ID: 1125492169

View in Genome Browser
Species Human (GRCh38)
Location 15:40156453-40156475
Sequence AGGCTGACTACTGCCAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125492169_1125492172 12 Left 1125492169 15:40156453-40156475 CCACAGCTGGCAGTAGTCAGCCT No data
Right 1125492172 15:40156488-40156510 ATCTTCCTCATTGACAACAAAGG No data
1125492169_1125492173 13 Left 1125492169 15:40156453-40156475 CCACAGCTGGCAGTAGTCAGCCT No data
Right 1125492173 15:40156489-40156511 TCTTCCTCATTGACAACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125492169 Original CRISPR AGGCTGACTACTGCCAGCTG TGG (reversed) Intergenic
No off target data available for this crispr