Intronic
1163861423 19:19744893-19744915 AGCCCCTTTGGGAACCCGTTGGG + Intergenic
1165345746 19:35248205-35248227 ATTCCCCTTGGGCATCCCTGAGG + Intergenic
1167007320 19:46784488-46784510 ATCCCCTCAGGACACCCCTGAGG + Intronic
925184868 2:1840268-1840290 CACCCCCTTGGGCAGCCCAGCGG + Intronic
927865536 2:26585123-26585145 GACCCATTTAGGCAGCCCTGAGG - Intronic
935525699 2:104163733-104163755 AACCCATTTTGGGGCCCCTGTGG - Intergenic
937298581 2:120824585-120824607 AGCCCCTTTGGGCCCCCTTTGGG + Intronic
940091813 2:149928316-149928338 CACCCCTTTGGTCATTCCTGTGG + Intergenic
943179359 2:184524103-184524125 CAGCCCTTTGGGGAGCCCTGGGG - Intergenic
944060362 2:195565362-195565384 AGCACCTTTGGACACCCATGGGG - Intergenic
947898528 2:233698965-233698987 AAGCCCTTTGGCCACCCAGGTGG + Intronic
1169198748 20:3697434-3697456 CAACCCTGTGGGCACCCCAGGGG - Intronic
1174453806 20:50636014-50636036 AGCCCCTGTGGGCCCCCTTGGGG + Intronic
1180392373 22:12296685-12296707 AAGCCCTTTGGGATCACCTGAGG + Intergenic
1180407373 22:12568085-12568107 AAGCCCTTTGGGATCACCTGAGG - Intergenic
1180609637 22:17086749-17086771 AAGGCATTTGGGCAGCCCTGTGG + Intronic
1181053424 22:20248308-20248330 AAGACCTTTTCGCACCCCTGGGG - Intronic
1183412864 22:37665710-37665732 ATCCTCTTTGGCCACCGCTGCGG + Exonic
1183684198 22:39351965-39351987 AGCCCCTCTGAGCACCCATGGGG + Intronic
1183759810 22:39805837-39805859 TACTCCTTTGGGCACACTTGAGG + Intronic
1184984976 22:48125294-48125316 AACCACTTTGGGAAACCATGTGG + Intergenic
1185234388 22:49703615-49703637 AGCCCCTTTGGCCTCCCATGGGG + Intergenic
950531136 3:13552926-13552948 AACCCATGCAGGCACCCCTGGGG - Intronic
953334696 3:42084551-42084573 AGCCCCCTTGGGCCCCACTGGGG + Intronic
953907524 3:46875803-46875825 AAACCCTTTGGGGCTCCCTGAGG - Intronic
955935514 3:64099289-64099311 AATGCCTTTGGGGACCGCTGGGG - Exonic
963113577 3:141706939-141706961 AAGCCCTCTGGGTACCTCTGAGG - Intergenic
989671652 5:43924591-43924613 AACACCTCTGGACACACCTGGGG - Intergenic
990976442 5:61565479-61565501 ATCCCATTTGGGCCTCCCTGAGG - Intergenic
992610035 5:78499682-78499704 AACCCCTCACGGCACTCCTGTGG - Intronic
999181389 5:149671990-149672012 TACCACTTTGGGCAACCTTGGGG - Intergenic
1001631384 5:173177956-173177978 AACTGCTCTGGGCACCCCAGAGG - Intergenic
1002090456 5:176802572-176802594 GCCACCTTTGGGCAGCCCTGGGG - Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002979414 6:2121185-2121207 AACCACTTTGTCCACCCCTCTGG + Intronic
1003691554 6:8359308-8359330 AACCCATATGTGTACCCCTGGGG - Intergenic
1005710465 6:28499407-28499429 AACCACTGTGGTCTCCCCTGTGG - Intergenic
1007756254 6:44101626-44101648 GACCCCTGGGGGGACCCCTGGGG - Intergenic
1008096606 6:47345505-47345527 AACCCCTGTTGCCAGCCCTGTGG - Intergenic
1010900596 6:81423109-81423131 CACAACCTTGGGCACCCCTGTGG - Intergenic
1011845777 6:91561643-91561665 ATCCCCTTTGGTCACCACAGTGG - Intergenic
1013369130 6:109455132-109455154 AACCCCCTCGGGCACCCTTCAGG - Intronic
1014934029 6:127365515-127365537 AAAACCTTGGGGCACCCCAGGGG + Intergenic
1017820348 6:158044572-158044594 ACCTCCTTTGGGCAGCCCTCCGG - Intronic
1018737870 6:166702320-166702342 AACCCCTTTCTGCAGCCCCGAGG - Intronic
1018967061 6:168497368-168497390 ATCCCCTTTGCCCACGCCTGGGG - Intronic
1019424486 7:967713-967735 AGCCCCTCCGAGCACCCCTGGGG - Exonic
1019547831 7:1586973-1586995 AACGCCTTTAGGTCCCCCTGAGG - Intergenic
1019957223 7:4424966-4424988 AACCACTTAGGGTACCCTTGTGG + Intergenic
1021191901 7:17630488-17630510 AACCCATCTGTGCACCCTTGTGG - Intergenic
1021573940 7:22090711-22090733 ACCCCCTGTGGGCTCCCGTGCGG + Intergenic
1025020029 7:55473405-55473427 AACCCCTCTGGGCACGCCATTGG + Intronic
1026153483 7:67807892-67807914 GACCCCTTTGGGGATCCATGAGG + Intergenic
1027979279 7:85196900-85196922 AACCACTTTGGAAAACCCTGAGG + Intergenic
1032513971 7:132493432-132493454 AGCCCATTTGGACAACCCTGTGG + Intronic
1035026473 7:155829995-155830017 ACGGCCTTTGGGCAGCCCTGGGG - Intergenic
1035714315 8:1742247-1742269 AACTCACTTGCGCACCCCTGGGG - Intergenic
1036142616 8:6222516-6222538 AAGCCCATTGGACACACCTGGGG + Intergenic
1049317595 8:141977519-141977541 CACCCCTCTTGACACCCCTGTGG - Intergenic
1049696821 8:143988106-143988128 AACCCCCATGGCCACCCCTCTGG + Intronic
1050112165 9:2228283-2228305 AGGCCCATTGGGTACCCCTGGGG + Intergenic
1053268908 9:36736510-36736532 ATCCTCTGTGGGCTCCCCTGGGG + Intergenic
1186019425 X:5237432-5237454 AAGCCCTTTGGGCAAGCATGAGG - Intergenic
1187610514 X:20938648-20938670 AACACCTCTGGACACACCTGGGG - Intergenic