ID: 1125492173

View in Genome Browser
Species Human (GRCh38)
Location 15:40156489-40156511
Sequence TCTTCCTCATTGACAACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125492168_1125492173 14 Left 1125492168 15:40156452-40156474 CCCACAGCTGGCAGTAGTCAGCC No data
Right 1125492173 15:40156489-40156511 TCTTCCTCATTGACAACAAAGGG No data
1125492170_1125492173 -7 Left 1125492170 15:40156473-40156495 CCTCTCAAATGCCACATCTTCCT No data
Right 1125492173 15:40156489-40156511 TCTTCCTCATTGACAACAAAGGG No data
1125492166_1125492173 26 Left 1125492166 15:40156440-40156462 CCAGGCACACATCCCACAGCTGG No data
Right 1125492173 15:40156489-40156511 TCTTCCTCATTGACAACAAAGGG No data
1125492169_1125492173 13 Left 1125492169 15:40156453-40156475 CCACAGCTGGCAGTAGTCAGCCT No data
Right 1125492173 15:40156489-40156511 TCTTCCTCATTGACAACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125492173 Original CRISPR TCTTCCTCATTGACAACAAA GGG Intergenic
No off target data available for this crispr