ID: 1125487037

View in Genome Browser
Species Human (GRCh38)
Location 15:40118643-40118665
Sequence TTGGCTCCTTCAGTGGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125487037_1125487043 -1 Left 1125487037 15:40118643-40118665 CCAGGGGCCACTGAAGGAGCCAA No data
Right 1125487043 15:40118665-40118687 AGATTCCTCGGGGATTTAATTGG No data
1125487037_1125487045 3 Left 1125487037 15:40118643-40118665 CCAGGGGCCACTGAAGGAGCCAA No data
Right 1125487045 15:40118669-40118691 TCCTCGGGGATTTAATTGGGTGG No data
1125487037_1125487044 0 Left 1125487037 15:40118643-40118665 CCAGGGGCCACTGAAGGAGCCAA No data
Right 1125487044 15:40118666-40118688 GATTCCTCGGGGATTTAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125487037 Original CRISPR TTGGCTCCTTCAGTGGCCCC TGG (reversed) Intergenic
No off target data available for this crispr