ID: 1125481891

View in Genome Browser
Species Human (GRCh38)
Location 15:40086910-40086932
Sequence AACCACTCTATATTTGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125481891_1125481895 6 Left 1125481891 15:40086910-40086932 CCCTGTCCAAATATAGAGTGGTT No data
Right 1125481895 15:40086939-40086961 GCCATACTTTACAGAAGAAGAGG No data
1125481891_1125481897 17 Left 1125481891 15:40086910-40086932 CCCTGTCCAAATATAGAGTGGTT No data
Right 1125481897 15:40086950-40086972 CAGAAGAAGAGGCAGTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125481891 Original CRISPR AACCACTCTATATTTGGACA GGG (reversed) Intergenic
No off target data available for this crispr