ID: 1125504059

View in Genome Browser
Species Human (GRCh38)
Location 15:40256874-40256896
Sequence TCCTGCTCACGGAGGAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125504059_1125504067 13 Left 1125504059 15:40256874-40256896 CCAAAGCTCCTCCGTGAGCAGGA 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1125504067 15:40256910-40256932 CTCACTGTGCCTGGAGAAGCTGG 0: 1
1: 0
2: 9
3: 49
4: 345
1125504059_1125504062 4 Left 1125504059 15:40256874-40256896 CCAAAGCTCCTCCGTGAGCAGGA 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1125504062 15:40256901-40256923 ATGCTCCCCCTCACTGTGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 238
1125504059_1125504068 19 Left 1125504059 15:40256874-40256896 CCAAAGCTCCTCCGTGAGCAGGA 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1125504068 15:40256916-40256938 GTGCCTGGAGAAGCTGGCAGAGG 0: 1
1: 0
2: 5
3: 65
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125504059 Original CRISPR TCCTGCTCACGGAGGAGCTT TGG (reversed) Intronic