ID: 1125489234

View in Genome Browser
Species Human (GRCh38)
Location 15:40134488-40134510
Sequence TTGGTGAAGGCAATAATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125489234 Original CRISPR TTGGTGAAGGCAATAATAAT TGG Intergenic
909332027 1:74425012-74425034 TTGGTGCAGGCTAGAATATTTGG + Intronic
909596973 1:77417072-77417094 TTGCTGAAGGTAAGAAAAATCGG - Intronic
913116241 1:115700264-115700286 TTGGCCAGGGCAACAATAATTGG - Exonic
916446088 1:164873172-164873194 TGGATGAAGGCAAAAATAGTAGG - Intronic
916584516 1:166138866-166138888 TTGTTGAATGAATTAATAATTGG + Intronic
917289291 1:173455576-173455598 GTGGAGAAGGCAAAAATAACAGG + Intergenic
917362621 1:174193741-174193763 TTGGGGAAGGGAGTATTAATAGG + Intronic
917642797 1:176999042-176999064 AAGGTGAAGACAATAATAATAGG - Intronic
917652991 1:177097265-177097287 TTGGAGAAAAAAATAATAATGGG - Intronic
921613574 1:217240538-217240560 TTGATGAAGGCAATTTAAATGGG - Intergenic
922392314 1:225157349-225157371 ATGATGAAGACAATCATAATGGG + Intronic
1065815342 10:29478166-29478188 TTGCCAAAGACAATAATAATAGG - Intronic
1066539860 10:36434411-36434433 TTGATGAAGGTAATAATGATTGG + Intergenic
1068472986 10:57489072-57489094 TTGCTGAAGGAAATAAAAAAAGG + Intergenic
1072218706 10:93309543-93309565 TAGGTAAGGGCAATAATATTTGG + Intronic
1074014608 10:109521344-109521366 TAGGTGAGGGCATTATTAATAGG - Intergenic
1075357664 10:121796414-121796436 TTGGTGAAGTCAGGAATCATAGG - Intronic
1077723786 11:4653059-4653081 TTGGTGTAGGCAGTAGGAATGGG - Exonic
1078723349 11:13904333-13904355 TTGGTGAAGGTAACAACAGTGGG - Intergenic
1078742096 11:14076394-14076416 TCGGGGAAAACAATAATAATAGG + Intronic
1079821264 11:25132932-25132954 TTAATGAAGGCATAAATAATTGG - Intergenic
1081359421 11:42156133-42156155 TTTCTGAAAGAAATAATAATTGG + Intergenic
1081627819 11:44666061-44666083 TTTGTGAAAGCAAGAATAAGAGG + Intergenic
1083581127 11:63826347-63826369 ATGGAGAAGGCACTCATAATGGG - Intronic
1085968153 11:81554158-81554180 TTGGTTAAGATAGTAATAATCGG - Intergenic
1087450279 11:98312235-98312257 TTGGTGATGGCAGTGATAATAGG + Intergenic
1090337143 11:125978231-125978253 TTGCTGAAGGGAAAAATAAAAGG + Intronic
1091561326 12:1616239-1616261 TTGGTGAAGGCTGCAATGATGGG - Intronic
1092072830 12:5647111-5647133 TTGGGGAAGGCAAAAATCAGAGG - Intronic
1093073769 12:14735792-14735814 TTGGTGAAGGAAACAATGGTAGG - Intergenic
1093083858 12:14844778-14844800 TTGGTGCAAATAATAATAATTGG - Intronic
1095363751 12:41376324-41376346 TTGTTGATGGGAATAAAAATTGG - Intronic
1096066982 12:48748894-48748916 TTGGAGAAGGCAAAAAGAAATGG - Intergenic
1097500758 12:60398419-60398441 TTGATTATGGCAATATTAATAGG - Intergenic
1104798861 12:131539552-131539574 TTGGTGATGACGATCATAATAGG + Intergenic
1107370967 13:39747094-39747116 TTGTTCAAGGCAACAATAAGTGG + Intronic
1109279160 13:60336283-60336305 CTGGTGAAGGCACTAATATAGGG + Intergenic
1115805513 14:37046733-37046755 TTGGTGGAGGAAATAAAAAAGGG - Intronic
1116321357 14:43468601-43468623 TTAGATAAAGCAATAATAATAGG + Intergenic
1118456932 14:65953155-65953177 TTGGTGCTGGCAACAATAAGTGG + Intergenic
1118735438 14:68697565-68697587 TTGGAAAAGGCAAAACTAATGGG - Intronic
1120370484 14:83627955-83627977 TATGTGAAGACAATAAAAATAGG + Intergenic
1124673028 15:31658343-31658365 TTGCTGAAGGCAGGAATAAGGGG + Intronic
1125489234 15:40134488-40134510 TTGGTGAAGGCAATAATAATTGG + Intergenic
1127351040 15:58152655-58152677 TTGGCTAAGGTAGTAATAATTGG - Intronic
1129233625 15:74210257-74210279 TTTGTAATGGCAAAAATAATTGG + Intronic
1131940011 15:97552053-97552075 TTGGTGAGGGGAATTAGAATAGG - Intergenic
1132010547 15:98272329-98272351 TTGGAGGTGGCAAAAATAATCGG - Intergenic
1132052820 15:98623980-98624002 TTGTTGATGGCAATAAAAATGGG + Intergenic
1133088213 16:3382215-3382237 ATGATGAGGGCAATAATAAAAGG + Exonic
1133992686 16:10721421-10721443 TTGGCTAAGGTGATAATAATTGG + Intergenic
1135232478 16:20722211-20722233 CTGGTTAAGGTAACAATAATTGG + Intronic
1135243633 16:20834537-20834559 GTGGTGAAAGAAAAAATAATGGG - Intronic
1138982824 16:62291477-62291499 TTGTTGAAGGAAATACTAAAAGG + Intergenic
1139904389 16:70353595-70353617 TTGCTGATGGAAATATTAATTGG + Intronic
1139904511 16:70354448-70354470 TTGCTGATGGAAATATTAATTGG - Intronic
1147480618 17:40758519-40758541 TTGATGAAGACAAAAATAAATGG - Intergenic
1148960392 17:51387608-51387630 TTGGTGAGGGCAAGAATTTTAGG + Intergenic
1149558317 17:57589992-57590014 TTGGGGAAAGCAATATTCATGGG - Intronic
1154303738 18:13216819-13216841 TTGGTGACTGCAATAAAATTGGG + Intergenic
1155362082 18:25013543-25013565 ATAGTGAAGGAAATCATAATAGG - Intergenic
1156174589 18:34528452-34528474 TTGCTGAAGGTGAAAATAATAGG - Intronic
1156924304 18:42557514-42557536 TTGGAGAAGACAGTAAGAATAGG + Intergenic
1157050685 18:44160606-44160628 TTGGTTAAGGCTAGAAAAATAGG + Intergenic
1157343983 18:46806774-46806796 TTGATGAAGGCCAAAATAAGAGG + Intergenic
1158364900 18:56723102-56723124 TTGCTCTAGTCAATAATAATTGG + Intronic
1160426974 18:78784624-78784646 TTGTTAAAAGCAACAATAATAGG + Intergenic
1160591929 18:79949929-79949951 TTGTTGAAGGCAGACATAATTGG - Intronic
1161227175 19:3152069-3152091 TTGGAGGAGGGAATATTAATGGG + Intronic
1166429420 19:42711678-42711700 TGGGTGAGGGCAAGAAAAATGGG + Intronic
1166450834 19:42899419-42899441 TGGGTGAGGGCAAGAAAAATGGG + Intronic
1166462740 19:43003764-43003786 TGGGTGAGGGCAAGAAAAATGGG + Intronic
1166468882 19:43060222-43060244 TGGGTGAGGGCAAGAAAAATGGG + Intronic
1166480028 19:43163743-43163765 TGGGTGAGGGCAAGAAAAATGGG + Intronic
1166489849 19:43249274-43249296 TGGGTGAGGGCAAGAAAAATGGG + Intronic
1168109961 19:54186782-54186804 TTGGTGAAGGGAACAAAACTAGG - Intronic
925569269 2:5291708-5291730 TTGCTCAAGGAGATAATAATGGG - Intergenic
928938792 2:36707080-36707102 CTAGAGAAGGCTATAATAATAGG - Intronic
929386406 2:41412617-41412639 TTTGTTAAGGCAATAATTATAGG - Intergenic
930167677 2:48219413-48219435 TTGGTGATGGCAATCATGCTTGG - Intergenic
930417757 2:51110529-51110551 TTGGTTAAGGCAAAAAGAAATGG + Intergenic
933477852 2:82815778-82815800 TTGGTTAAGGTAATAGTAATTGG - Intergenic
938309645 2:130280338-130280360 TTTATGAAGGTAATAATAATTGG - Intergenic
938445281 2:131372029-131372051 TTGATGAAGGTAATAATAATTGG + Intergenic
938639214 2:133262855-133262877 TGGGTGATGGCACAAATAATAGG + Intronic
940485359 2:154289848-154289870 TTGGTGAAGGACAGAATAAGTGG - Intronic
941059499 2:160829345-160829367 TGGGTGAAGGCAATAATAGATGG - Intergenic
944590521 2:201213014-201213036 TTGATAAAGGTAATAATAATTGG + Intronic
1169479054 20:5961065-5961087 TTGGTGAAGGGCATAAAACTAGG + Intronic
1169975547 20:11323207-11323229 TTGGTGAAGGCACGAAAAAGAGG + Intergenic
1170135912 20:13073574-13073596 TTGGTGGAAGGAATAATAGTGGG + Intronic
1170524292 20:17222952-17222974 TTGGTGAAAGCTATAGGAATTGG + Intergenic
1170933235 20:20787722-20787744 TTGGTGGTGGTAATAATAACAGG + Intergenic
1177949315 21:27514166-27514188 TAGCTGAAAGCAATAATAATGGG - Intergenic
1178569536 21:33722928-33722950 TGGGTGAAGCCAAAACTAATTGG - Intronic
949098067 3:110334-110356 TTGGTGAAGGCGACAATATCAGG - Intergenic
951275098 3:20675604-20675626 TTGGTTAAGCCACTAATATTAGG - Intergenic
951382880 3:22006720-22006742 TTTGTGAAAACAATAAAAATTGG + Intronic
951610093 3:24481909-24481931 TTGCAAAAGGTAATAATAATAGG - Intronic
956631130 3:71317231-71317253 GGGTTGAAGGAAATAATAATGGG - Intronic
959280651 3:104334304-104334326 TTGGAGCAGGAAATTATAATTGG + Intergenic
960755817 3:121010990-121011012 TTGGTGAAAGAAATATTATTTGG + Intronic
962795907 3:138849457-138849479 GTTGTGACAGCAATAATAATAGG + Intergenic
963502452 3:146145186-146145208 TTGATGAAGACAAAAATATTTGG - Intronic
964989440 3:162788893-162788915 TTGGTGAAGTTAAAACTAATTGG - Intergenic
966321758 3:178708733-178708755 TTGTAAAAGGGAATAATAATAGG - Intronic
968586857 4:1421988-1422010 TTGGAAAAGTCAATAAAAATAGG - Intergenic
970831024 4:20340018-20340040 TTGGAGAAGGCAAGATTGATGGG - Intronic
972598087 4:40547853-40547875 TTGTTGAAAGCATTAATAATGGG - Intronic
974138513 4:57851179-57851201 TAGGTGAAGGAAATAGAAATGGG + Intergenic
974761314 4:66277866-66277888 TTGATGAAGGAAAAAGTAATTGG + Intergenic
975883057 4:78933841-78933863 GTGGTGAAGGCATAAAGAATAGG + Intronic
976132902 4:81903952-81903974 TTGGTGGAGGCAAGAGCAATGGG - Intronic
977186510 4:93945051-93945073 TTGGTTAAGCCAACAATAAAAGG - Intergenic
980091508 4:128447710-128447732 ATGGTGAATGTAAGAATAATGGG + Intergenic
980478084 4:133346560-133346582 GTGGTGATGGTAATAGTAATTGG + Intergenic
980560614 4:134468746-134468768 TTGGGGAAGGCAAGAATATTGGG + Intergenic
980647348 4:135659434-135659456 TTAGTGAAGACACTAATAAATGG - Intergenic
981142150 4:141281576-141281598 TTGCTGAAGACAATAATATATGG + Intergenic
982565620 4:156982911-156982933 TTGCTAAAGGCAATATTACTTGG + Intergenic
982913556 4:161176170-161176192 TGGGTGAGGGAAATAAAAATAGG + Intergenic
983057323 4:163113311-163113333 GTGGAGAAGTGAATAATAATTGG - Intronic
983848831 4:172554096-172554118 TTGTTGAAGGCAATGGCAATTGG - Intronic
984453049 4:179928253-179928275 TTGCTTAAGGCAGGAATAATGGG + Intergenic
986176555 5:5357262-5357284 TTAGTCAAGGTAATAATATTTGG - Intergenic
989518193 5:42368521-42368543 TTGCTAAAGGGAATAAAAATTGG + Intergenic
990937884 5:61169740-61169762 TTGGTGAAGGCAATCGTGCTAGG - Intergenic
991059591 5:62359414-62359436 TTGGTGAAGACAAAAAGAGTTGG - Intronic
991923637 5:71682576-71682598 TAGGTGGGGGCAATAATAGTTGG + Intergenic
992308394 5:75467138-75467160 TTGCTGAATGCATCAATAATTGG - Intronic
992689528 5:79229155-79229177 TTGGTGGGGGCTATGATAATGGG + Intronic
993289795 5:86052378-86052400 TTGGTTATGACAATATTAATAGG - Intergenic
994523384 5:100871828-100871850 TCAGTGAGGTCAATAATAATAGG - Intronic
995055076 5:107750224-107750246 TCTGTGAAGGAAATAATGATTGG - Intergenic
997254221 5:132415484-132415506 TAAATGAAGGCAATCATAATAGG - Intronic
999464120 5:151785304-151785326 TTGGTGAAATAAATACTAATTGG + Intronic
1001225110 5:169937521-169937543 TTAGTAAAAGCAATGATAATAGG + Intronic
1003222186 6:4170886-4170908 TTGGTTCAGGCAACAAAAATAGG - Intergenic
1004099804 6:12597583-12597605 TAGGTGATGGCAAAAATAAATGG - Intergenic
1011854502 6:91672421-91672443 TTGGTGCAGGCTGTAAAAATAGG - Intergenic
1012331344 6:97992164-97992186 TTGGTTAAGAAAATAACAATGGG + Intergenic
1014314601 6:119847872-119847894 TTGGGGAATGCAATAATTAAAGG + Intergenic
1014339348 6:120183618-120183640 TTGATGAGGGCAAAAATAAATGG - Intergenic
1015035122 6:128644407-128644429 TTGATGAAGGAAAGAATACTAGG + Intergenic
1015141701 6:129941576-129941598 TCCGTGAAGGTAAAAATAATAGG + Intergenic
1015176297 6:130312750-130312772 TTGTTGAAGACAGTAATTATAGG + Intronic
1016309691 6:142720511-142720533 ATATTGAAGACAATAATAATTGG - Intergenic
1016852983 6:148640336-148640358 TTGGAGAAGGGAATAAGAAGAGG - Intergenic
1017361009 6:153571423-153571445 CTGGTGAATGCAAAATTAATTGG - Intergenic
1018139787 6:160819609-160819631 TAGGTAAAGGCCAAAATAATCGG - Intergenic
1018493924 6:164327881-164327903 TTGTTCAAGGCACTAATTATGGG + Intergenic
1021533409 7:21674976-21674998 TTGGAGAAGGCAGTGAGAATAGG - Intronic
1026648724 7:72195758-72195780 TTGGTGAAGGAATTAATCAGTGG + Intronic
1027808961 7:82867701-82867723 TTGATGAAGGCAATCAAATTAGG + Intronic
1031181591 7:118424814-118424836 TTGGTGAAGTTAATAAAAACTGG + Intergenic
1036537607 8:9665781-9665803 AAGGTGCATGCAATAATAATGGG - Intronic
1037089705 8:14898550-14898572 TTGGTAAAAGCAAGAATAATGGG + Intronic
1037129660 8:15392063-15392085 TTGGTGAAGGTACTATTACTGGG - Intergenic
1038015387 8:23510260-23510282 TTAGAGAAGGAAATAAAAATGGG - Intergenic
1039128131 8:34228057-34228079 TTGGTGGTGGCAACAATATTGGG + Intergenic
1039713483 8:40083300-40083322 TTGGTGAGGACAGAAATAATTGG - Intergenic
1039930299 8:41980752-41980774 TTGTTAAATGAAATAATAATTGG - Intronic
1040809116 8:51430771-51430793 TTGTTGAATGAAATAATAATGGG - Intronic
1042058569 8:64792348-64792370 TTGCAGAAGGCACTAATATTAGG + Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1044217727 8:89632485-89632507 TTGGTAAAGGCAATCCTCATAGG + Intergenic
1045514386 8:102844369-102844391 TAGGTGAAAGTAATAAAAATGGG + Intronic
1046563750 8:115872057-115872079 TAGGTGAAGACAATGTTAATTGG + Intergenic
1046765741 8:118067612-118067634 GTGGTCAAGTCAATACTAATTGG + Intronic
1048394897 8:134004653-134004675 TGGCTGAAGGAAATAGTAATAGG + Intergenic
1050038380 9:1461803-1461825 TTGGTAAATGCACAAATAATGGG - Intergenic
1050940850 9:11454938-11454960 TTGATTAAGGCAATAATTATTGG + Intergenic
1051395416 9:16615136-16615158 TTAATTATGGCAATAATAATGGG - Intronic
1053945616 9:43307489-43307511 CTGGTGATAGCAATAATGATTGG + Intergenic
1055228416 9:74030151-74030173 TTTGTATAGTCAATAATAATTGG + Intergenic
1056881845 9:90402121-90402143 TTGTTTAAAGCAAAAATAATGGG + Intergenic
1057254620 9:93534835-93534857 TTGGTGAAGGCAGGAAGGATTGG + Intronic
1059937501 9:119325784-119325806 TTGTTGAAGGCAAGACTAAGGGG - Intronic
1060334315 9:122706899-122706921 TTGGAGTAGGGAATAAGAATGGG + Intergenic
1203588751 Un_KI270747v1:36069-36091 CTGGTGATAGCAATAATGATTGG + Intergenic
1185842820 X:3408821-3408843 TTGGTGAAGGAACTTATTATGGG - Intergenic
1186951624 X:14632501-14632523 TTTGTAAAGGAATTAATAATTGG + Intronic
1187108880 X:16274955-16274977 TTGCTGAAGGAAATAATAGATGG - Intergenic
1188024282 X:25192727-25192749 TTGTTGAAGGGAATAATGTTAGG + Intergenic
1188562604 X:31486492-31486514 TTGAAGAAGGCAATGCTAATGGG - Intronic
1189404664 X:40710249-40710271 TTTGTGGAGGGAATAATAATGGG + Intronic
1189732168 X:44032998-44033020 CTGGTGCAGGCAACAATAAATGG - Intergenic
1191226603 X:58050590-58050612 TGGGTGAGGGCTATAATGATGGG + Intergenic
1194482603 X:94445485-94445507 TTTGTGAAGGCACTTATGATGGG + Intergenic
1197588104 X:128374411-128374433 TGGGTGAAGGCTATAAAAGTTGG - Intergenic
1198044171 X:132883483-132883505 TTGGTTAACGCAATAAAAAATGG - Intronic
1199304263 X:146248762-146248784 ATAGTGAAAGCAATATTAATGGG + Intergenic
1200311534 X:155083569-155083591 TTGTTGAAAGAAATAATAATGGG - Intronic
1200373186 X:155749644-155749666 GAGGTGAGGGCAATAAGAATAGG + Intergenic