ID: 1125481897

View in Genome Browser
Species Human (GRCh38)
Location 15:40086950-40086972
Sequence CAGAAGAAGAGGCAGTTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125481894_1125481897 11 Left 1125481894 15:40086916-40086938 CCAAATATAGAGTGGTTGGAAGT No data
Right 1125481897 15:40086950-40086972 CAGAAGAAGAGGCAGTTATTTGG No data
1125481892_1125481897 16 Left 1125481892 15:40086911-40086933 CCTGTCCAAATATAGAGTGGTTG No data
Right 1125481897 15:40086950-40086972 CAGAAGAAGAGGCAGTTATTTGG No data
1125481891_1125481897 17 Left 1125481891 15:40086910-40086932 CCCTGTCCAAATATAGAGTGGTT No data
Right 1125481897 15:40086950-40086972 CAGAAGAAGAGGCAGTTATTTGG No data
1125481889_1125481897 20 Left 1125481889 15:40086907-40086929 CCTCCCTGTCCAAATATAGAGTG No data
Right 1125481897 15:40086950-40086972 CAGAAGAAGAGGCAGTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125481897 Original CRISPR CAGAAGAAGAGGCAGTTATT TGG Intergenic
No off target data available for this crispr