ID: 1125488175

View in Genome Browser
Species Human (GRCh38)
Location 15:40126812-40126834
Sequence GTGCACACCCTCTGCCATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125488175_1125488179 10 Left 1125488175 15:40126812-40126834 CCAATATGGCAGAGGGTGTGCAC No data
Right 1125488179 15:40126845-40126867 TATTGTTCCTAATATCAAGCAGG No data
1125488175_1125488180 11 Left 1125488175 15:40126812-40126834 CCAATATGGCAGAGGGTGTGCAC No data
Right 1125488180 15:40126846-40126868 ATTGTTCCTAATATCAAGCAGGG No data
1125488175_1125488181 12 Left 1125488175 15:40126812-40126834 CCAATATGGCAGAGGGTGTGCAC No data
Right 1125488181 15:40126847-40126869 TTGTTCCTAATATCAAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125488175 Original CRISPR GTGCACACCCTCTGCCATAT TGG (reversed) Intergenic
No off target data available for this crispr