ID: 1125505303

View in Genome Browser
Species Human (GRCh38)
Location 15:40264653-40264675
Sequence GGGAAGCCCTAGGCTTCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125505292_1125505303 10 Left 1125505292 15:40264620-40264642 CCATTTCCCTGAGGAAGCAGAGA 0: 1
1: 0
2: 3
3: 51
4: 468
Right 1125505303 15:40264653-40264675 GGGAAGCCCTAGGCTTCTAGGGG 0: 1
1: 0
2: 0
3: 15
4: 142
1125505294_1125505303 4 Left 1125505294 15:40264626-40264648 CCCTGAGGAAGCAGAGATGGAGG 0: 1
1: 0
2: 8
3: 53
4: 506
Right 1125505303 15:40264653-40264675 GGGAAGCCCTAGGCTTCTAGGGG 0: 1
1: 0
2: 0
3: 15
4: 142
1125505296_1125505303 3 Left 1125505296 15:40264627-40264649 CCTGAGGAAGCAGAGATGGAGGT 0: 1
1: 0
2: 3
3: 44
4: 431
Right 1125505303 15:40264653-40264675 GGGAAGCCCTAGGCTTCTAGGGG 0: 1
1: 0
2: 0
3: 15
4: 142
1125505291_1125505303 14 Left 1125505291 15:40264616-40264638 CCAGCCATTTCCCTGAGGAAGCA 0: 1
1: 0
2: 4
3: 24
4: 239
Right 1125505303 15:40264653-40264675 GGGAAGCCCTAGGCTTCTAGGGG 0: 1
1: 0
2: 0
3: 15
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125505303 Original CRISPR GGGAAGCCCTAGGCTTCTAG GGG Intronic
901461907 1:9397093-9397115 GGGAGGCCCTAGGCTTTTGTGGG - Intergenic
902087238 1:13873026-13873048 GGGAAGCTCAAGGACTCTAGGGG - Intergenic
902575067 1:17372482-17372504 GGGAAGCCTTGGGTCTCTAGTGG + Intronic
903466116 1:23553891-23553913 GGGAGGCCTTAGGCTTCCTGGGG - Intergenic
905542621 1:38772354-38772376 GTGACCCCCTAGACTTCTAGGGG - Intergenic
905682335 1:39883218-39883240 GTGAACCCCGAGGCTTGTAGGGG - Intronic
906416396 1:45623603-45623625 GGGAGGCCCTGGGGTTCTTGTGG + Exonic
910431569 1:87164792-87164814 GGGAACCTCTGGGCTTCTAATGG - Intronic
911044588 1:93617875-93617897 GGGAAGCCCTAGGCAGATAAAGG + Intronic
912814495 1:112818086-112818108 GGGAAGACCTGGGCTTGCAGGGG - Intergenic
919876133 1:201870189-201870211 GGAAATCCCTAGGCAACTAGTGG + Intronic
920336752 1:205250038-205250060 GTGAAGCCCTTGCCTTGTAGGGG + Intronic
920446309 1:206021289-206021311 GGGCATCACCAGGCTTCTAGGGG - Intronic
921693148 1:218176495-218176517 GGGCAGCTGGAGGCTTCTAGAGG - Intergenic
1068630804 10:59295425-59295447 GGGCAGCTCTCAGCTTCTAGAGG - Intronic
1069616496 10:69809849-69809871 GGGAAGCCCAAGCATTCCAGAGG - Intronic
1069796910 10:71059506-71059528 GGGAAGCCCCAGGCTTGCTGTGG - Intergenic
1070777676 10:79119282-79119304 GGGTAGCCCTTTCCTTCTAGAGG + Intronic
1073546740 10:104355283-104355305 GGGAAGCCCCAGCCTCCCAGAGG + Intronic
1075742692 10:124705491-124705513 GGGAAGCCCAGGGCTTGTAGAGG - Intronic
1076424669 10:130359117-130359139 GGGAAGACCCAGGCATCCAGAGG - Intergenic
1079892773 11:26078717-26078739 GGGAAGCCCAAGGCTTACAGAGG - Intergenic
1080247438 11:30195615-30195637 GAGAAACCCTAGGGTTCTGGGGG + Intergenic
1081595706 11:44458006-44458028 AGGAAGCCCTGGGCTTTCAGGGG - Intergenic
1081637352 11:44729363-44729385 GGGAAACGCTGGCCTTCTAGGGG - Intronic
1081699467 11:45144064-45144086 GGGAAGCCCTAGGCAGTTGGAGG - Intronic
1082084154 11:48035298-48035320 GGAAAGCCCTAGGCTTAAAATGG - Intronic
1083331743 11:61901673-61901695 GGGACACCCTCAGCTTCTAGAGG - Intronic
1084002612 11:66305279-66305301 GGGAAGCTCTAGGGGTCTAGTGG - Intergenic
1084180164 11:67442124-67442146 GGGAAGACCAAGGCTTCGGGAGG - Intronic
1090328015 11:125905147-125905169 GGGAAGCACTGGGCTGCTTGAGG + Intronic
1091835050 12:3579869-3579891 GTGAAGCCCTCTGCTTCAAGCGG + Intronic
1093286600 12:17271242-17271264 AGGAAGACCTTGGCTTCTCGAGG - Intergenic
1093509867 12:19913758-19913780 GGGAAGCAATAAGCTTCTAGAGG + Intergenic
1095802253 12:46281404-46281426 GGCAATCCCTAGGCACCTAGTGG - Intergenic
1096614989 12:52827141-52827163 TGGAAGGGCTAGACTTCTAGAGG - Intronic
1097178068 12:57154813-57154835 TGGATGCCCCAGGCCTCTAGTGG + Intronic
1102698111 12:114815597-114815619 GGGAAGCCCAAGGCTTGTCATGG + Intergenic
1106409301 13:29499921-29499943 GGGAAGTCCTGGGCTGCTGGAGG - Intronic
1111861043 13:93706630-93706652 GGGAATAACTAGGCTTCTGGAGG + Intronic
1112997361 13:105590523-105590545 GAGGAGCCCGAGGTTTCTAGTGG - Intergenic
1119114120 14:72002617-72002639 GGGAACCCCTGGGCTCCTTGGGG + Intronic
1120607539 14:86597660-86597682 GGGACACTCTAGGCTCCTAGAGG + Intergenic
1120634186 14:86930889-86930911 GGAAAGCCCTCAGCTCCTAGGGG + Intergenic
1121224251 14:92309625-92309647 TGGAAGCCCTAGGCTTTGGGGGG - Intergenic
1122958924 14:105085696-105085718 GGGGAGTCCTGGGCTTCTAGAGG + Intergenic
1124407946 15:29408383-29408405 GGGAAATCCTGGGCTTGTAGGGG + Intronic
1125462535 15:39920429-39920451 GGGATGCCCTAGCCCTCGAGGGG - Exonic
1125505303 15:40264653-40264675 GGGAAGCCCTAGGCTTCTAGGGG + Intronic
1126456879 15:48872488-48872510 TGTAAGCCCAAAGCTTCTAGGGG + Intronic
1126983079 15:54268956-54268978 GGGAAGACCAAGGCAGCTAGAGG - Intronic
1130135466 15:81178195-81178217 GGGAAGCCCTAGTCTTTGGGAGG - Intronic
1130299946 15:82672876-82672898 GGGCTGCCCTTGCCTTCTAGAGG - Intronic
1130670250 15:85905934-85905956 GGGAAGGCCTTGGTTTCCAGTGG + Intergenic
1132295746 15:100733014-100733036 TGGTAGCACTGGGCTTCTAGAGG - Intergenic
1141064155 16:80900494-80900516 GGGAAGCACTAGTCTCCCAGCGG + Intergenic
1141315845 16:82961836-82961858 GGGCTGCCGTTGGCTTCTAGTGG + Intronic
1141850579 16:86642597-86642619 GGGAAGCCCCATGGTTCTAAGGG - Intergenic
1143132871 17:4691577-4691599 GAAAAGCTCAAGGCTTCTAGTGG - Intronic
1146910129 17:36642944-36642966 GGGAAGACCTAGGCTCAGAGAGG + Intergenic
1149423235 17:56530788-56530810 GAGAATCCCTAGTCTTCTATTGG + Intergenic
1150877554 17:68986277-68986299 GGGAACCCCTGGGCTTCCTGGGG - Exonic
1151829563 17:76541589-76541611 GGGAAGCCCTGGGCCTGTACAGG + Intronic
1152124494 17:78438183-78438205 GGGAAGCCCTCAGCTTCAAGAGG - Intronic
1203165904 17_GL000205v2_random:95306-95328 GGGATGCCCTAGCCCTCTATAGG - Intergenic
1155453983 18:25991394-25991416 CTGAAGGCCTAGGCTTCCAGAGG - Intergenic
1158475039 18:57772539-57772561 GGGAAGGCCTTGGGTGCTAGCGG + Intronic
1161486677 19:4539652-4539674 GGGAAGCCCCAGGCTTCCAAGGG - Intronic
1163088771 19:15003399-15003421 GGGAAGCCCCAGGCTGGGAGAGG - Intronic
1165890607 19:39110135-39110157 GGCAAAACCTAGGCTTCTGGAGG - Exonic
1167291425 19:48627322-48627344 GGGAAGCCCTAGACCTCTGTTGG - Intronic
926184163 2:10675312-10675334 GGGCCACTCTAGGCTTCTAGAGG - Intronic
930049850 2:47206559-47206581 TAGAAGCCTTGGGCTTCTAGTGG - Intergenic
933912714 2:86957400-86957422 GGGGAGGTCTAGGCTTCTGGTGG + Intronic
934010281 2:87812490-87812512 GGGGAGGTCTAGGCTTCTGGTGG - Intronic
935992686 2:108735226-108735248 GGGGAGGTCTAGGCTTCTGGTGG + Intronic
936128004 2:109807868-109807890 GGGGAGGTCTAGGCTTCTGGTGG + Intronic
936216693 2:110563617-110563639 GGGGAGGTCTAGGCTTCTGGTGG - Intronic
936425832 2:112418198-112418220 GGGGAGGTCTAGGCTTCTGGTGG - Intronic
938092941 2:128445000-128445022 GGGGAGCCCTACCCTTCTCGTGG + Intergenic
942794946 2:179806958-179806980 GGCAATCCATACGCTTCTAGAGG + Intronic
948607511 2:239145506-239145528 GGGAAGCACTAGGGATCTAAAGG + Intronic
948800097 2:240429590-240429612 GGGAAGCCCTGCCCTTCCAGAGG - Intergenic
948908499 2:240991361-240991383 TGGAGGCCCTAGGCTGCTGGGGG + Intronic
1172177847 20:32983438-32983460 GGGAAGACCAAGGCTCCTAGAGG + Intergenic
1175737438 20:61396827-61396849 GGGATGCCCCAGGGCTCTAGTGG + Intronic
1176377745 21:6094834-6094856 GGGCAGCCCTGGGCTCCAAGAGG + Intergenic
1176405849 21:6363790-6363812 GGGATGCCCTAGCCCTCTATAGG + Intergenic
1178519830 21:33280006-33280028 GGGAAGCTCTTGGCTTACAGAGG - Intronic
1178760200 21:35394860-35394882 GGAAGGCTCTTGGCTTCTAGAGG - Intronic
1179745729 21:43443410-43443432 GGGCAGCCCTGGGCTCCAAGAGG - Intergenic
1181497551 22:23296005-23296027 GAGGAGCCCTGTGCTTCTAGGGG - Intronic
1181581174 22:23828961-23828983 CAGAAGCCCTAGGCTCCTAGAGG + Intronic
1183831624 22:40421132-40421154 GGGCAGCCTCAGGCTTCTCGGGG + Intronic
1184365362 22:44047711-44047733 TGGAAGCCACAAGCTTCTAGGGG + Intronic
954577137 3:51682794-51682816 TGGATGCCGTAGGCTTCAAGGGG + Intronic
956680503 3:71775030-71775052 GGGATGCTCTAGGCGTCTAGTGG + Intronic
958731343 3:97963615-97963637 GAGAAGCCCTGGTTTTCTAGTGG - Intronic
959310452 3:104729490-104729512 TGGAAACCCAAGGCTCCTAGTGG + Intergenic
960695738 3:120394639-120394661 GCTAAGCCCTATGCTTTTAGAGG + Exonic
961061429 3:123832148-123832170 GGAAAGCACTGTGCTTCTAGAGG + Intronic
961726294 3:128933199-128933221 GGGCAGCCTTTGGCTTCTGGGGG - Intronic
962827226 3:139108733-139108755 GGGAAGCCCCAGGATTAGAGGGG + Intronic
962830573 3:139135715-139135737 GGGAAGCCCACAGCTTTTAGTGG + Intronic
962902682 3:139775005-139775027 GCAAAGCCGCAGGCTTCTAGTGG + Intergenic
963794424 3:149617415-149617437 GGAAAGCCATAAGCCTCTAGTGG - Intronic
964371815 3:156008158-156008180 GGGAAGCCATAGGTTTTTTGTGG + Intergenic
964886066 3:161484542-161484564 GGGGAGCCCTTGACTTCTAAAGG + Intergenic
966051431 3:175620910-175620932 GGGTAGCCCTCAGCTTCAAGAGG + Intronic
968119848 3:196118306-196118328 GGGAATCCATAGGATTCTGGGGG + Intergenic
969271774 4:6108039-6108061 GGGCAGCCCGGGGCGTCTAGGGG + Intronic
969641948 4:8404149-8404171 GGGAAGCCCCAGCCATCTGGAGG - Intronic
985959408 5:3288573-3288595 GGGAAGCCCCTGGTTTCTAGCGG + Intergenic
986299896 5:6470161-6470183 GGGGAGCACCAGGCTTCCAGGGG - Intronic
987274821 5:16351441-16351463 AGAAAGTCCTAGGCTTCAAGAGG + Intergenic
991558496 5:67923267-67923289 AGGAAGCACTGGGCTTCCAGGGG - Intergenic
993198901 5:84786946-84786968 GGGAATCCATAGGTTTCTAAAGG + Intergenic
997654752 5:135546491-135546513 AGGCAGCCCTAGGCTTATCGAGG - Intergenic
999652988 5:153785365-153785387 GGGAACCACTAGGATTCTAGGGG - Intronic
1002098954 5:176847981-176848003 GGGAAGGGCTGGGCTTCTTGAGG + Intronic
1002827290 6:785127-785149 CTGAAGCCCTGGGCTTCTTGTGG - Intergenic
1003183792 6:3813392-3813414 GGGAAGCCCTGGTCGTCTGGGGG + Intergenic
1003956336 6:11168845-11168867 GAGAAGCCCTTCCCTTCTAGGGG + Intergenic
1006153718 6:32002827-32002849 GTGAAGCACTAGACTCCTAGCGG - Intergenic
1006160026 6:32035564-32035586 GTGAAGCACTAGACTCCTAGCGG - Intergenic
1011261039 6:85469628-85469650 GGGGAGCCCTGGGCTTCTTGGGG + Intronic
1015290639 6:131534962-131534984 GTGAATCCTTAGGCTTCTTGGGG + Intergenic
1016359290 6:143250680-143250702 TGGAAGTCCTTGGCTTGTAGCGG - Intronic
1019322065 7:420295-420317 GGGATGCCCTGGCCTTCCAGAGG - Intergenic
1020025372 7:4895990-4896012 GGGAAGCACTAGGCTTCGTCAGG - Intergenic
1021903885 7:25314289-25314311 GGGAAGCCAGCGGCTTCTACAGG + Intergenic
1022046482 7:26626313-26626335 CGGAAGTCCCAGGCTTCTTGAGG - Intergenic
1022763305 7:33380872-33380894 GTAACACCCTAGGCTTCTAGGGG - Intronic
1023024269 7:36036711-36036733 GGGAAGGTCTGGGCTGCTAGTGG + Intergenic
1024589548 7:50869246-50869268 GGGAAACCACAGGCTTCAAGAGG - Intergenic
1026907728 7:74072259-74072281 GGGCAGCCCTACTCTTCCAGAGG + Intergenic
1026959947 7:74401424-74401446 GGGAAGACCTCGCCATCTAGTGG + Intronic
1030756711 7:113294902-113294924 GGTAATCCCCAGGCTTCTGGTGG - Intergenic
1032081096 7:128858822-128858844 GGGAAGCCCTGAGTTTCTGGCGG + Exonic
1037835187 8:22211450-22211472 AAGAAGCCCTATGCTTCAAGGGG + Intronic
1044608799 8:94072004-94072026 GGAAAGCCTCAGGCTTCTTGTGG + Intergenic
1049406396 8:142453493-142453515 GGGAGGCCGGAGGCTTCCAGAGG - Intronic
1057967442 9:99517873-99517895 GGGCAGCCCTTGGTTTGTAGAGG - Intergenic
1058674333 9:107387797-107387819 GGGAAACCATAGTCTCCTAGGGG + Intergenic
1060033461 9:120235074-120235096 TGGAAACCCTTGGCTTCTTGGGG - Intergenic
1060727756 9:126017149-126017171 AGGAAGCCCCAGGCTGCCAGGGG + Intergenic
1060931337 9:127491384-127491406 GGGAAGCCCTTGACTCCCAGGGG - Intronic
1061807130 9:133142792-133142814 GGGAGGCCCTAGGCCCCAAGTGG - Intronic
1187674079 X:21698435-21698457 GGGAAGCCCTGGGCTTGAAGGGG - Intergenic
1189006488 X:37000105-37000127 GGGAAGCCTTAGGCCTCTGAGGG + Intergenic
1190497418 X:51040117-51040139 AGGAAGCCCTAGGATTGTGGGGG - Intergenic
1190508565 X:51154191-51154213 AGGAAGCCCTAGGATTGTGGGGG + Intergenic
1190927538 X:54922591-54922613 GGGAAGCCCCAGGCTCCCCGGGG - Exonic
1195972727 X:110491401-110491423 GGGAAGAGCTAGGATTCAAGGGG + Intergenic
1196709949 X:118752419-118752441 GGAAAGGCCTAGGCTACAAGAGG - Intronic
1199006784 X:142708717-142708739 GGGAGGCCCTAGACTTTTAAAGG - Intergenic
1199977358 X:152902222-152902244 GGCAAGCCCTAGGCTGCTGGTGG + Intergenic
1200494378 Y:3863962-3863984 GGGAAGCCCTAGGTTTATCATGG + Intergenic