ID: 1125504276

View in Genome Browser
Species Human (GRCh38)
Location 15:40257958-40257980
Sequence CAGGCTGAGCCCCTACAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 183}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125504270_1125504276 1 Left 1125504270 15:40257934-40257956 CCAAGCCTGTGGGTCGCCTGGCT 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1125504276 15:40257958-40257980 CAGGCTGAGCCCCTACAGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 183
1125504268_1125504276 8 Left 1125504268 15:40257927-40257949 CCTCAAGCCAAGCCTGTGGGTCG 0: 1
1: 0
2: 0
3: 3
4: 120
Right 1125504276 15:40257958-40257980 CAGGCTGAGCCCCTACAGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 183
1125504271_1125504276 -4 Left 1125504271 15:40257939-40257961 CCTGTGGGTCGCCTGGCTTCAGG 0: 1
1: 0
2: 0
3: 16
4: 241
Right 1125504276 15:40257958-40257980 CAGGCTGAGCCCCTACAGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 183
1125504264_1125504276 12 Left 1125504264 15:40257923-40257945 CCCTCCTCAAGCCAAGCCTGTGG 0: 1
1: 0
2: 2
3: 22
4: 216
Right 1125504276 15:40257958-40257980 CAGGCTGAGCCCCTACAGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 183
1125504266_1125504276 11 Left 1125504266 15:40257924-40257946 CCTCCTCAAGCCAAGCCTGTGGG 0: 1
1: 0
2: 0
3: 21
4: 203
Right 1125504276 15:40257958-40257980 CAGGCTGAGCCCCTACAGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 183
1125504261_1125504276 30 Left 1125504261 15:40257905-40257927 CCACAAAACTTACTCACCCCCTC 0: 1
1: 1
2: 2
3: 11
4: 209
Right 1125504276 15:40257958-40257980 CAGGCTGAGCCCCTACAGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 183
1125504262_1125504276 14 Left 1125504262 15:40257921-40257943 CCCCCTCCTCAAGCCAAGCCTGT 0: 1
1: 0
2: 3
3: 22
4: 298
Right 1125504276 15:40257958-40257980 CAGGCTGAGCCCCTACAGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 183
1125504263_1125504276 13 Left 1125504263 15:40257922-40257944 CCCCTCCTCAAGCCAAGCCTGTG 0: 1
1: 0
2: 0
3: 33
4: 263
Right 1125504276 15:40257958-40257980 CAGGCTGAGCCCCTACAGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125504276 Original CRISPR CAGGCTGAGCCCCTACAGAG GGG Intronic
902617525 1:17632007-17632029 CAGGCAGAATCCCTACAGAGAGG + Intronic
903058899 1:20655801-20655823 CTAGCTGAGCCCTTACAGGGGGG + Intronic
903761728 1:25703225-25703247 CAGCCTCAGCACCCACAGAGAGG - Intronic
904330633 1:29755826-29755848 CAGCCTGAGTGCCCACAGAGGGG - Intergenic
904416041 1:30361769-30361791 CAGCCTGAGTGCCCACAGAGGGG + Intergenic
904824717 1:33266744-33266766 CAGGCTGAGCCCCTCCATCTGGG - Intronic
905132976 1:35775422-35775444 CAGGCTGAGCCACTGCACCGAGG - Intergenic
906306583 1:44723854-44723876 GAGGCTGAGACCCCAGAGAGGGG - Intronic
906689428 1:47782851-47782873 CAGGCTGAGCCCCAACATCGTGG - Intronic
906708517 1:47912494-47912516 GAGGCTGAGACCCTCCAGAAAGG - Intronic
907382193 1:54100292-54100314 GAGACTGAGTCCCTACACAGAGG - Intronic
907516462 1:54996363-54996385 CTGGTTGAGCCCCTACTGTGTGG - Intergenic
907927102 1:58965264-58965286 CTTGCTGAGCCCCCTCAGAGTGG - Intergenic
914917193 1:151826034-151826056 CAGGCTGAGGCGCTGCTGAGAGG - Intronic
919821677 1:201476893-201476915 CAGACTCAGCCCCATCAGAGGGG - Intergenic
920430464 1:205915345-205915367 CTGGCTGAGCCCTCACAGGGCGG + Exonic
920926029 1:210342528-210342550 CAGGCTGTGTCCCTATAGATTGG + Intronic
921272768 1:213487597-213487619 CAGTATGAGCCCTTACAGGGGGG + Intergenic
1063123904 10:3123839-3123861 CAGGCAGAGCCTGCACAGAGCGG + Intronic
1063196917 10:3752285-3752307 CAGAATGATCCCCTAGAGAGTGG + Intergenic
1065731554 10:28713889-28713911 CATGCTGATCCCCATCAGAGAGG + Intergenic
1070305637 10:75237559-75237581 CAGGCTGAGGACTTACACAGGGG + Intergenic
1070442249 10:76458187-76458209 CAGTCTGAGCACCCATAGAGGGG + Intronic
1070602524 10:77875859-77875881 GAGGCCGAGCCCCTAGGGAGGGG - Intronic
1076535509 10:131174317-131174339 CAGGCTGAAACCCCACAGTGGGG + Intronic
1076871096 10:133195548-133195570 CAGGCACTGCCCCCACAGAGGGG - Intronic
1077332772 11:1990615-1990637 CCGGCTGACCTCCAACAGAGTGG - Intergenic
1077873360 11:6281958-6281980 CATGCTGAGCCCCTAAACAAAGG + Intergenic
1079089112 11:17468406-17468428 CAGGCTGAACCCCAACACAGAGG + Intronic
1081381070 11:42416026-42416048 CAGGCTGAGTACCTTTAGAGAGG - Intergenic
1081674952 11:44963307-44963329 CAGGCTGGGGCCCAACAGAGAGG - Intergenic
1082081023 11:48012650-48012672 CAGGGTGAGCCCCTTGAGAGAGG + Intronic
1083304480 11:61755344-61755366 CCGGCTAATCCCCTAGAGAGAGG + Intronic
1083310246 11:61780236-61780258 CAGGCTCAGCACGTACAGTGTGG - Exonic
1084426406 11:69086740-69086762 GAGGCTGAGCCCCTCCCGTGGGG + Intronic
1084520055 11:69657473-69657495 CTGGCTGAGCCCCTCCAGGACGG + Intronic
1084804627 11:71570213-71570235 CAGCCCCAGCCCCTCCAGAGAGG - Intergenic
1087796648 11:102461224-102461246 CAGGGTGACACCCTAAAGAGGGG + Intronic
1090492493 11:127177085-127177107 AAGGCTTAGCCCATACACAGTGG - Intergenic
1202815755 11_KI270721v1_random:45791-45813 CCGGCTGACCTCCAACAGAGTGG - Intergenic
1092298736 12:7224514-7224536 CAGTCTGAGCCTCCCCAGAGTGG + Intergenic
1094358929 12:29609054-29609076 CAGGCTGTTCCCTTCCAGAGAGG + Intronic
1099195432 12:79609550-79609572 CAGGCTCTGCCACCACAGAGAGG + Intronic
1102192239 12:110997412-110997434 CTAGCTGAGCACCTACAGAAAGG - Intergenic
1102796063 12:115689624-115689646 CAGGGTGAGCCCCTGAAGAAGGG + Intergenic
1102864307 12:116361783-116361805 CAGTCTGAGCCTCTACAAAACGG - Intergenic
1104595166 12:130115786-130115808 CTGACAGAGCCCCTGCAGAGAGG + Intergenic
1104840622 12:131823407-131823429 CAGGGTGAGCCCCTTCAAAAGGG + Intergenic
1105973467 13:25452299-25452321 CGGGCTGAGCGCACACAGAGCGG + Intronic
1106772106 13:32971562-32971584 CAGGCTCAGTCCCTACAGGTTGG + Intergenic
1107875796 13:44789751-44789773 CAGGATGAGCAGCTGCAGAGAGG - Intergenic
1112010448 13:95289588-95289610 CTGGCTGAGCACCCACAGAGGGG + Intronic
1113469509 13:110534416-110534438 GAGGCCGAGCCCCTACAAAGAGG + Intronic
1113970723 13:114186190-114186212 CAGGATGACCAGCTACAGAGGGG + Intergenic
1114705767 14:24725397-24725419 CTGGCTGAGCCCAGACAAAGAGG - Intergenic
1121005409 14:90487505-90487527 CATGATGAGGCCCTACAGAATGG + Intergenic
1121526854 14:94625215-94625237 GAGGCTGAGGGGCTACAGAGAGG + Intergenic
1124555262 15:30719425-30719447 AAGGCAAAGCCCCTGCAGAGAGG + Intronic
1124675993 15:31686256-31686278 AAGGCAAAGCCCCTGCAGAGAGG - Intronic
1124883399 15:33662210-33662232 CACGCTGAGGCTCTACAGCGCGG + Exonic
1125385198 15:39129739-39129761 CTGGCTGAGGCCCTGCAGGGAGG - Intergenic
1125504276 15:40257958-40257980 CAGGCTGAGCCCCTACAGAGGGG + Intronic
1128131255 15:65228552-65228574 CAGACTGAGCCCCAAATGAGGGG + Intergenic
1129147633 15:73663305-73663327 CAGGCTCAGCCAGTAGAGAGAGG - Intergenic
1129457874 15:75685306-75685328 CAGGCTGAGGCCCAGGAGAGTGG + Exonic
1137270666 16:46900547-46900569 CAGGCTGAGTCCTCGCAGAGAGG + Intronic
1138586510 16:57973776-57973798 CAGTTGGAGCCCCTGCAGAGTGG + Intergenic
1139940492 16:70601891-70601913 CAGCCCGAGCCCAGACAGAGAGG + Intronic
1140457434 16:75113427-75113449 CAGGCTGAGCCTCAACAACGGGG - Intronic
1141182349 16:81762762-81762784 CAGGCAGAGCCCCTTCAAATGGG + Intronic
1141446277 16:84060689-84060711 CAGGCTCAGTCACTCCAGAGAGG - Exonic
1141716027 16:85727327-85727349 CAGGCTGAGCCCCCCGAGCGAGG + Intronic
1142494923 17:301070-301092 GAGGCAGCGCCCCTACAGAGTGG - Intronic
1142830486 17:2545490-2545512 CAGGCTGAGCCACTTAAGAGAGG - Intergenic
1143795236 17:9330759-9330781 CAGGCTGAGCCCCTATTCAGAGG + Intronic
1144060899 17:11582873-11582895 CAGGATGACCAGCTACAGAGAGG - Intergenic
1144767372 17:17740041-17740063 CAGGCTGAGCCCTTCCAAAGTGG + Intronic
1145259813 17:21347992-21348014 CAGGCTGAGTGCCTACAGTAGGG - Intergenic
1145316802 17:21739946-21739968 CAGGCTGAGTGCCTACAGTAGGG + Intergenic
1147654522 17:42081259-42081281 CTGACAGAGCCCCTCCAGAGGGG - Intergenic
1150951000 17:69802013-69802035 CAGGATGACCAGCTACAGAGAGG + Intergenic
1152100565 17:78299441-78299463 CAGGCTGAGCCGCTGCAGTGTGG + Intergenic
1152567521 17:81106865-81106887 CAAGCAGAGGCCCTACAGTGTGG + Exonic
1152720347 17:81920633-81920655 CAGGCTGCGCCCCCACAGGGAGG + Exonic
1153968451 18:10203092-10203114 GTGGCCGAGCCCCTACTGAGAGG + Intergenic
1154096091 18:11416546-11416568 GAGGCTGAGCAGCTGCAGAGAGG - Intergenic
1155750655 18:29419102-29419124 AAGCCTGAGTCCCTCCAGAGTGG - Intergenic
1156063808 18:33116151-33116173 AAAGCTGAGCTACTACAGAGGGG + Intronic
1162803595 19:13124582-13124604 CACATTCAGCCCCTACAGAGGGG + Intronic
1163895914 19:20058986-20059008 CAGCCTGAGTCTCTCCAGAGTGG - Intergenic
1164436729 19:28236787-28236809 CAGTCAGAGCCCCTCAAGAGTGG - Intergenic
1165128758 19:33619429-33619451 CAGGCTCAGCCTCTGCAGCGAGG - Intergenic
1165374190 19:35430023-35430045 CAGGCTGAACACCTGGAGAGGGG + Intergenic
1165386506 19:35513396-35513418 GAGGCTGGCCCCCTGCAGAGCGG - Exonic
1166617232 19:44261086-44261108 CAGGCTGAGCTCAGGCAGAGTGG + Intronic
1167211545 19:48136859-48136881 GAGGCCCAGCCCCTAAAGAGTGG - Intronic
1167346275 19:48947351-48947373 CAGGATGACCAGCTACAGAGCGG + Intergenic
1167610975 19:50507600-50507622 CAGGCCCAGCCCCTGCAGAGCGG + Exonic
1168241791 19:55092408-55092430 CAGGCAAAGCCCCGACGGAGGGG + Intronic
926124582 2:10264433-10264455 CAGGGTGAGACCCTCCAGATGGG - Intergenic
926124602 2:10264507-10264529 CAGGGTGAGACCCTCCAGACAGG - Intergenic
926251805 2:11159205-11159227 CTGGCTGTGGCCCCACAGAGGGG + Intronic
929118570 2:38465345-38465367 CACGCTGAGCACCTAGAGACTGG - Intergenic
930187022 2:48420563-48420585 GGGGCTGTGCCCCTGCAGAGAGG + Intergenic
932405065 2:71507222-71507244 CAGGGTGAGCCCCTAGAAACAGG + Intronic
932467841 2:71934949-71934971 CAGGCTGGGCCCACAGAGAGAGG - Intergenic
934559878 2:95307553-95307575 CAGGCTGAGCACCTCCCAAGTGG - Intronic
934674448 2:96239702-96239724 CAGGTTCAGCACCTACAGAAGGG - Intergenic
937823298 2:126335660-126335682 CAGTCACAGCCCCTAGAGAGGGG + Intergenic
937989056 2:127652228-127652250 CTGGCAGAGGCACTACAGAGGGG - Exonic
940910659 2:159206828-159206850 CAAGCTTAGCCCTTACCGAGAGG + Intronic
944647528 2:201794852-201794874 CTGCCCCAGCCCCTACAGAGAGG - Intronic
946422905 2:219575026-219575048 CGGGCTGAGCAGGTACAGAGGGG - Exonic
946806309 2:223474369-223474391 CAGGCCGAGGCTCTCCAGAGGGG - Intergenic
947714965 2:232334785-232334807 CAGCCTGTGCCCCTCCAGTGCGG - Intronic
947734041 2:232445736-232445758 CAGCCTGTGCCCCTCCAGTGCGG - Intergenic
948589230 2:239038758-239038780 CAGGCTGAGCCCATCTGGAGAGG + Intergenic
1169406592 20:5326454-5326476 CAGGCAGAGCCCCCAGAGAGGGG - Intergenic
1171414167 20:24966237-24966259 CAGGAGGAGCCCCTTCAGTGTGG - Intronic
1175001326 20:55633240-55633262 CAGGGTGACCAGCTACAGAGAGG - Intergenic
1180953692 22:19731864-19731886 CCGGCTGACCCCCAACAGGGAGG + Intergenic
1181438713 22:22924834-22924856 CAGGCTGAGCCACTCCTGGGGGG + Intergenic
1181772841 22:25139240-25139262 CAGGGTGAGCCCCATCAGGGGGG - Intronic
1183094405 22:35543478-35543500 CAGGCTGACCTCATACAGCGAGG - Intronic
1183211748 22:36455424-36455446 CAAGTTGAGCCCCTGCAGGGTGG - Intergenic
1183533857 22:38383261-38383283 CAGGCTGACCACCTGCACAGTGG - Intronic
1183862261 22:40678833-40678855 CAGGCAGATCCCATGCAGAGAGG + Exonic
1184161246 22:42698558-42698580 CAGGCTGAGTGCTGACAGAGAGG + Intronic
953625239 3:44565571-44565593 GGGGCTGAGCCCCCACTGAGGGG - Exonic
953686590 3:45082902-45082924 CAGGCTGGGCCCCTTCACTGAGG + Exonic
954139121 3:48595863-48595885 CCGGCTTATCCCCTACAAAGAGG - Intergenic
954789855 3:53124221-53124243 AAAGCTGAGCCTCTACCGAGTGG + Intronic
954792161 3:53141519-53141541 CAGGGAGGGCCTCTACAGAGTGG + Intergenic
955253085 3:57304164-57304186 CAGGCTGAGTCCGAAAAGAGAGG - Intronic
955817328 3:62859371-62859393 CATGCTGAGCTCTTAAAGAGGGG - Intronic
957696798 3:83649797-83649819 CGGCCTGAGCCCCTACGGAGAGG - Intergenic
959883504 3:111473525-111473547 GGGGATGAGCCCCTACAGGGAGG - Intronic
960987725 3:123291624-123291646 CAGGCTCAGCACCCCCAGAGAGG - Intronic
961186413 3:124918855-124918877 CAGGCTGGGCCCAAACACAGTGG - Intronic
965701036 3:171459821-171459843 CTGGCTGAGCCCCTACGGCAGGG - Intronic
967446095 3:189568318-189568340 CTGGCTGTGCCCCTTCACAGAGG + Intergenic
968438207 4:606621-606643 CAGGCTGAGCCTCTTGTGAGGGG + Intergenic
969461059 4:7329179-7329201 CATTCGGAGCCCCTACTGAGTGG - Intronic
969467915 4:7368556-7368578 CAGGACCAGCCCCTAAAGAGAGG - Intronic
983979443 4:173976168-173976190 CAGACTGAGCTCCTGTAGAGGGG - Intergenic
984724928 4:183011715-183011737 CAGGCTCAGCCCCTGCAGAGGGG - Intergenic
986176150 5:5353810-5353832 CAGACTCAACCCCGACAGAGGGG + Intergenic
986325955 5:6674705-6674727 CAGGCTGAGCCCTGCCAGAGGGG + Intergenic
986534727 5:8775344-8775366 CAGGCTGAATCCTTTCAGAGGGG + Intergenic
987133851 5:14882932-14882954 AAGGCTTAGCCCCTCCAGAGAGG + Intergenic
996456283 5:123686572-123686594 CAGGGTAAACCCCTACAGAATGG + Intergenic
998386553 5:141760478-141760500 CAGGATGCTCCCCTGCAGAGTGG + Intergenic
1001042892 5:168349464-168349486 CAGGATGAGGCCCTGGAGAGTGG - Intronic
1001638369 5:173228771-173228793 CAGGCTGAGCTCCTGGAGAAAGG - Intergenic
1002259479 5:177983840-177983862 CAGGCAGAGCCCCTGCTGTGAGG + Intergenic
1002460428 5:179370638-179370660 CAGGCCGGGCCCCCACCGAGAGG + Intergenic
1003023264 6:2530434-2530456 CTGGCTGAGGCCCTAGAGACAGG - Intergenic
1004603131 6:17169985-17170007 CTGGCTCAGCCCCTAGAGGGTGG - Intergenic
1005042586 6:21612505-21612527 CAGAGTGACACCCTACAGAGGGG + Intergenic
1006406667 6:33849582-33849604 CCTGCTCAGCCCCTACAGGGTGG + Intergenic
1007594519 6:43043332-43043354 CAGGCTGAGCCCATAGGGAGGGG + Intronic
1007809786 6:44477593-44477615 AAGGCTGTGCCCATCCAGAGAGG - Intergenic
1010282955 6:74041470-74041492 GGGCCTGAGCCCCTACAGCGAGG - Intergenic
1011042610 6:83047563-83047585 CATGCAGAGCCCCTGCTGAGAGG + Intronic
1014843501 6:126247102-126247124 CAAGCTAAGCCCATACAGCGAGG - Intergenic
1018008132 6:159642297-159642319 CAGGCTGTGCCCACAGAGAGGGG + Intergenic
1018286341 6:162242733-162242755 CAGGCTTTACACCTACAGAGAGG + Intronic
1019417771 7:935202-935224 CAGGCGGAGCCGCTGGAGAGGGG + Intronic
1019459919 7:1152333-1152355 ATGGGTGAGCACCTACAGAGAGG + Intronic
1019543207 7:1560661-1560683 CAGGCTGAGCGCCACCAGGGAGG - Intronic
1019617652 7:1973492-1973514 CGAGCTGGGCCCCTACAGTGGGG + Intronic
1019836247 7:3387372-3387394 CAGGGTGAGCTCCTACAAGGAGG - Intronic
1022408601 7:30118090-30118112 CAGGCTGATCCCCTGGAGAGAGG - Intronic
1022525294 7:31033309-31033331 CATGCTGAGCCCCTGCAGCTAGG + Intergenic
1024171023 7:46786723-46786745 CAGGCTGAGGCCCTGGAGACTGG - Intergenic
1027269879 7:76513408-76513430 CAGGCTGACTCCCTACAGGAGGG - Intronic
1029303535 7:99602281-99602303 CAGGCTCAGCACAGACAGAGGGG + Intronic
1032279316 7:130488095-130488117 CAGGGTGATCCTCTACTGAGGGG - Intronic
1032736719 7:134699197-134699219 AAGACTGAGGCCCTACAAAGGGG - Intergenic
1035050230 7:155994470-155994492 CAGGCTCAGCCTGGACAGAGTGG - Intergenic
1037891947 8:22628242-22628264 GAGGCCGAGCCCCTGCAGGGAGG + Intronic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1039073169 8:33664311-33664333 CAGGCTGAGCTGCTTCTGAGTGG + Intergenic
1042020805 8:64370260-64370282 TAGGCTGAGCCCCCAGCGAGGGG + Intergenic
1042439363 8:68808016-68808038 GAGGCTGAGACCCTAAAGAAGGG - Intronic
1043892652 8:85663022-85663044 CAGGCGGAGCCCCAAAACAGGGG - Intergenic
1044699378 8:94952044-94952066 CAGGCTGACCCCCTGCTGTGGGG + Intronic
1045707916 8:104947998-104948020 CAGGCTGGGCCCCTCTAGACTGG + Intronic
1047100558 8:121670867-121670889 TGGGCTGAGCCCCAACAGAACGG - Intergenic
1049299103 8:141860473-141860495 CAGGCAGAGCCTGCACAGAGAGG - Intergenic
1049373218 8:142277472-142277494 CAGGCAGTGCCGCTGCAGAGCGG + Intronic
1049642127 8:143720537-143720559 CAGTCTGGGCCCCTGCAGGGTGG - Intronic
1050630129 9:7549742-7549764 GAGCCTGAGCCCCTAGTGAGAGG + Intergenic
1051823852 9:21197277-21197299 CAGGCTGAGAGGCTAGAGAGAGG - Intergenic
1052565191 9:30140782-30140804 CAGGCTGAGCCCCAATTGTGGGG + Intergenic
1053415563 9:37944955-37944977 CAGGCTGAGCCCCTGGAGGCTGG + Intronic
1056992239 9:91423283-91423305 CAGGCTGAGCCCTCTCCGAGCGG - Intronic
1057863026 9:98657133-98657155 CAGCCTTTGCCCCTGCAGAGGGG + Intronic
1058091970 9:100814700-100814722 CAGGCTGATCAGCTACAGAGAGG + Intergenic
1059447759 9:114349473-114349495 CGGGGAGGGCCCCTACAGAGGGG - Intronic
1061041575 9:128143997-128144019 CAGGCTGAGCTCCCAGGGAGGGG + Intergenic
1062280533 9:135749805-135749827 CACCCTGAGCCCCAACAGGGCGG + Intronic
1062680852 9:137779251-137779273 CAGGATGAGCCCACACAGCGTGG - Intronic
1195179045 X:102339338-102339360 CAGGCTGAACAGCTGCAGAGAGG - Intergenic
1199685313 X:150260121-150260143 CAGGCCCAGCCCCCACAAAGGGG + Intergenic
1202593588 Y:26512746-26512768 CAGGCTGACCACCTGCACAGTGG + Intergenic