ID: 1125489003

View in Genome Browser
Species Human (GRCh38)
Location 15:40132719-40132741
Sequence CCTAATATCCAGCGGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125488999_1125489003 -9 Left 1125488999 15:40132705-40132727 CCTGTGATATTGTTCCTAATATC No data
Right 1125489003 15:40132719-40132741 CCTAATATCCAGCGGGAAACAGG No data
1125488997_1125489003 -7 Left 1125488997 15:40132703-40132725 CCCCTGTGATATTGTTCCTAATA No data
Right 1125489003 15:40132719-40132741 CCTAATATCCAGCGGGAAACAGG No data
1125488998_1125489003 -8 Left 1125488998 15:40132704-40132726 CCCTGTGATATTGTTCCTAATAT No data
Right 1125489003 15:40132719-40132741 CCTAATATCCAGCGGGAAACAGG No data
1125488995_1125489003 -1 Left 1125488995 15:40132697-40132719 CCATACCCCCTGTGATATTGTTC No data
Right 1125489003 15:40132719-40132741 CCTAATATCCAGCGGGAAACAGG No data
1125488996_1125489003 -6 Left 1125488996 15:40132702-40132724 CCCCCTGTGATATTGTTCCTAAT No data
Right 1125489003 15:40132719-40132741 CCTAATATCCAGCGGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125489003 Original CRISPR CCTAATATCCAGCGGGAAAC AGG Intergenic
No off target data available for this crispr