ID: 1125497127

View in Genome Browser
Species Human (GRCh38)
Location 15:40207221-40207243
Sequence CAGGGTCTGACACTTGTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125497127 Original CRISPR CAGGGTCTGACACTTGTTTT AGG Intronic
901885336 1:12218718-12218740 CTGGGTTTGACACTTATCTTAGG + Intergenic
902709851 1:18231170-18231192 CTGGGCTTGACACATGTTTTGGG - Intronic
903187917 1:21639776-21639798 CAGCGTCTGACACTTTTCCTGGG + Intronic
903465380 1:23548816-23548838 CAGGCTCTGACACTTGGGCTAGG + Intergenic
910160720 1:84269665-84269687 CAGGGTCTCACAGCTTTTTTAGG - Intergenic
914220645 1:145678903-145678925 AAGCGTCTGACATTTGATTTTGG + Intronic
915764865 1:158352830-158352852 TAGGGCCTGGCAATTGTTTTTGG + Intergenic
916889759 1:169104490-169104512 TAAGGTAGGACACTTGTTTTAGG + Intergenic
922875385 1:228936307-228936329 CAGGGTTTGACCTTTGATTTGGG - Intergenic
924821000 1:247490735-247490757 CTGAGTCTGAGAGTTGTTTTTGG - Intergenic
1070649526 10:78224894-78224916 CAGGGCCTGATACAAGTTTTTGG + Intergenic
1070755989 10:78993661-78993683 CAGGGTCTGACAGTTGTAGGGGG - Intergenic
1072284250 10:93897554-93897576 CAGTGTGTGACCTTTGTTTTAGG + Intronic
1074392360 10:113068941-113068963 CAGGGCCTAACTCTTGTTCTTGG - Intronic
1076672642 10:132131560-132131582 CAGCCTCTGACTCTTGTTTGTGG + Intronic
1077961797 11:7083596-7083618 CAGTGTCTGTCTCTTATTTTTGG + Intergenic
1078591357 11:12642863-12642885 CAGGGTCTCACAGTGATTTTGGG + Intergenic
1079084522 11:17435770-17435792 TGGGGTCTGACACTTGATGTGGG - Intronic
1079143274 11:17828496-17828518 GAGGATCTGGCACTTATTTTAGG + Intronic
1080296387 11:30734486-30734508 CTGGGTCTGATACTTTCTTTTGG - Intergenic
1080819726 11:35793769-35793791 CATGGCCTGGCTCTTGTTTTTGG - Intronic
1081844077 11:46225910-46225932 CTGGACCTGACACTTTTTTTGGG - Intergenic
1082728982 11:56772146-56772168 CAGGCTCTGTCACTTGGTTTAGG - Intergenic
1083379209 11:62251147-62251169 CAGGGGCTGACACCTGATTCTGG + Intergenic
1083982816 11:66187631-66187653 CAGGATCTCACACTTTTTTATGG + Intronic
1084510786 11:69602250-69602272 CAGGATGTGACACTGTTTTTGGG + Intergenic
1088768529 11:113009733-113009755 CAGGGTCTTACAGATGTTTTGGG + Intronic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089423265 11:118348164-118348186 TAGGGTCTGACACTAATTTGGGG - Intronic
1091167414 11:133491935-133491957 CAAGGTGTGACACTTGCTGTGGG - Intronic
1092243790 12:6851802-6851824 CAGGAACTGACGGTTGTTTTAGG - Exonic
1093756590 12:22859776-22859798 CAGGGTTTGGCACTGGTTTCAGG + Intergenic
1096232678 12:49905076-49905098 CAGGTTCAGATACTTCTTTTAGG - Intergenic
1099143341 12:79007922-79007944 AAGTGTCTGGCACTGGTTTTAGG + Intronic
1099757594 12:86873940-86873962 CAGGGTCTTACTCTTTTTTATGG + Intergenic
1101192595 12:102350669-102350691 CAGGGTGTCACACTAGTTTCAGG - Intergenic
1103275496 12:119708187-119708209 CAAGGGCTGCCACTTGTTTGGGG - Exonic
1103940305 12:124497895-124497917 CAGGGCCAGACTCTTGTTTCTGG - Intronic
1104733103 12:131119850-131119872 CAGGTGCTGTCTCTTGTTTTGGG + Intronic
1105461158 13:20588998-20589020 CAGTGTCTCAGACTTGTCTTTGG + Intronic
1106664228 13:31835003-31835025 CAGGGTCTCACTCTGGTTATTGG + Intergenic
1109150464 13:58841385-58841407 CAGTGTGTGACAGTTATTTTAGG - Intergenic
1109988646 13:70023852-70023874 CATGTTATGACACTTGTTTGAGG - Intronic
1110333446 13:74299127-74299149 CTGAGGCTGACACATGTTTTGGG + Intergenic
1110923768 13:81123991-81124013 TATGGTCTGACACCTATTTTTGG + Intergenic
1113431058 13:110250846-110250868 CTGGAGCTGACACTTGGTTTGGG - Intronic
1114522353 14:23347396-23347418 CAGGGTCTGGGGCTTGTCTTGGG + Intronic
1115023985 14:28718264-28718286 CAGTGTCTGACATTTATTTCAGG + Intergenic
1118216929 14:63817726-63817748 CCTGGCCTGACATTTGTTTTAGG - Intergenic
1120841301 14:89087410-89087432 CATTGTCTTTCACTTGTTTTTGG + Intergenic
1125483799 15:40098517-40098539 CAGGTTCTGACACTCGACTTGGG + Intronic
1125497127 15:40207221-40207243 CAGGGTCTGACACTTGTTTTAGG + Intronic
1129557696 15:76530063-76530085 CAGGGTCTGACACACAGTTTAGG + Intronic
1134209655 16:12265535-12265557 CAGGCTCTCACTCTTGTATTTGG + Intronic
1134685559 16:16155706-16155728 CAGTGTCTGACACATGGTGTGGG + Intronic
1134811259 16:17168823-17168845 CATGGTCAGACTCATGTTTTAGG - Intronic
1137673807 16:50293880-50293902 CCGGTTCTGACACCTGTCTTTGG + Intronic
1141603422 16:85139615-85139637 CAGGGTCTGACTCATGCTTTAGG + Intergenic
1142889260 17:2932396-2932418 CCGGGTCCCACACTTGTTATGGG - Intronic
1143538080 17:7553503-7553525 CTGTGTCTGGCACTTGTGTTTGG + Intronic
1147698676 17:42377056-42377078 CATTGTCTGACATTTGTTTTTGG - Intronic
1149796754 17:59528073-59528095 CTGGGGCTGAGATTTGTTTTAGG - Intergenic
1150819451 17:68423503-68423525 AAGGGTCTAACACCTGTTCTAGG + Intronic
1151444153 17:74152367-74152389 CAGGCTCAGACACTTATTTCAGG - Intergenic
1153555808 18:6311997-6312019 CATGGTCTGACACGTATTCTTGG + Exonic
1161807252 19:6451772-6451794 CTGGGTCTGATACTTGCTTCGGG + Intronic
1162474342 19:10891062-10891084 CAGGGCCAGACACTTGTTCTGGG + Intronic
925533117 2:4885229-4885251 CAGGGTTTGACCTTTGTCTTGGG - Intergenic
927027737 2:19087139-19087161 CAGGGTCTGAATCATTTTTTTGG + Intergenic
929576510 2:43055938-43055960 CTGGGTCAGACATTGGTTTTGGG + Intergenic
933438926 2:82284964-82284986 CGGGATTTGACATTTGTTTTTGG + Intergenic
936800134 2:116256534-116256556 CATGGTCTGAAACCTGTTCTAGG + Intergenic
939625520 2:144472715-144472737 CAGATTCTGACACTTTCTTTCGG - Intronic
941857532 2:170246131-170246153 AAGGGTCTGATAGTTGTTTCAGG - Intronic
947916914 2:233838678-233838700 CTGGGCCGGACAGTTGTTTTTGG + Intronic
948069426 2:235107606-235107628 CAGGGTCTGAAATTTGTCTCTGG + Intergenic
948079862 2:235197069-235197091 CAGGGTCAGACACCTCTTTCTGG - Intergenic
1171376581 20:24698099-24698121 CATGGTCAGACACTTATTCTGGG - Intergenic
1174032711 20:47643291-47643313 CAGGGGCTGTCAGTTGTTGTTGG + Intronic
1177052831 21:16259377-16259399 CAGGGTCTGTCACCTGTTCTGGG + Intergenic
1179321106 21:40291777-40291799 CATGCTCTGACTCTTCTTTTTGG + Intronic
1181988309 22:26817309-26817331 CAGTCTCTGACACTTCCTTTCGG - Intergenic
1184631790 22:45787247-45787269 TAGGGTCTGACCCTTCTTTCAGG - Intronic
950016494 3:9758333-9758355 CAGGGACAGAAACATGTTTTGGG - Intronic
950584735 3:13884058-13884080 CAGGGAGTGAAACTTGGTTTTGG + Intergenic
951095616 3:18626141-18626163 ATGGGTCTGTCACTTGTGTTCGG + Intergenic
951681401 3:25298604-25298626 CCGGGTATGACACTAGCTTTGGG + Intronic
953348579 3:42197159-42197181 CAGGCTCTGTGACTTGTTTTTGG - Intronic
953734549 3:45481007-45481029 GAGGGTCTGAGATTTCTTTTTGG - Intronic
955009717 3:55002290-55002312 CTGGCTCTGGCACATGTTTTAGG + Intronic
957526852 3:81388963-81388985 TAGTGTCTGACACTGGTGTTTGG + Intergenic
959374844 3:105576541-105576563 GAGGTTCTGACAGCTGTTTTTGG - Exonic
962145967 3:132840396-132840418 CAGCCACTGTCACTTGTTTTGGG - Intergenic
962646065 3:137441490-137441512 CAGGGCCTTTCACTTATTTTGGG + Intergenic
965996590 3:174890667-174890689 AAGGTTCTCACACTTGTTTTTGG - Intronic
966607174 3:181832982-181833004 GAGGGTCTGTCTCTTTTTTTTGG + Intergenic
966910829 3:184559127-184559149 CAGGCTCTGACCTTTGATTTTGG - Intronic
967274093 3:187756917-187756939 AAGGTTCTGAAACTTGCTTTAGG + Intergenic
968279544 3:197465769-197465791 CAGTTTGTGACCCTTGTTTTAGG + Intergenic
970023795 4:11598830-11598852 CTGGGTCTGACACTTTTCCTGGG + Intergenic
971256240 4:25016129-25016151 CAGGCTCTGAGAATTGTTATTGG - Intronic
975775059 4:77777693-77777715 CAGATTCAGACACTTGGTTTTGG - Intronic
979762908 4:124428980-124429002 CAGGGTCTCTCACTTGAATTTGG - Intergenic
981639823 4:146928218-146928240 CTGGGTCTAACACTCATTTTTGG - Intronic
982772815 4:159413809-159413831 CGGCGTTTGACACTTGTTATGGG + Intergenic
995782554 5:115793933-115793955 CAGGGTCAGATAAATGTTTTTGG + Intergenic
997928599 5:138053661-138053683 CAGTGCCTGGCACTTTTTTTGGG - Intergenic
999804168 5:155066594-155066616 AAGGCTCTGACACTTGTACTTGG + Intergenic
1000682612 5:164204636-164204658 CAGTGTGTGACACTTTATTTTGG + Intergenic
1001039180 5:168320586-168320608 CAGAGTCTTACACATGTTATGGG - Intronic
1001829686 5:174775063-174775085 ATGTGTCTGACACTTCTTTTGGG - Intergenic
1004303024 6:14475557-14475579 CCGGGTCTCACACTTGATTAAGG + Intergenic
1006073206 6:31511660-31511682 CTGGTGCTGCCACTTGTTTTGGG + Intergenic
1007908638 6:45490177-45490199 CAGGGTCTAGGAGTTGTTTTGGG + Intronic
1008095820 6:47338209-47338231 CAGGGACTAAGATTTGTTTTAGG - Intergenic
1008154714 6:47999805-47999827 CTGGGTCAGATAATTGTTTTAGG - Intronic
1014206964 6:118666385-118666407 CAGGCTCTGACCCTTTTTTGGGG - Intronic
1014919920 6:127202067-127202089 CAGGGCATGGCACTCGTTTTTGG - Intergenic
1017489090 6:154928567-154928589 CCGGGCCTGACACTTGATTTTGG + Intronic
1018648145 6:165967141-165967163 CAGGGTCTGACACAGGCATTGGG - Intronic
1018670547 6:166173377-166173399 CAGGGCCTGACACTTGCCTGAGG + Intergenic
1022790036 7:33679075-33679097 CAGAGAGTGACAGTTGTTTTTGG - Intergenic
1023229257 7:38008502-38008524 CAGGATCTGACAAGTATTTTGGG - Intronic
1025115779 7:56256649-56256671 CAGGGGCTGCCCTTTGTTTTGGG - Intergenic
1026433738 7:70374886-70374908 CAGAGTATGGCACTTGGTTTAGG - Intronic
1031104176 7:117519334-117519356 CAGAGTCTGACAATAGTTTTTGG - Intronic
1031262170 7:119534560-119534582 CAGGGTGACACACTTGCTTTAGG + Intergenic
1033633186 7:143181663-143181685 TATGCTCTGACACTTGATTTAGG + Intergenic
1038677736 8:29638698-29638720 AAGGGTATGACACTTGTCTAAGG - Intergenic
1038983803 8:32787448-32787470 CACTCACTGACACTTGTTTTGGG - Intergenic
1039455601 8:37703907-37703929 CAGGGGCTGACAGCTGGTTTCGG - Intergenic
1039733333 8:40303731-40303753 CAGGGTCAGAGACATGGTTTGGG + Intergenic
1047443822 8:124902149-124902171 CATGGGCTGACACTTGTGCTGGG + Intergenic
1048251404 8:132869459-132869481 CAGGGTGGGTCACTTGTTTTGGG + Intronic
1049846371 8:144803848-144803870 CAAGGTCTGACACATTTTTGAGG + Intronic
1050584075 9:7091891-7091913 CAGGGTCTGAGACCTGTGTCAGG - Intergenic
1050693996 9:8259412-8259434 CAGGGGCAGAAACTTGGTTTGGG - Intergenic
1050718028 9:8552384-8552406 CAGAGTATGACATGTGTTTTTGG + Intronic
1050891897 9:10835209-10835231 CAGGGTCTGAAACATGGTTCAGG - Intergenic
1059067822 9:111103774-111103796 CAGGGTATGATACTTTGTTTTGG + Intergenic
1060445381 9:123682377-123682399 CAGGGTCTTTCAGTTGCTTTTGG + Intronic
1060755935 9:126213445-126213467 TGGGGTCTGTCACATGTTTTGGG - Intergenic
1185689927 X:2146007-2146029 CAGTTTCTGCCACTCGTTTTTGG - Intergenic
1185809066 X:3088267-3088289 CAGGGTGTGACCCTAGTTTGAGG + Intronic
1186058393 X:5676119-5676141 AAATGTCTGACACATGTTTTTGG - Intergenic
1189761291 X:44324145-44324167 CAGGGTCTGAAAATTATCTTAGG - Intronic
1192070136 X:67930159-67930181 CAGGATCTCACTCTTGTTTATGG - Intergenic
1192838588 X:74829276-74829298 CATGTTCTGTCACTTGTTTGTGG - Intronic
1195540820 X:106060639-106060661 CAGTGAATGACACTTGCTTTAGG - Intergenic
1200428125 Y:3045218-3045240 CAGGGTCTGACTCCTGATTCAGG - Intergenic
1200779799 Y:7204303-7204325 CAGGGTCTGATACTTGGTCAGGG - Intergenic