ID: 1125485604

View in Genome Browser
Species Human (GRCh38)
Location 15:40108812-40108834
Sequence CGGCGGCGGCGGGCACAGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 675
Summary {0: 1, 1: 0, 2: 10, 3: 69, 4: 595}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125485591_1125485604 17 Left 1125485591 15:40108772-40108794 CCGGGCTGCGGCAGGAGGCGGGA 0: 1
1: 1
2: 3
3: 26
4: 370
Right 1125485604 15:40108812-40108834 CGGCGGCGGCGGGCACAGGCCGG 0: 1
1: 0
2: 10
3: 69
4: 595
1125485584_1125485604 29 Left 1125485584 15:40108760-40108782 CCCGGGCGCTCACCGGGCTGCGG 0: 1
1: 0
2: 1
3: 17
4: 172
Right 1125485604 15:40108812-40108834 CGGCGGCGGCGGGCACAGGCCGG 0: 1
1: 0
2: 10
3: 69
4: 595
1125485586_1125485604 28 Left 1125485586 15:40108761-40108783 CCGGGCGCTCACCGGGCTGCGGC 0: 1
1: 0
2: 1
3: 15
4: 234
Right 1125485604 15:40108812-40108834 CGGCGGCGGCGGGCACAGGCCGG 0: 1
1: 0
2: 10
3: 69
4: 595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125485604 Original CRISPR CGGCGGCGGCGGGCACAGGC CGG Exonic
900087471 1:905204-905226 CGGGGGTTTCGGGCACAGGCGGG - Intergenic
900113892 1:1020570-1020592 AGGCGGCGGCGGGCGGAGGACGG - Intronic
900287694 1:1909314-1909336 TAGCGGCGGCGGGGAAAGGCGGG - Intergenic
900393423 1:2443565-2443587 TGGCTGCGGCGGGCGCAGGGCGG + Intronic
900417281 1:2540926-2540948 CGGCGGCGGGGGGCGCGGGGGGG - Intergenic
901007941 1:6180597-6180619 CGGCGGCGGCTGGCTCTGCCCGG - Intergenic
901019721 1:6249580-6249602 CGGGGGCGGCGGGCGCAGCGGGG + Exonic
901060894 1:6471461-6471483 GGGCGGGGCCGGGCGCAGGCGGG - Intronic
901361370 1:8703443-8703465 CGGCGGCGGCCGGCAAAACCCGG + Intronic
901607020 1:10467132-10467154 CTGGGGCGGGGGGCAGAGGCTGG + Intronic
902067515 1:13700376-13700398 CGACGGCGGCGGCGACACGCTGG + Intronic
902169582 1:14599120-14599142 CGGCGGCGGCGGCCCCGGCCCGG + Exonic
902823233 1:18956221-18956243 CGGCGGCGGCGGGGCAGGGCCGG - Exonic
902890354 1:19438821-19438843 CGGGGCCGGCGGGCACTGGGTGG + Intronic
902916838 1:19644550-19644572 CGGCGGCCGCGGGCACCGGGTGG + Intronic
902985496 1:20152030-20152052 GGGTGGGGGCGGGCAGAGGCTGG - Intergenic
903169168 1:21541515-21541537 TGGCAGAGGCCGGCACAGGCCGG - Intronic
903263430 1:22143142-22143164 CGGCGGCGGCGGAGGCGGGCGGG + Intronic
903324700 1:22563346-22563368 CGGCGGCGGTGGCCGCGGGCCGG + Intergenic
903324834 1:22563735-22563757 CGGCGGCGGCGGGGCGGGGCAGG + Intronic
903475992 1:23619562-23619584 CGGCGGCGGCGGCGGCTGGCGGG - Intronic
903543845 1:24111416-24111438 GGGCGGCGGGTGGCACAGGCTGG + Intronic
903573371 1:24322315-24322337 CGGCGGCGGCGGCCGCGGTCAGG - Intronic
904050456 1:27635154-27635176 CAGGGGCGGCGGTCAGAGGCGGG - Exonic
904245093 1:29181832-29181854 CGGCGGCGGCGGCAACGGGCGGG + Exonic
904690827 1:32292235-32292257 CGGCGGGGGCGGGGCCAGGCCGG + Intronic
904720007 1:32500666-32500688 CGGCGGCGGTGGGCGTTGGCGGG + Intronic
904822824 1:33256443-33256465 CGGCGGCGGCGGCGGGAGGCTGG - Intergenic
905241555 1:36584596-36584618 CAGAGGCGGCGGGCACTGGGTGG + Intergenic
905347099 1:37318653-37318675 CGGCGGGGGTGGGCACAGGCAGG + Intergenic
905518323 1:38578424-38578446 CGGCGGCGGCGAGAGCGGGCGGG + Intergenic
905647212 1:39633050-39633072 CGGCGGCGGCGGGGCTGGGCCGG + Intronic
905710388 1:40097290-40097312 CGGCGGCGCCACGCCCAGGCGGG - Exonic
905884517 1:41484604-41484626 CGGCGGTGGAGCGCGCAGGCTGG + Exonic
906078412 1:43068405-43068427 CGGGGGCGGCGGGGGCGGGCTGG + Intergenic
906520977 1:46466726-46466748 CGGCGGCGGCGGGAGCGGGAGGG + Intergenic
906650356 1:47508447-47508469 CGGCCGCGGCGGCCCCAGGGAGG - Intergenic
907051054 1:51330281-51330303 CGGCGGCGGCTGCCAGGGGCCGG + Intronic
912429083 1:109619805-109619827 AGGCGGAGGCGGGGCCAGGCGGG + Intronic
912927906 1:113929720-113929742 CGGCGGCGGCGGGAAGGGGCTGG + Exonic
913518366 1:119623685-119623707 CGGCGGCAGCGGCCTCAGCCAGG + Exonic
914702920 1:150150302-150150324 AGGCGGCGGCGGCCGCAGGGCGG - Intronic
914824795 1:151132870-151132892 GGGCGGGGGCGGGCTCCGGCGGG + Exonic
915977432 1:160400463-160400485 CGGCGGCTGTGGGAACAGCCGGG + Intergenic
917829095 1:178859807-178859829 GGGGGGGGGCGGGCAGAGGCAGG - Intronic
918056027 1:181022748-181022770 GGGCAGCTGCGGGAACAGGCGGG - Exonic
918066551 1:181105462-181105484 CGGCCGCGGCGGGTACCGGTGGG + Intergenic
918365654 1:183805140-183805162 CGGCGGCGGCGGGGGCAGCGCGG + Intronic
919101849 1:193105489-193105511 CGGCGGCGGCGCGGGCAGTCCGG - Intronic
919892145 1:201983125-201983147 AGGCAGCGGCGGGCGCAGTCTGG - Intronic
919919693 1:202160692-202160714 CAGCGGCAGCAGGCACAGGAGGG - Exonic
920455794 1:206100140-206100162 CGGTGGAGGCAGGCAGAGGCAGG - Intronic
921355563 1:214281437-214281459 CGGCGGCGGCGGCGGCGGGCGGG + Intronic
921355564 1:214281443-214281465 CGGCGGCGGCGGGCGGGAGCCGG + Intronic
921432798 1:215083015-215083037 CGGCGGCGGCGGCGGCGGGCAGG + Intronic
921432800 1:215083021-215083043 CGGCGGCGGCGGGCAGGCGCGGG + Intronic
921671097 1:217925038-217925060 CGCCGGCCGCGGGCACACGGAGG - Intergenic
922744923 1:228038274-228038296 CGGCTCCGGCGGGCTCCGGCGGG + Intronic
922774393 1:228208136-228208158 CGCAGGCTGGGGGCACAGGCTGG - Exonic
922904750 1:229165471-229165493 CAGCAGCGGCAGGCACAGGAAGG + Intergenic
923537314 1:234863171-234863193 GAGCGGCGTGGGGCACAGGCAGG + Intergenic
1062874026 10:931309-931331 CGGCCGCGGCGGGCAGGGCCGGG - Intronic
1063125911 10:3136590-3136612 CGGTGGCTGCAGGCACATGCAGG - Exonic
1063228014 10:4034277-4034299 CGGGGGCGGCAAGGACAGGCAGG - Intergenic
1064274192 10:13891762-13891784 GGGCGGCGGCGGGGACGGGGCGG - Intronic
1065520486 10:26567028-26567050 CGGAGGGGGCGGGGGCAGGCTGG - Exonic
1065614321 10:27504528-27504550 CTGCAGCGGCGGGCTCGGGCCGG + Intronic
1065712755 10:28533220-28533242 CGGCGGCGGCGGGGGGAGGAGGG + Intronic
1065712869 10:28533649-28533671 CGGCGGCGGGGGGCGGCGGCGGG + Intronic
1066080731 10:31928588-31928610 CGCCCTCGGCGGGCACAGCCCGG + Intronic
1066429326 10:35336836-35336858 CGGCGGCGGCGGCGACGAGCGGG - Intronic
1067107414 10:43375402-43375424 TGGCAGCGGCTGGCACAAGCAGG + Intronic
1069676952 10:70255191-70255213 CGACGGGCGCGGGCAGAGGCGGG + Exonic
1071695298 10:87863523-87863545 CGGCGGCGGAGGGGGCGGGCAGG + Exonic
1071695430 10:87864094-87864116 CGGCGGCGGCTGGCACATCCAGG + Exonic
1072794239 10:98342219-98342241 CGGGGGAGGCAGGCACGGGCAGG - Intergenic
1073139127 10:101236279-101236301 GGGGGGCGCCGGGCGCAGGCCGG + Intergenic
1073432132 10:103493781-103493803 CGGGGGCGGCGGTCGCAGGAGGG + Intergenic
1074085703 10:110207877-110207899 CCACGGCGGGGGGCACAGCCGGG - Exonic
1074377321 10:112951033-112951055 GGGCGGCGGCGGGGCCCGGCGGG + Intronic
1074592013 10:114822182-114822204 CGGCGGCCTCGGGGACAAGCCGG + Intronic
1074801534 10:117005359-117005381 CCGCGCCGGCAGCCACAGGCTGG - Exonic
1074829866 10:117240961-117240983 CGGCCGAGGCGGGGACAGGGAGG + Intergenic
1074829880 10:117241007-117241029 CGGCGCGGGCGGGCGGAGGCCGG + Intergenic
1075054357 10:119207024-119207046 CGGCGGCGGCCGGCCCGGCCTGG - Intergenic
1075438546 10:122461953-122461975 GTGCGGCGGCGCGCGCAGGCCGG + Exonic
1075745500 10:124724553-124724575 CGGGGTAGGGGGGCACAGGCTGG + Intronic
1076313293 10:129523205-129523227 GGGCCTCGGCGGGCACAGGCGGG + Intronic
1076719858 10:132388255-132388277 CGGGGGCGGGGGGCTCATGCGGG + Intergenic
1076719901 10:132388351-132388373 CGGGGGCGGGGGGCTCATGCGGG + Intergenic
1076719910 10:132388370-132388392 CGGGGGCGGGGGGCTCATGCGGG + Intergenic
1076719927 10:132388407-132388429 CGGGGGCGGGGGGCTCATGCGGG + Intergenic
1076719996 10:132388559-132388581 CGGGGGCGGGGGGCTCATGCGGG + Intergenic
1076720005 10:132388578-132388600 CGGGGGCGGGGGGCTCATGCGGG + Intergenic
1076720023 10:132388616-132388638 CGGGGGCGGGGGGCTCATGCGGG + Intergenic
1076720032 10:132388635-132388657 CGGGGGCGGGGGGCTCATGCGGG + Intergenic
1076720050 10:132388673-132388695 CGGGGGCGGGGGGCTCATGCGGG + Intergenic
1076720069 10:132388712-132388734 CGGGGGCGGGGGGCTCATGCGGG + Intergenic
1076720126 10:132388829-132388851 CGGGGGCGGGGGGCTCATGCGGG + Intergenic
1076720135 10:132388848-132388870 CGGGGGCGGGGGGCTCATGCGGG + Intergenic
1076792822 10:132785976-132785998 CGGCGGCGGCGGGGCCCGGATGG - Exonic
1076868232 10:133179867-133179889 CGTCAGCGGAGGGAACAGGCTGG - Intronic
1076936128 10:133568281-133568303 CCGGGGCGGCGGGCTCAGGCTGG - Intronic
1077012180 11:384229-384251 AGGCGGCCGAGGACACAGGCGGG + Intergenic
1077085374 11:747437-747459 CGGCGGCGGCGGCGACGGGACGG - Exonic
1077151200 11:1073889-1073911 CGGCCCGGGAGGGCACAGGCAGG - Intergenic
1077235748 11:1481292-1481314 CGGCAGGGGCAGGGACAGGCTGG - Intronic
1077419948 11:2445328-2445350 CGGCGGCCGCGGGCCAAGGTCGG - Exonic
1077479642 11:2807630-2807652 AGCCGGCGGTGGGCACAGGCGGG + Intronic
1078316040 11:10294061-10294083 CGGCGGCGGCGGCCATGGCCCGG - Exonic
1078508029 11:11966484-11966506 CGGAGGCGGCAGGTACAGGGAGG + Intronic
1078514119 11:12008585-12008607 CGGCGGCTGCGGGCGCAGAGCGG - Exonic
1079076723 11:17389145-17389167 CGGCGGCGGCGGGCGGGGCCGGG - Intronic
1081705610 11:45180755-45180777 CGGCCGGGGCGGGCGCGGGCGGG - Intronic
1081831910 11:46121536-46121558 CGGCGGCGGCGGCGGCGGGCCGG - Intergenic
1082076688 11:47980714-47980736 CGGCGGCCGCGGCCACACGCCGG - Exonic
1083797746 11:65027451-65027473 AGGCGGCGGCGGGCGGAGGCTGG + Exonic
1083934586 11:65863594-65863616 CTCCAGGGGCGGGCACAGGCCGG + Exonic
1084072393 11:66744828-66744850 CGGCGGCGGCGGCGGCGGGCGGG + Intronic
1084418581 11:69049045-69049067 CGGCGGTGGCGGCGACTGGCCGG + Exonic
1085332915 11:75668067-75668089 AGCCGGCGGCGGGCCCCGGCCGG - Exonic
1087014638 11:93543275-93543297 CGGCGGCGGCGCCCGCGGGCAGG - Exonic
1088332131 11:108665129-108665151 CGGCGGCGGCGGCGACAGCTCGG - Exonic
1089346982 11:117796984-117797006 CGGAGGCGGCGGGGCCAGGGTGG - Intronic
1089432717 11:118436703-118436725 CGGCGGCGGCGGGAAGCAGCGGG + Exonic
1089616380 11:119697031-119697053 CCGCTGCAGCGGGCAGAGGCCGG + Intronic
1089845083 11:121452177-121452199 CAGCGGCGGCGGGCGCAGCGGGG + Intergenic
1090460899 11:126890788-126890810 GGGCAGCGCTGGGCACAGGCAGG - Intronic
1090636692 11:128694297-128694319 CGCGGGCGGCGGGGACCGGCCGG + Intronic
1092193192 12:6534618-6534640 CGGCAGGGGCGGGCGCAGGCCGG + Intronic
1095465521 12:42484132-42484154 GGGCGGCGGCGGGAGCAGGCTGG - Intronic
1095986485 12:48002909-48002931 GGAAGGCGGCGGGCTCAGGCGGG - Intronic
1096459483 12:51814377-51814399 CGGCGGCGCCGGGCCGCGGCAGG + Intergenic
1096460880 12:51821012-51821034 CGGCGGCGCCGGGCGCAGCCAGG + Intergenic
1096466416 12:51849298-51849320 CGGACGGGGCGGGCCCAGGCCGG - Intergenic
1096493023 12:52023351-52023373 CGGCGGCGGCACGCCCAGGAGGG - Intronic
1096749944 12:53752144-53752166 CGGCGGCAGCGGGCAGAGAGGGG - Intergenic
1098105966 12:67069323-67069345 CGGCGGCGGCCGGGCCGGGCCGG + Intergenic
1102197408 12:111034851-111034873 CGGCGGCGGCGGCCCCCGGGTGG - Intronic
1102853895 12:116277308-116277330 CGGGGGCAGCGGGCCCGGGCTGG + Exonic
1103432967 12:120903911-120903933 CGGCGGCGGCGGGCTCGCTCGGG + Exonic
1104069368 12:125331075-125331097 TGGCGGCGGCGGCCACTGGGTGG + Intronic
1104964452 12:132502740-132502762 AGGAGGGGGCGGGGACAGGCAGG - Intronic
1104982824 12:132581834-132581856 CGGGGGAGGGGGGCACAGGCTGG - Intronic
1105014202 12:132776287-132776309 CTGAGGCGCTGGGCACAGGCGGG - Intronic
1106248726 13:27968556-27968578 CGGTGGCGGCGGGCCCAGGAGGG + Exonic
1107058516 13:36131226-36131248 GGGCGGCGGCGGGGCCGGGCTGG + Exonic
1107467797 13:40665789-40665811 CGGCGGCGGGGGGCACCGGCGGG + Exonic
1111396066 13:87671795-87671817 CGGCGGCGGCGGGCTCGGCGCGG + Intergenic
1111396305 13:87672635-87672657 CCGCGGCGGCGGCCCCAGGCTGG + Exonic
1112091797 13:96090809-96090831 CGGCGGCGGCGGCGGCAGGGCGG - Intergenic
1112216256 13:97434108-97434130 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1112505042 13:99970434-99970456 CGGCGGCGGCGGCGGCAGCCCGG + Exonic
1113460557 13:110479336-110479358 CAGAGGAGGCGGGGACAGGCAGG + Intronic
1113465102 13:110507265-110507287 TGGAGGCGGGGCGCACAGGCAGG - Intronic
1113541823 13:111115292-111115314 GGGCGGCGGCGGGCGCCCGCAGG + Exonic
1113541871 13:111115446-111115468 CGGCGGCGGGGGCCGCGGGCCGG + Exonic
1114224198 14:20723447-20723469 GGGAGGCTGCGGGCGCAGGCGGG + Intergenic
1116436180 14:44897479-44897501 CGGCGGCGGCGGCGGCAGCCCGG + Exonic
1116657979 14:47675013-47675035 GGCCGGCGGCGGGCGCGGGCAGG + Intergenic
1118971550 14:70642078-70642100 CGGCGGCGGCGGGCAGATCGCGG + Exonic
1119106815 14:71932566-71932588 CGACCGGGGCGGGCAGAGGCGGG + Exonic
1119329870 14:73786150-73786172 CGGCGGCGGCGGGGACACGTTGG - Intronic
1119410279 14:74426081-74426103 CGGCGGCGGCGGGCTGCGGGCGG - Exonic
1121050492 14:90816453-90816475 CGGCGGCGGCGGGCGCGGCGGGG + Intronic
1122162330 14:99793426-99793448 CGGCGGCGGCGCGGCCGGGCCGG + Exonic
1122270856 14:100567989-100568011 CGGCCGCGCCGGGCAGAGCCGGG + Exonic
1122626046 14:103085810-103085832 CTCTGGCGGCGGGCTCAGGCAGG + Intergenic
1122772424 14:104103356-104103378 CTGCGGAGCCTGGCACAGGCCGG + Intronic
1122776158 14:104117791-104117813 CGGCGGCGGCGTCTCCAGGCCGG - Intergenic
1122975290 14:105168436-105168458 CGGCGGCGGCGGGGCCGGGCGGG - Exonic
1123004487 14:105314788-105314810 GGGCGGCGGAGGGGACGGGCCGG - Exonic
1124297083 15:28513392-28513414 TGGCGGGGGGGGGTACAGGCAGG + Intergenic
1124410575 15:29433103-29433125 CGTCGGGGGCTGGCCCAGGCAGG - Intronic
1124469319 15:29968961-29968983 CGGCGGCGGCGGGAGCGGCCGGG - Intergenic
1125003634 15:34795533-34795555 CGGCGGCAGCGGGCTCTGGGTGG + Exonic
1125485604 15:40108812-40108834 CGGCGGCGGCGGGCACAGGCCGG + Exonic
1128743351 15:70097642-70097664 CCGCGTCGGAGCGCACAGGCAGG + Exonic
1129052813 15:72796908-72796930 AGGCGCCGGCGGGAAGAGGCGGG - Intergenic
1129199884 15:73992367-73992389 CGGCGGAAGCGGGCCCCGGCCGG - Intronic
1129503187 15:76059735-76059757 CGGCGTCGGCTGGCAGGGGCTGG - Intronic
1129675973 15:77632626-77632648 CGGCGGCGGCGGCTCCGGGCCGG - Intronic
1129771237 15:78204696-78204718 CGGAGGCTGCGGGGACAGGCAGG + Intronic
1129780225 15:78264901-78264923 GGGCGGCGCGGGGCACGGGCCGG + Intronic
1130002439 15:80059521-80059543 CGGAGGAGGCGGGGAGAGGCGGG - Intergenic
1130564540 15:84982135-84982157 CGGCGGCGCCGCGGACACGCTGG - Exonic
1130596693 15:85254284-85254306 CGGCCGCGGCTGCCACATGCAGG + Intergenic
1131257620 15:90872209-90872231 CGCCGGCGGCCGGCGCAGGTAGG + Intronic
1131431744 15:92393889-92393911 CGGCAGCGGCAGCGACAGGCAGG - Exonic
1131827049 15:96330504-96330526 TGGCGGCCGCGGGCGCAGCCCGG - Intronic
1132055560 15:98648554-98648576 CGGCGGCGGCGCGGCGAGGCTGG + Intergenic
1132055635 15:98648845-98648867 AGGCGGCGGCGGGCGGGGGCCGG + Intergenic
1132505818 16:308141-308163 CAGAGGCGGCAGGCACAGACAGG - Intronic
1132514582 16:360196-360218 AGGCGGCGGAGGGCACAGGTGGG - Intergenic
1132519820 16:381945-381967 CGACGGCGGCGGGGACCGGCCGG - Exonic
1132588173 16:715201-715223 GGGCGGCGGCGGGAGCAGCCGGG - Exonic
1132605607 16:792529-792551 CGACGGCGCCGGGCAGAGGGGGG + Exonic
1132622224 16:873292-873314 CGGCGGGGGCGAGCACAGATGGG - Intronic
1132684724 16:1157565-1157587 CCGGGGAGGCGGGCGCAGGCGGG - Intronic
1132779426 16:1614481-1614503 GGGCCGCGGCGGGCTCGGGCGGG + Intronic
1132803877 16:1766849-1766871 CGGAGGGGGCTGGCACAGCCTGG + Intronic
1132843531 16:1989933-1989955 CGGCCGCGGCGGGGACGCGCGGG - Exonic
1133029662 16:3004389-3004411 CGGCGGCCCGGGGCTCAGGCCGG - Intergenic
1133156447 16:3880130-3880152 CGGCGGCGGCGGCCGGGGGCGGG - Exonic
1133231428 16:4368862-4368884 TGGCTGCTGGGGGCACAGGCTGG + Intronic
1133286669 16:4693912-4693934 CGGCGCGGGCGGGCCCGGGCGGG + Intronic
1134656125 16:15949668-15949690 GGGCGGCGGCGGGCACCGGGCGG - Exonic
1134656143 16:15949718-15949740 GGGCGGCGGCGGGCACCGGGCGG - Exonic
1135115182 16:19717996-19718018 TGGAGGCGGCGGCCTCAGGCCGG + Exonic
1136129625 16:28211686-28211708 GGGAGGCTGCGGGCCCAGGCAGG + Exonic
1136146741 16:28320735-28320757 CGACGGCGGGGGGCGCGGGCCGG - Exonic
1136153020 16:28364637-28364659 CGGCGGCGGCCGGAGCAGGGTGG + Intergenic
1136210063 16:28750636-28750658 CGGCGGCGGCCGGAGCAGGGTGG - Intergenic
1136230760 16:28883920-28883942 AGGCAGCGGGGGGCACAGGGTGG - Intronic
1136237761 16:28925102-28925124 CGGCGGCGGCGGCCGGGGGCTGG - Exonic
1136281967 16:29218617-29218639 AGCCGGCGGGAGGCACAGGCTGG - Intergenic
1136399758 16:30010932-30010954 GGGGGACGGCGGGCGCAGGCTGG + Exonic
1137531572 16:49281758-49281780 CGGCAGCGGCGGGTGCGGGCAGG - Exonic
1137617792 16:49857318-49857340 CGGCGGCGGCAGGCACGGCGCGG + Intronic
1138023151 16:53502845-53502867 CGGGGAGGGCGGGCACGGGCCGG + Intronic
1138083757 16:54115579-54115601 AGGGGACGGCGGGCCCAGGCAGG + Exonic
1138178737 16:54928880-54928902 CGGCTGCGGCGGGCGGAGCCGGG + Intergenic
1138619198 16:58198042-58198064 CGGCAGCGGCAGCCACCGGCCGG + Intergenic
1139549867 16:67667171-67667193 AGGCGGGGAGGGGCACAGGCTGG + Intronic
1141054608 16:80804002-80804024 CGGCGGCGGCGGCCGGAGGGTGG - Intronic
1141079312 16:81036331-81036353 CGGCCGGGGAGGGCAGAGGCCGG - Intronic
1141231438 16:82170734-82170756 CGGCGGGGGCCGCCCCAGGCAGG + Intergenic
1141608576 16:85169240-85169262 CGGCGGCGGCGGGGCCCGGGCGG - Intergenic
1141690621 16:85594240-85594262 GGGGGGCGGAGGGGACAGGCGGG + Intergenic
1141839722 16:86567026-86567048 CGGCGGCAGCGCGGGCAGGCGGG - Intergenic
1142086343 16:88184533-88184555 AGCCGGCGGGAGGCACAGGCTGG - Intergenic
1142163338 16:88570634-88570656 CGGCGGCGGCGGCCGCGGGAGGG + Intronic
1142211910 16:88812389-88812411 CGGAGGCGGCGGGCCTGGGCTGG + Intergenic
1142236449 16:88924741-88924763 CGGACGCGGCGGGGACAGCCAGG + Intronic
1142245974 16:88970188-88970210 CGGTGGCGGCGGCCCCAAGCCGG + Intronic
1142300975 16:89257586-89257608 CACCGGCGGCGGGACCAGGCGGG - Intergenic
1142799711 17:2337553-2337575 CGGCGGCGGCGGCGGCGGGCCGG + Exonic
1142867548 17:2799865-2799887 CAGTGAGGGCGGGCACAGGCTGG + Intronic
1143148296 17:4790299-4790321 CGGCGGCTGCGGGGACCGGCGGG + Exonic
1143527217 17:7479586-7479608 CGGCGGCAGCGGGGCCGGGCCGG - Intronic
1143545480 17:7592783-7592805 CGGCGGCGCCTGGCACTTGCTGG + Exonic
1143586649 17:7853824-7853846 CGGCGGCGGGGGTCACATACGGG + Exonic
1144021027 17:11240621-11240643 CGGCGGCGGCGGGGCGAGGCGGG - Intergenic
1144339678 17:14301379-14301401 CGGCGGCCGCGGGCACACGGGGG + Exonic
1144565141 17:16353484-16353506 CGGCGGGGGCGCGCGCAGGCCGG - Exonic
1144586911 17:16492432-16492454 CGGGGGCGAGGGGAACAGGCAGG + Intergenic
1144687912 17:17238259-17238281 AGGGGGCAGCGCGCACAGGCGGG - Intergenic
1144787545 17:17840314-17840336 GAGGGGCGGCGGGGACAGGCTGG + Intergenic
1144840505 17:18183098-18183120 CGGCGGCAGCGGCGGCAGGCTGG + Intronic
1145693919 17:26773360-26773382 CGGCGGCGGCGGAAAAAGCCTGG - Intergenic
1147591844 17:41688967-41688989 CGGCGGTGGCGGGAGAAGGCGGG - Exonic
1147912486 17:43864362-43864384 CAGAGGCCTCGGGCACAGGCTGG - Intergenic
1147970854 17:44218748-44218770 CGGAGGCGGGGGGAACCGGCCGG - Intronic
1148151102 17:45396788-45396810 CGGCTGCCGCGGGGAAAGGCAGG + Exonic
1148493467 17:48037809-48037831 CGGCGGCGGCGGGCAGGCGGCGG - Intronic
1148579372 17:48733210-48733232 CGGCGGCCGCGCTCAAAGGCCGG - Intergenic
1148603069 17:48908643-48908665 CGGCGGCGGCGGCAGCGGGCGGG + Exonic
1148617887 17:49014055-49014077 GGGCGACCGTGGGCACAGGCGGG + Intronic
1149614746 17:57988280-57988302 CCGCGGCGGCGAGCGCGGGCGGG + Intergenic
1149685364 17:58531812-58531834 CGCCGGCCCCGGGCACAGGCTGG - Intronic
1150326682 17:64263317-64263339 CGGCGGCCGCGGGCGCGGGGCGG - Intergenic
1150489015 17:65561705-65561727 CGGCGGGGGCGGGCCGGGGCGGG - Intronic
1151210445 17:72540396-72540418 CGGACGCGCCGGGCACAGCCAGG + Intergenic
1151558697 17:74859897-74859919 CGGCGGCGGCGGCTCCGGGCGGG + Intronic
1151559228 17:74861752-74861774 CGGAGGTGGCGGGCCCCGGCGGG - Intergenic
1151656840 17:75500134-75500156 CGGCGGTGGCTGGCAAAGGGAGG + Intergenic
1151802044 17:76384504-76384526 CGGAGGCGGCGCGCTGAGGCCGG + Intronic
1151938864 17:77280931-77280953 CGGCGGCGCCGGGCACAGCCGGG - Intronic
1152175021 17:78781936-78781958 CTGGGGCGGGGGTCACAGGCCGG - Intronic
1152396378 17:80035941-80035963 CGGCGGGGGCAGGCAGGGGCCGG - Intergenic
1152433110 17:80260518-80260540 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433119 17:80260542-80260564 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433123 17:80260548-80260570 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433132 17:80260572-80260594 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433136 17:80260578-80260600 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433145 17:80260602-80260624 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433149 17:80260608-80260630 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433158 17:80260632-80260654 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433162 17:80260638-80260660 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433171 17:80260662-80260684 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433175 17:80260668-80260690 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433184 17:80260692-80260714 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433188 17:80260698-80260720 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433197 17:80260722-80260744 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433201 17:80260728-80260750 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433210 17:80260752-80260774 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433214 17:80260758-80260780 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433223 17:80260782-80260804 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433227 17:80260788-80260810 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152433236 17:80260812-80260834 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433240 17:80260818-80260840 CGGCGGCGGCGGGCAGGGCGGGG + Intergenic
1152655860 17:81518990-81519012 CCGCGGGGGCGGGCACAGCAGGG + Intronic
1152718545 17:81911363-81911385 CAGCGGCGGCGCGGACAGCCTGG + Exonic
1152723662 17:81934883-81934905 TGGCGGCGGCGGGCACTTCCCGG - Intronic
1152745674 17:82037582-82037604 GGCCGGCGGCGGGCAGAGGCGGG - Intronic
1152784069 17:82238986-82239008 CGGGGCCGGCAGGCACAGGGAGG + Exonic
1152864910 17:82716740-82716762 CGGCCGCGGCGGGAACATGGAGG + Exonic
1152906798 17:82974777-82974799 CAGCGGCAGGAGGCACAGGCAGG + Intronic
1152924151 17:83079874-83079896 CGGCGGGGGCGGGCCCGGGGCGG - Exonic
1152938930 17:83155508-83155530 CCCCGCCGGAGGGCACAGGCAGG - Intergenic
1153202003 18:2656135-2656157 CGGAGGCGTCGGCCACAGGACGG + Exonic
1153842173 18:9017020-9017042 TGGCGGAGGCGGGGCCAGGCAGG + Intergenic
1155152472 18:23134417-23134439 GGGCGGGGGCGGGGACAGGGTGG - Intergenic
1155152791 18:23135867-23135889 CGGCGGCCGCGGGCTGAGGCTGG - Exonic
1155392722 18:25352309-25352331 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
1159040291 18:63318423-63318445 CGGCGGCGCCGGGGGCAGCCGGG + Exonic
1160204583 18:76822526-76822548 CGGCGGGGGCGCGCACGCGCGGG - Intergenic
1160345268 18:78127299-78127321 CGGAGGTGGGGGGCACTGGCTGG + Intergenic
1160653473 19:246787-246809 CGGCGGCGCGGCGCACAGACGGG + Intergenic
1160909897 19:1469550-1469572 CGGCGGGCGCGCGCACAGGCAGG - Exonic
1160927984 19:1556108-1556130 TGGCCGCGGCGGGCACGGTCAGG + Exonic
1161241152 19:3224692-3224714 CGGCGGCGGCGGGCGGCGGGCGG - Exonic
1161333825 19:3700430-3700452 CGGCGGCGGCGGTCGCAGCTCGG - Exonic
1161337296 19:3721553-3721575 CGGCGGCCGCGGCCAGAGCCCGG - Intronic
1161388013 19:4007334-4007356 CGGCGGCGTCGGGCAGGGGATGG - Intergenic
1161395831 19:4044417-4044439 GGGCGTCGGGGGGCAGAGGCAGG + Exonic
1161450704 19:4343859-4343881 CGGCGGCGGCGGGGCCGGGGCGG + Exonic
1161851410 19:6739743-6739765 CGGCGGCGGCGGGAGCAGCATGG + Exonic
1162033056 19:7925634-7925656 CGGCGGCGGCGGCGGCAGGAGGG - Intronic
1162065661 19:8123830-8123852 CAGCCCCCGCGGGCACAGGCTGG + Exonic
1162412981 19:10517575-10517597 CCGCGGCGAGTGGCACAGGCTGG - Intronic
1162536629 19:11266315-11266337 CGGAGGCAGCGGGCAAAGGCAGG - Intergenic
1162604205 19:11694574-11694596 CGGCGACTGCGGGCCCGGGCAGG - Intergenic
1162914009 19:13865008-13865030 GGGCGCGGGCGGGCACACGCAGG - Intronic
1162954496 19:14090770-14090792 CGGCGGCGGCGGGGAGGGGCCGG - Intronic
1163617925 19:18340744-18340766 CAGCGGCCGGGGGCAGAGGCGGG + Intronic
1164658646 19:29942712-29942734 CGGCGGCCCAGAGCACAGGCAGG - Intronic
1165120826 19:33557286-33557308 GGGCGGTGGCTGGCACAGGGAGG - Intergenic
1165129229 19:33621872-33621894 CGGCGGGGCGGGGCACGGGCCGG + Intergenic
1165213696 19:34254623-34254645 CGGGCGCGGCGGGCGCAGGCGGG + Intronic
1165420199 19:35718453-35718475 CGGGGGCGGCGTGGGCAGGCCGG + Intronic
1165796709 19:38523984-38524006 AGGCGGGGGCGTGCAGAGGCTGG - Intronic
1165922597 19:39308088-39308110 CGGCGACGGCGGGGGCAGCCTGG + Exonic
1166043576 19:40217110-40217132 CTGCAGCGGAGGGAACAGGCAGG - Intronic
1166219136 19:41353913-41353935 CGGCGGCGGCGGGGACCGGCTGG + Intronic
1166288820 19:41848769-41848791 CAGGGGCAGAGGGCACAGGCTGG - Intronic
1166307042 19:41940876-41940898 CGGCGGCGGCGGCGACAGGCGGG - Intergenic
1166358669 19:42242505-42242527 CGGCGGCGGCTGGGGCAGCCCGG - Exonic
1166546974 19:43639722-43639744 CGGCCGCGGCGGGGCCAGGTAGG - Exonic
1166807687 19:45496950-45496972 CGGCGGCGGCTGGAGCAGCCCGG - Exonic
1167002951 19:46756579-46756601 CAGCTGCGGGGGGCAGAGGCCGG + Exonic
1167019227 19:46861446-46861468 GGGCGGCGGCGGGGACAGCAGGG - Intergenic
1167037183 19:47001451-47001473 CGGCAGAGGCGGGCACAGAGTGG - Exonic
1167103842 19:47419327-47419349 CGGGGGCAGCAGGCGCAGGCGGG + Intronic
1167333126 19:48868626-48868648 CGTGGGCGGCTGGCAGAGGCAGG - Exonic
1167369651 19:49072825-49072847 CGGCGGCGGCGGGGCAGGGCAGG - Exonic
1168153538 19:54461324-54461346 CGCCGCAGGCGGGCACGGGCTGG - Exonic
1168696758 19:58408224-58408246 GGGCGGTTGCGGGCACAGGCGGG + Intronic
925430312 2:3786320-3786342 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430319 2:3786355-3786377 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430328 2:3786390-3786412 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430337 2:3786425-3786447 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430346 2:3786460-3786482 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430355 2:3786495-3786517 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430364 2:3786530-3786552 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430373 2:3786565-3786587 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430382 2:3786600-3786622 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430391 2:3786635-3786657 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430400 2:3786670-3786692 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925984956 2:9207549-9207571 GGGCGGCGGCGGGCGGCGGCGGG - Intronic
926130967 2:10302914-10302936 CGGCGGCGGCGGGCAGCGGACGG + Intronic
926154902 2:10448299-10448321 CGGCGGCGGCGGCTACAGGAGGG + Exonic
926166740 2:10525835-10525857 AGGCGCAGGCTGGCACAGGCGGG - Intergenic
926284978 2:11481933-11481955 CGGCGGCGGTGGGGAGAGGGCGG + Intergenic
926684640 2:15689572-15689594 CGGTGGAGGAGGGCAGAGGCAGG + Intergenic
929078224 2:38096067-38096089 CGGGGGCGGCGGGGAAGGGCGGG - Intronic
929218116 2:39437111-39437133 CGGCGGCGGCGGCCGCAGCGTGG - Exonic
929533810 2:42768107-42768129 TTGCAGCGGCGGGCACAGGGAGG - Intronic
931253676 2:60553304-60553326 CGGCGGCGGCGGGCGGACGACGG + Exonic
931348829 2:61470819-61470841 GGGCGGCGGCGGGGACGGGGCGG + Intergenic
932496599 2:72148663-72148685 CGGCGGCGGCGGCAGCGGGCGGG + Intergenic
932820706 2:74897498-74897520 CGGCGGCGGCGGGGAGGGGGAGG - Intergenic
933908023 2:86914183-86914205 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
933908034 2:86914211-86914233 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
933908069 2:86914307-86914329 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
933908143 2:86914518-86914540 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
934011428 2:87824733-87824755 CGGCGGCGGCGGCCTCGGCCTGG - Intronic
934011459 2:87824816-87824838 CGGCGGCGGCGGCCTCGGCCTGG - Intronic
934079121 2:88452466-88452488 CGGTGGCGGCGGGCGGGGGCAGG + Exonic
934604321 2:95682677-95682699 CGGCGGGGAGGGGCGCAGGCCGG - Intergenic
934978345 2:98821926-98821948 CGGCGTCGGGGGGCGCGGGCTGG + Exonic
935591884 2:104852530-104852552 TGGGGGCGGCGGGCGCAAGCGGG + Intergenic
936153912 2:110036118-110036140 CGGAGGAGGAGGGCCCAGGCTGG + Intergenic
936190773 2:110335297-110335319 CGGAGGAGGAGGGCCCAGGCTGG - Intergenic
936939637 2:117871058-117871080 CGGCGGCGGCGGGGAGAGGGAGG - Intergenic
937221580 2:120345579-120345601 CGCCGGCGGCGGAGACGGGCAGG - Intergenic
938038138 2:128053515-128053537 CGGCGGCGGCGGGGGCGGGTAGG - Intergenic
938074079 2:128322719-128322741 CGGGGGGGGCGGGCAAGGGCCGG - Intergenic
941384944 2:164841396-164841418 CGGCGGCGGCGCCCGCGGGCTGG - Exonic
941666422 2:168247540-168247562 CGGCGGCGGCGGCGGCGGGCGGG - Exonic
941951500 2:171160844-171160866 CGGCGGCGGCGGGCTGTGGGTGG + Intronic
941978935 2:171434153-171434175 GGGCCGCGGCAGGCAGAGGCAGG + Intronic
942241233 2:173965080-173965102 CGGCGGCAGCGGCCCCGGGCTGG + Intronic
942454804 2:176130336-176130358 CAGCGGCGGCGGCCCCGGGCGGG - Exonic
942890263 2:180980280-180980302 CCCCGGAGGCGGGCCCAGGCCGG + Intronic
946309272 2:218873719-218873741 CTGCGGCCGCGGGCACCGCCAGG + Exonic
946340030 2:219060754-219060776 CGGCGGCGGCGGGGGGCGGCGGG + Intergenic
947641056 2:231708109-231708131 AGGGGGCGGCGGGCACACGACGG - Intronic
948196608 2:236101508-236101530 CGGAAGAGGCGGGGACAGGCCGG - Intronic
948586059 2:239020575-239020597 GGGAGGCGGCGGTCACTGGCCGG + Intergenic
948855179 2:240727048-240727070 GAGCGGCTGGGGGCACAGGCTGG + Intronic
948892954 2:240916051-240916073 CTGCGCCGGCGGGTACAGGCAGG - Intergenic
948897161 2:240932891-240932913 CGGTGGCGGCGGGAACAGGTGGG + Intronic
948934020 2:241150640-241150662 GCGCGGCGGCGGCCAGAGGCAGG - Intronic
948945737 2:241218046-241218068 CGGCGGGGGCGGGCAGGGGCGGG + Intronic
1169204543 20:3732535-3732557 CGGCGGAGGCCCGCGCAGGCAGG + Intergenic
1172320810 20:33994022-33994044 CGGCTGCGGCGGGAAGAGGCTGG - Exonic
1172474464 20:35226692-35226714 CGGCGGCGGCGAAGGCAGGCGGG + Exonic
1172644518 20:36461518-36461540 CGGCGGCGGCGGCCAGCGGCGGG - Intronic
1173454181 20:43190068-43190090 CGCCCGCGGCTGGCACACGCGGG + Intergenic
1174258801 20:49278271-49278293 CGGAGCCGGCGGGCTCAGGCGGG + Intronic
1174494602 20:50930882-50930904 CGGCGGCGGCGGGCGGATGGCGG + Exonic
1174494735 20:50931319-50931341 AGGCGGCGGCGGCAACGGGCGGG + Intergenic
1175256694 20:57652238-57652260 CGGCAGCGGCGGGCGCATGGAGG - Exonic
1175383425 20:58579060-58579082 CGGTGGCTTCAGGCACAGGCAGG - Intergenic
1175429532 20:58891696-58891718 CGGCGGCGGCGGGGCGCGGCCGG - Intronic
1175443870 20:59007448-59007470 GGCCGGCGGCGGGGTCAGGCTGG - Intergenic
1175904375 20:62372333-62372355 TGGGGGAGGAGGGCACAGGCAGG - Intergenic
1176005848 20:62861888-62861910 CGGCGGCGGCGGGTAACGGAGGG - Intergenic
1176029881 20:63006796-63006818 CGGCAGCGGCGGGCTCGGGCCGG - Exonic
1176278210 20:64286471-64286493 CGGCGCAGGCGCGCACAGGCTGG - Intronic
1176380780 21:6111280-6111302 CGGCAGCGGCGGGCTCCGGGCGG + Intronic
1176382127 21:6118823-6118845 CTGCGGCTGCGGGCACAGCAAGG - Exonic
1176549286 21:8214470-8214492 CGGAGGGGGCGGGCTCCGGCGGG + Intergenic
1176550169 21:8217368-8217390 CGGCGGCGGCGGGCGGCGGAGGG + Intergenic
1176557179 21:8258693-8258715 CGGAGGGGGCGGGCTCCGGCGGG + Intergenic
1176568218 21:8397508-8397530 CGGAGGGGGCGGGCTCCGGCGGG + Intergenic
1176576121 21:8441728-8441750 CGGAGGGGGCGGGCTCCGGCGGG + Intergenic
1176577011 21:8444638-8444660 CGGCGGCGGCGGGCGGCGGAGGG + Intergenic
1176856673 21:13980214-13980236 CGGAGGCGGCACGCACTGGCAGG + Intergenic
1177894556 21:26844459-26844481 CGCTGGCGGCGGGCAGCGGCTGG + Exonic
1178334673 21:31732290-31732312 CGGCGGCCGCGGCCGCGGGCCGG + Intergenic
1178922443 21:36747657-36747679 CGGCGGCGGCGGGCGCTGCGGGG - Exonic
1179375461 21:40846769-40846791 CGGCGGCGGCGGGCGGCGGGCGG - Exonic
1179420993 21:41236717-41236739 CAGCTGCTGCGGGCACAGGCTGG + Intronic
1179511887 21:41878981-41879003 CCGCGGCGGCGGGACCCGGCGGG + Exonic
1179741345 21:43419416-43419438 CTGCGGCTGCGGGCACAGCAAGG + Exonic
1179742692 21:43426960-43426982 CGGCAGCGGCGGGCTCCGGGCGG - Intronic
1179783926 21:43719258-43719280 CGGCGGCGCGGGGCCGAGGCGGG - Exonic
1179897334 21:44370021-44370043 CGGGGGAGGCGGGCACACTCAGG + Intronic
1180005643 21:45019221-45019243 CGGCGGCGCTGGGAAGAGGCCGG + Intergenic
1180014444 21:45073472-45073494 CGGGGGCGGTGGGCAGAGCCAGG - Intergenic
1180908383 22:19431623-19431645 CGGCGGAGGGGGGCGCGGGCCGG - Exonic
1180914822 22:19478925-19478947 CGGCCGCACCGGGCACAAGCAGG - Intronic
1180953493 22:19731192-19731214 CCGCGGCGGTGTGCACAGCCCGG - Intergenic
1181166917 22:20988885-20988907 CGGAGGTGGGGTGCACAGGCCGG - Intronic
1181669654 22:24420258-24420280 CGGCGGCGGCGGGGCCAGCTGGG - Intronic
1182586365 22:31346217-31346239 CGGCGGCGGCTGGAGCGGGCGGG + Exonic
1182904020 22:33920946-33920968 CGGAGGCGGCGGGGCCAGCCCGG - Intronic
1183093622 22:35540077-35540099 AGGCGGCGGCTGGGACAGGCAGG + Intergenic
1183247220 22:36703249-36703271 CGGCGGCGGCGGCGGCAGGGCGG + Exonic
1183522393 22:38303102-38303124 GGGCGGCGGCGGGCGCCGGGTGG - Intronic
1183544285 22:38447430-38447452 GGGAGGTGGTGGGCACAGGCTGG - Intronic
1183578256 22:38706159-38706181 CGGCGGCGGCGGGCGCTGAGGGG + Intronic
1183744788 22:39686134-39686156 CGGGGGCGGCGGGCAGAAGAGGG - Exonic
1184004673 22:41699555-41699577 CGGCGACGGCGGGCACTCCCGGG + Exonic
1184372310 22:44090290-44090312 AGGAGGAGGGGGGCACAGGCTGG - Intronic
1184403465 22:44286964-44286986 CAGCGGTGGCGTGTACAGGCCGG - Intronic
1184412231 22:44331877-44331899 CGGCGGCGGCGGGCGCGGCGCGG - Intergenic
1184767030 22:46577386-46577408 CGGCGGCGGCGGGGAGAGCGCGG - Intronic
1184774856 22:46618058-46618080 TGGTGGCTGCGGGCTCAGGCTGG + Intronic
1185055112 22:48575388-48575410 AGACGGCGGCGGGCGCGGGCCGG + Intronic
1185247652 22:49781600-49781622 CGGCAGGGGCGGGCAGGGGCGGG - Intronic
1185346184 22:50311856-50311878 GGACGGGGGCGGGGACAGGCTGG - Exonic
1185389207 22:50549735-50549757 GGGCGGGGGCGGGCAGGGGCAGG - Exonic
1203254171 22_KI270733v1_random:130786-130808 CGGAGGGGGCGGGCTCCGGCGGG + Intergenic
1203255064 22_KI270733v1_random:133706-133728 CGGCGGCGGCGGGCGGCGGAGGG + Intergenic
1203262227 22_KI270733v1_random:175865-175887 CGGAGGGGGCGGGCTCCGGCGGG + Intergenic
1203263120 22_KI270733v1_random:178785-178807 CGGCGGCGGCGGGCGGCGGAGGG + Intergenic
949987524 3:9552698-9552720 CGGCGGCGGCGGCGGCTGGCGGG + Exonic
953485074 3:43286906-43286928 GGGCGGCGGCGGGGCCCGGCGGG + Intronic
954186193 3:48918887-48918909 CGGAGGCGGCGGGCCGACGCCGG - Exonic
956678028 3:71753682-71753704 CGGCGGCGGCGGGCCCGGCGGGG + Intronic
959539813 3:107525075-107525097 TGGCGGCGGCGCGCAGGGGCGGG - Intronic
960902224 3:122564434-122564456 CGGGGACGGCGGGCGCAGGTGGG - Exonic
961827525 3:129606753-129606775 CGGGGGCGGCTGGCGCGGGCAGG - Exonic
961827626 3:129606982-129607004 CGGCGGCGGCGGCTACGGGGAGG - Intergenic
961860977 3:129916693-129916715 CGGAGGCAGCAGGTACAGGCTGG - Intergenic
962738866 3:138348666-138348688 CGGCGGCCGCGGGGCCCGGCGGG + Intronic
963904451 3:150762651-150762673 CGGCGGCGGCGGGGCCGGCCCGG - Exonic
963904489 3:150762744-150762766 CGGCGGCCGGGGGCGCAGCCGGG + Exonic
964118558 3:153160711-153160733 CGGCGGCGGCGGGTGCGGGATGG - Intergenic
965757333 3:172040017-172040039 CTGAGGCAGGGGGCACAGGCGGG - Intronic
966866522 3:184261482-184261504 CGGCGGTGGCGGGGACCGGGCGG + Intronic
967859685 3:194141550-194141572 CGGCGGCGGCGGCGGGAGGCCGG + Intergenic
968083058 3:195860213-195860235 CCGAGGCGGCGGGCACGAGCCGG - Intergenic
968434071 4:576096-576118 GGGCGGCGGCGGGCGGCGGCGGG - Intergenic
968452368 4:681575-681597 CGGCGGCTGCAGCCACAGTCTGG - Intronic
968471916 4:786354-786376 GGGAGGCGGCGGGCGCGGGCAGG + Exonic
968542573 4:1175500-1175522 GGGCGGTGGTGGGCCCAGGCTGG + Intronic
968674734 4:1871421-1871443 CGGCGGCGGCGGGCGCAGCGCGG - Intronic
968701318 4:2059452-2059474 GGGCGGCGGCGGGCACGGCCGGG - Intergenic
968850484 4:3074606-3074628 CGGCGGAGGCGGGGCCACGCCGG - Intergenic
968957112 4:3725153-3725175 TGGCGCCGGGGGACACAGGCTGG - Intergenic
969330768 4:6472437-6472459 CGGCGGCCGCGGGTTCGGGCGGG + Intronic
969436685 4:7192880-7192902 CGGTGGCGGCGAGGACCGGCAGG + Exonic
969593334 4:8134039-8134061 CGGCTGCCATGGGCACAGGCGGG + Intronic
969716886 4:8872038-8872060 GGGCGGCCCCGGGCGCAGGCGGG + Intergenic
970332793 4:15002880-15002902 CGGCGGCGGCGCGGGCAGCCCGG + Exonic
972644432 4:40954218-40954240 CTGCTGCGGAGGGCACAGGAAGG + Intronic
972725870 4:41746091-41746113 CGGCGGCGGCGGGCCCAGCCCGG - Exonic
973279222 4:48341721-48341743 CGGCGGCGGCGGGGCCGGGATGG + Exonic
975701996 4:77075728-77075750 GAGCGGCGGCGGCCTCAGGCCGG - Exonic
975778967 4:77819622-77819644 CGGCGGCGGCGGCGACGGGGCGG + Intergenic
975801068 4:78059115-78059137 CGGCGGCGGCGGGCGCAGGGCGG + Intronic
975986024 4:80202332-80202354 CGGCGGCGGCGGCCACCAGGAGG + Exonic
979832042 4:125315658-125315680 CGGCGGCGGCGGCTGCAGGAGGG + Intergenic
984668070 4:182449099-182449121 CGGCGGCGGCGGCCTGGGGCGGG + Intronic
984952609 4:185018470-185018492 CAGCGGCCGCGGGCACCGGGGGG - Intergenic
985716178 5:1463292-1463314 CGGCGGCAGCGTGCACCGGGCGG - Exonic
986330579 5:6713838-6713860 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
988547777 5:32174248-32174270 CGGGGACTGCGGCCACAGGCAGG - Exonic
988825425 5:34930047-34930069 GGGCGGCTCCGGGCACTGGCCGG - Intronic
990910173 5:60844343-60844365 TGGCGGCGGCGGGCAGGGGGCGG - Exonic
991676563 5:69094297-69094319 CGGCGGCGGCGGCCTTGGGCCGG + Exonic
992052709 5:72955998-72956020 AGGCGGCGGCGGCGAAAGGCGGG + Exonic
992105791 5:73448224-73448246 CGGCGGTGGCGGGCCCCGGCTGG - Exonic
992487593 5:77210879-77210901 CGGCGGCCGCGGGCGCGGGCGGG + Exonic
992530140 5:77645309-77645331 CGGCGGCGGCGCGGGCCGGCTGG - Intergenic
993187202 5:84635754-84635776 CGATGGCGGGGGGCACAGGGAGG - Intergenic
993386552 5:87268574-87268596 AGGGGGCGGCTGCCACAGGCAGG - Exonic
994072736 5:95620479-95620501 CGGCGGCGGCGGGCCCTGGGCGG + Exonic
994353903 5:98774138-98774160 CAGCGGCGGGGGGCAGAGCCCGG - Exonic
995623748 5:114055470-114055492 CGGCGGCGGAGGGGAGAGCCGGG - Intergenic
996785058 5:127229348-127229370 CGGCTGCGGCGGGCCCGGGCGGG - Intergenic
997129606 5:131263904-131263926 CGGCGGGGGCGGGGCCTGGCGGG + Intronic
998203909 5:140145952-140145974 TGGCGGCGCCGGGGACACGCCGG - Intergenic
1000071405 5:157743957-157743979 CGGCGGGCGCGGGCGCGGGCGGG + Exonic
1000279899 5:159773412-159773434 CGGCGGCGGCGGCAGCAGCCGGG + Intergenic
1001065126 5:168529726-168529748 CGGCGGCGGTGGACAGCGGCGGG + Exonic
1001529915 5:172454524-172454546 CGGCGGCGGCTGGGCCCGGCTGG - Intergenic
1001556549 5:172641190-172641212 CGGAGCCGGCGGGCCCGGGCCGG + Intergenic
1002061927 5:176630313-176630335 CGGCTGCGGCGGGCGGACGCGGG + Exonic
1002897857 6:1389746-1389768 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
1002898162 6:1390856-1390878 CGGCGGCGGCGACTACGGGCCGG + Exonic
1003139168 6:3456777-3456799 GGGCAGAGGCGGGCAGAGGCCGG + Intronic
1003345271 6:5260924-5260946 CTTCGGGGGCGGGCGCAGGCAGG + Intronic
1003603665 6:7541478-7541500 CGCGGGCGGCGGGCGCAGGTGGG + Intergenic
1004690346 6:17987691-17987713 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1005562926 6:27059808-27059830 CGGGGGGGGGGGGCACAGGCAGG + Intergenic
1006180394 6:32150535-32150557 CGGCGGCAGCGGGCGGCGGCGGG + Exonic
1006472626 6:34237225-34237247 CGGCCGCGGCGGAGCCAGGCCGG + Exonic
1007406638 6:41639356-41639378 CAGGGGCGGCGGGGACTGGCCGG - Intronic
1007784067 6:44270457-44270479 AGGCGGCGGCGGGAGCGGGCGGG + Exonic
1007902334 6:45423162-45423184 GGGTGGCAGCGGGCACAGGTGGG - Intronic
1009975629 6:70667968-70667990 CGGCGGCGGCGGACGCTGGCTGG - Exonic
1010980185 6:82363273-82363295 AGGGGGCGGGGGGGACAGGCGGG + Intronic
1013293653 6:108739856-108739878 CGTCTGCAGCAGGCACAGGCTGG + Intergenic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1014246869 6:119078688-119078710 GGGCTGCGGCGGGGATAGGCGGG + Exonic
1014272312 6:119348978-119349000 CGGCGGCGGCGGTGGCAGGAAGG - Exonic
1015149033 6:130019095-130019117 CGGCCGCGTTGGGCTCAGGCTGG + Intronic
1015910166 6:138161830-138161852 CGGCGGCTGCGGGCTGGGGCCGG - Intergenic
1017174940 6:151494055-151494077 CGGCGGCGCCGGGAGCCGGCGGG - Exonic
1017545963 6:155450811-155450833 CTGTGGCAGGGGGCACAGGCAGG + Intronic
1017714448 6:157198885-157198907 CGGCTGCTGTGGGTACAGGCCGG - Exonic
1017793628 6:157823050-157823072 CGGCGGCGGCGGTGACTGCCCGG + Intronic
1017898951 6:158704342-158704364 CAGCGACGCGGGGCACAGGCGGG - Intronic
1018727924 6:166627608-166627630 CGGCGGCTGCGGGCACTGATTGG - Intronic
1018876649 6:167827290-167827312 CGGCGGCGGGGGGGAGGGGCGGG - Intronic
1018947570 6:168357620-168357642 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947588 6:168357674-168357696 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947760 6:168358224-168358246 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947778 6:168358278-168358300 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947965 6:168358883-168358905 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947983 6:168358937-168358959 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1019048914 6:169168432-169168454 GGGCGGCGGCGGCGCCAGGCAGG + Intergenic
1019111914 6:169723971-169723993 CGGCGGCGGCCGGGACAAGGCGG - Exonic
1019279298 7:192232-192254 TGGCGGCGGCGGCCCCGGGCGGG + Intergenic
1019474641 7:1238203-1238225 GGGCGGCTGCGGGCAGGGGCGGG - Intergenic
1019519790 7:1455427-1455449 CAGGGCAGGCGGGCACAGGCAGG + Intronic
1019594281 7:1851210-1851232 CGGCCTCGGCCGGCACAGGGTGG + Intronic
1019618778 7:1979408-1979430 CGGTGGCTGTGGGCACAGGGTGG - Intronic
1020080266 7:5282904-5282926 CGCGGGGGGCGGGCAGAGGCGGG + Intronic
1020210531 7:6154788-6154810 CGGCGGCCGCGAGCACGAGCGGG + Exonic
1020262117 7:6536464-6536486 CAGCGGCGGCTGGGAAAGGCGGG + Intronic
1020278313 7:6637526-6637548 CGGCGGCGGCGGGGCCGGGCTGG + Intronic
1021162925 7:17298638-17298660 CGGCGGCGGGAGGCAGTGGCTGG + Exonic
1022207605 7:28179779-28179801 CGGCGGCCGCGGGCGGGGGCCGG - Intronic
1022363317 7:29684848-29684870 CGGCGGCGGCCGGCACCGGCCGG - Intergenic
1022428008 7:30285729-30285751 CGGCGGCGGCCGGGACCGGCCGG + Exonic
1022698069 7:32728912-32728934 CGGCGGCGGCCAGCACCGGCCGG + Intergenic
1023348192 7:39293142-39293164 CGTCGGGGCCGGGCAGAGGCAGG - Intronic
1023945145 7:44796979-44797001 GGACGGCGGCGGACAAAGGCAGG + Intronic
1024296102 7:47843619-47843641 GGGCGGTGGGAGGCACAGGCAGG - Intronic
1025069719 7:55887716-55887738 CGGAGGCGGGGGGCGGAGGCGGG + Intronic
1025069726 7:55887729-55887751 CGGAGGCGGGGGGCGGAGGCGGG + Intronic
1025069733 7:55887742-55887764 CGGAGGCGGGGGGCGGAGGCGGG + Intronic
1025069740 7:55887755-55887777 CGGAGGCGGGGGGCGGAGGCGGG + Intronic
1025069747 7:55887768-55887790 CGGAGGCGGGGGGCGGAGGCGGG + Intronic
1025069754 7:55887781-55887803 CGGAGGCGGGGGGCGGAGGCGGG + Intronic
1025069782 7:55887845-55887867 CGGCGGCGGCGGGCGGCGGGCGG + Intronic
1025069799 7:55887893-55887915 CGGCGGCGGCGGGAGGCGGCAGG + Intronic
1025916929 7:65873356-65873378 CGGCGGCGGCGGGAAGATGGCGG + Exonic
1026765052 7:73155079-73155101 CGGCGGCGGCCGGGCCGGGCCGG - Intergenic
1026827931 7:73595742-73595764 CAGCTGCTGCTGGCACAGGCTGG + Exonic
1026909458 7:74083881-74083903 CGGGGGCGGAGGGCGCGGGCCGG - Intronic
1027041525 7:74964834-74964856 CGGCGGCGGCCGGGCCGGGCCGG - Exonic
1027082117 7:75237535-75237557 CGGCGGCGGCCGGGCCGGGCCGG + Intergenic
1029123186 7:98281708-98281730 CGGCGGCGGCGGGGACGCGGCGG - Exonic
1029154282 7:98503955-98503977 CGGCAGCCGCAGGCAGAGGCAGG + Intergenic
1029238742 7:99143836-99143858 CGGCGGCGGCGGGGCCGGGCCGG - Exonic
1029390697 7:100272081-100272103 CGGCGGCGGCCGGACCGGGCCGG + Exonic
1029640460 7:101816526-101816548 GGGCGGCGGCGGGCGCCGGGAGG + Intronic
1030117280 7:106071508-106071530 CGGGGAAGCCGGGCACAGGCTGG - Intergenic
1031899244 7:127392110-127392132 GGGCGGCCGCGGGGACAGCCTGG + Intronic
1032344360 7:131105946-131105968 GGGCGGCGGCGGGCGCGCGCGGG + Intergenic
1032391287 7:131556716-131556738 CGGCGGCGGCCGGGCCGGGCGGG + Intronic
1034129000 7:148698828-148698850 CGGCGGCGGCGGGAGGAGGAGGG + Intronic
1034445395 7:151111419-151111441 GGGCTGCAGCGGGCACAGCCAGG + Intronic
1034455497 7:151167808-151167830 CGGCGGCGGCGGGCGGAGGGAGG - Intronic
1034468887 7:151245473-151245495 CGGGGGCGGTGGGCACCGGCTGG + Exonic
1034469718 7:151248750-151248772 CGGCGGCGGCGGCGGCGGGCGGG - Exonic
1034522620 7:151632312-151632334 CGGCGGCGGCGGCCTCGGGCGGG - Intronic
1034977862 7:155458467-155458489 CGGCGGCGGCGGTAGCAGCCCGG + Exonic
1035221636 7:157409867-157409889 CGGCTTCGGCGGGCGGAGGCCGG - Exonic
1035264857 7:157685056-157685078 GGGCGGCGAGGGGCGCAGGCCGG - Intronic
1035266071 7:157690899-157690921 CGGCGCGGGCGGGCTCAGGGCGG + Intronic
1035476018 7:159144794-159144816 CGGAGGCGGCGGGCGCTGGGCGG - Exonic
1035512993 8:206523-206545 CGGCGGCGCAGCGCACAGACGGG + Intergenic
1035581037 8:738980-739002 CGGCGGCGTCGCGCAGGGGCTGG - Intergenic
1035717208 8:1763664-1763686 CGACGGCGGCGGGCGCGGGAGGG - Intronic
1035928470 8:3755531-3755553 CAGCTGCGGCGCTCACAGGCAGG - Intronic
1036910738 8:12755306-12755328 CGGCGGCAGCGGCCATCGGCTGG - Exonic
1039453949 8:37696039-37696061 CGGCGGCGGCGGGAAGAGGCCGG + Exonic
1039476452 8:37841626-37841648 CTGCGGCGGCGGGCAGGGCCCGG - Exonic
1040570238 8:48602134-48602156 AGGAGGAGGCGGGCACAAGCGGG - Intergenic
1041192272 8:55365991-55366013 CGGCTGCGGAGGGCACAGGCCGG + Intronic
1041673679 8:60517091-60517113 CGGCGGCGGCGGGCGGCGCCTGG + Exonic
1041709057 8:60876448-60876470 CGGCCGCGCTGGGCACAGGTGGG + Intergenic
1042859049 8:73295053-73295075 CTGCCGCGGCGGGCACAGTCCGG + Exonic
1042903001 8:73746888-73746910 GGGCGGAGGCGGGCGGAGGCGGG - Exonic
1049109664 8:140635298-140635320 CGGCGGCGGCGGGGCCGAGCCGG - Intronic
1049746845 8:144266624-144266646 CGGCGGCGCCGGGCGCAGCGTGG - Exonic
1049762273 8:144336902-144336924 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1049762277 8:144336908-144336930 CGGCGGCGGCGGGCGGGGGGCGG + Intergenic
1049793128 8:144482069-144482091 CGGCGGCGGCGGCGGCAGCCGGG - Intronic
1051146210 9:14030218-14030240 TGGCGGCGGCGGGGCCAGGGAGG + Intergenic
1051590816 9:18775831-18775853 AGGCAGGGGCGGGCACAGGGTGG - Exonic
1051774767 9:20621832-20621854 CGGGAGCTGCGGGCACAGTCCGG - Intronic
1053009360 9:34624611-34624633 CGGAGTCGGCGGGCCGAGGCGGG - Intronic
1053239933 9:36487389-36487411 CCGTGGCGGCGGGCTCCGGCCGG + Intronic
1056168405 9:83959933-83959955 GGGCGGCGGGGGGCTGAGGCAGG - Intergenic
1056788027 9:89606248-89606270 CGGTGGCGGCAGGGCCAGGCTGG + Exonic
1057546015 9:96021062-96021084 CGCCTGCGCCGGGCACAGGGAGG + Intergenic
1057596146 9:96417729-96417751 CGGCGGCTGCGGCTGCAGGCAGG + Exonic
1060389941 9:123268741-123268763 AGGCGGCGGCGGGCGCTGGCCGG - Intergenic
1060811683 9:126614093-126614115 CGGTGGCGGCGGCGGCAGGCGGG - Intergenic
1060849174 9:126860625-126860647 CGGGGGCGGGGGGCGCGGGCTGG + Intergenic
1060940825 9:127542012-127542034 TGGCTGCGGCGGGCACAGGACGG - Intronic
1061541048 9:131277949-131277971 CGGCGGCGGCGAGCGGACGCGGG - Intergenic
1061541084 9:131278045-131278067 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1061991791 9:134163349-134163371 CGGCTGCGGCGGGGCGAGGCCGG - Intergenic
1062412175 9:136431151-136431173 GTGCGGCGGCTGGCACAAGCTGG - Intronic
1062431080 9:136527147-136527169 AGACTGGGGCGGGCACAGGCTGG - Intronic
1062467316 9:136687019-136687041 GGCCGGCGGCAGGCACAGGAGGG - Intronic
1203470572 Un_GL000220v1:113930-113952 CGGAGGGGGCGGGCTCCGGCGGG + Intergenic
1203478393 Un_GL000220v1:157902-157924 CGGAGGGGGCGGGCTCCGGCGGG + Intergenic
1185747275 X:2583582-2583604 CACCGGTGGCGGCCACAGGCGGG + Intergenic
1186107836 X:6226460-6226482 CGGCGGGGGCGGGAGCAGGGGGG - Intronic
1187464466 X:19515184-19515206 CGGCGGCGGCGGGCACTGAGGGG + Exonic
1189035684 X:37492004-37492026 CGGCGACAGCGGGCCCAGGGCGG - Intronic
1189377103 X:40474655-40474677 CGGGGGGGGCGGGCAGAGGGGGG + Intergenic
1190115530 X:47624013-47624035 TGGCAGCGGCGGGGAGAGGCTGG + Intergenic
1190533984 X:51407938-51407960 CGGCCTCGGCGGGCAGAGCCTGG - Exonic
1192358200 X:70422991-70423013 CGAGGGCTGAGGGCACAGGCTGG - Intergenic
1194977680 X:100410212-100410234 CGGCGGCGGCTGGCGCAGCGCGG - Exonic
1197774458 X:130110516-130110538 CGGCGGCCGCGGGGACCGACCGG - Intronic
1198310214 X:135422462-135422484 CCGCGGCGGGGGGCGGAGGCGGG + Intergenic
1199500407 X:148500783-148500805 CAGCCGCTGCGGGCTCAGGCGGG - Exonic
1199772596 X:150984039-150984061 CGGCGGCGGCGGCGCCGGGCGGG - Intronic
1200047804 X:153411794-153411816 CTGCGGCGGCGGCGACAAGCAGG + Intergenic
1200100753 X:153688294-153688316 GGGCGGCGGCGGGGCCCGGCCGG - Exonic
1200129148 X:153831486-153831508 GGTAGGCGGCGGGCCCAGGCTGG - Intergenic
1200233600 X:154458166-154458188 CGGCGGCAGGGGACGCAGGCGGG - Intergenic