ID: 1125481892

View in Genome Browser
Species Human (GRCh38)
Location 15:40086911-40086933
Sequence CAACCACTCTATATTTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125481892_1125481895 5 Left 1125481892 15:40086911-40086933 CCTGTCCAAATATAGAGTGGTTG No data
Right 1125481895 15:40086939-40086961 GCCATACTTTACAGAAGAAGAGG No data
1125481892_1125481897 16 Left 1125481892 15:40086911-40086933 CCTGTCCAAATATAGAGTGGTTG No data
Right 1125481897 15:40086950-40086972 CAGAAGAAGAGGCAGTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125481892 Original CRISPR CAACCACTCTATATTTGGAC AGG (reversed) Intergenic
No off target data available for this crispr