ID: 1125492168

View in Genome Browser
Species Human (GRCh38)
Location 15:40156452-40156474
Sequence GGCTGACTACTGCCAGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125492168_1125492173 14 Left 1125492168 15:40156452-40156474 CCCACAGCTGGCAGTAGTCAGCC No data
Right 1125492173 15:40156489-40156511 TCTTCCTCATTGACAACAAAGGG No data
1125492168_1125492172 13 Left 1125492168 15:40156452-40156474 CCCACAGCTGGCAGTAGTCAGCC No data
Right 1125492172 15:40156488-40156510 ATCTTCCTCATTGACAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125492168 Original CRISPR GGCTGACTACTGCCAGCTGT GGG (reversed) Intergenic
No off target data available for this crispr