ID: 1125508363

View in Genome Browser
Species Human (GRCh38)
Location 15:40280200-40280222
Sequence AAACGGCTCCTGCTTCTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125508363_1125508369 26 Left 1125508363 15:40280200-40280222 CCAGCGAGAAGCAGGAGCCGTTT 0: 1
1: 0
2: 0
3: 1
4: 63
Right 1125508369 15:40280249-40280271 AGTTTGATATAATTTAAACCTGG 0: 1
1: 0
2: 1
3: 22
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125508363 Original CRISPR AAACGGCTCCTGCTTCTCGC TGG (reversed) Intronic
900394195 1:2446437-2446459 ACACAGCTCCTGCTTCTGCCTGG - Intronic
904480611 1:30791105-30791127 AAATCCCTCCTGCTTCTCTCTGG + Intergenic
924690518 1:246345682-246345704 AGACTGCTCCTGCTCCTCCCAGG + Intronic
1062952174 10:1512787-1512809 ACACAGCTCCTGCATCTCACTGG - Intronic
1064139986 10:12782225-12782247 AAACAGCTGCTGCTTCACCCAGG - Intronic
1064278570 10:13930345-13930367 AGAGGGCTCCTGCTACTCTCTGG + Intronic
1064842809 10:19613896-19613918 AAATGGCTGCTGATTCTCTCTGG + Intronic
1065640003 10:27771621-27771643 AAACTCCTCCTGCTTCCAGCAGG - Intergenic
1068461656 10:57337101-57337123 AACCGGCTCCCTCTGCTCGCTGG - Intergenic
1070812299 10:79304609-79304631 AGACGGCTCCTTCTTCTTCCAGG - Intronic
1074926275 10:118075410-118075432 AAACCCCTCATGCTTCTGGCAGG - Intergenic
1080302763 11:30802815-30802837 AAACAGCACTTGCTTCTCTCAGG - Intergenic
1088537008 11:110872442-110872464 AAATGGCTGGTGCTTCTCTCAGG - Intergenic
1089229427 11:116958854-116958876 CATCTGCTCCTGCTTCTCTCAGG + Intronic
1091555505 12:1570342-1570364 CAACGGCTCCTGCCTGTCCCTGG + Intronic
1092918376 12:13208622-13208644 AAACAGCCCCTCCTTCTGGCTGG + Intronic
1097033180 12:56104357-56104379 CAACGGCTCCGCCTTCCCGCCGG + Exonic
1097456410 12:59803933-59803955 AAACACCTCATGCTTCTGGCAGG - Intergenic
1101623719 12:106417525-106417547 AAACTGCTACAGCTTCTAGCCGG - Intronic
1102645654 12:114402001-114402023 AGACTGCTCCTCCTTCCCGCTGG + Intronic
1108819417 13:54329071-54329093 AAACATCTCCTGCTTCTAACGGG + Intergenic
1115786492 14:36832139-36832161 AAACAGCTCCAGCTTCTCTCTGG - Intronic
1117846727 14:59919921-59919943 AAACGGCGGGAGCTTCTCGCTGG - Intronic
1119549541 14:75498298-75498320 GAACGTCTCCAGCTTCTGGCTGG + Intergenic
1119889885 14:78174774-78174796 AAACTGCTCCTGCCTCCAGCAGG + Intergenic
1125508363 15:40280200-40280222 AAACGGCTCCTGCTTCTCGCTGG - Intronic
1126383223 15:48068951-48068973 AAAACGCTCCTGCTTCTGGGTGG + Intergenic
1133725025 16:8529381-8529403 AAATGGCTCTTCCTTGTCGCTGG + Intergenic
1135385441 16:22035376-22035398 AATCCCCTCCTGCTTCTGGCAGG - Intronic
1139974470 16:70797908-70797930 TAGCGGCTTCTGCTTCTGGCGGG - Intronic
1150614175 17:66756141-66756163 AATCGCCTCATGCTTCTGGCAGG + Intronic
1152205050 17:78970131-78970153 AAACTGCCCCTGCTTCTCCATGG - Intergenic
1154065663 18:11104783-11104805 TAACGGCGCCTGCTTCTCTTGGG + Intronic
1154981623 18:21506941-21506963 AAACAACTCCTGCTTCTGGTAGG + Intronic
1160786133 19:900905-900927 AACCCGCTCCTGCTCCTCCCCGG + Exonic
1161729754 19:5952073-5952095 CAAGGGCTTCTGCCTCTCGCCGG + Intronic
1168269060 19:55239883-55239905 CCACTGCTCCTGCTGCTCGCTGG + Exonic
926314196 2:11697444-11697466 GCTCGGCTCCTGCTTCTCCCTGG + Intronic
930722779 2:54653916-54653938 TCAAGGCTCCTGCTTCTCTCTGG - Intronic
932417998 2:71585362-71585384 AAATGGCTACTGCTGCTCACGGG - Intronic
935072404 2:99706381-99706403 AAACAGCACCTGCTTCTATCCGG + Intronic
940854008 2:158715884-158715906 AGACTGCACCTGCTTCTGGCAGG - Intergenic
1170779258 20:19409213-19409235 GAAGGGCTCCTCCTTCTCCCTGG - Intronic
1175245335 20:57578851-57578873 AGACAGCTCCTGCTCCTCGGGGG - Intergenic
1175432586 20:58916610-58916632 AAAAGGCTCCAGACTCTCGCTGG + Intergenic
1180061300 21:45386332-45386354 AAACTGCTCCTGCTGCTGGGGGG - Intergenic
1182452086 22:30427688-30427710 CACCTGCTCCTGCTTCTCTCTGG - Intronic
1184760669 22:46542352-46542374 AAACTGCTCTTGCATCTCCCTGG + Intergenic
1185255582 22:49828879-49828901 AAAGGGCATCTGCTTCACGCCGG - Intergenic
962587464 3:136856863-136856885 AAAGGGCTCTTGCTTGTTGCTGG - Intergenic
964742255 3:159978596-159978618 AAGCACCTCCTGCTTCTAGCAGG + Intergenic
968471738 4:785760-785782 ACGCGGCTGCTGCTTCTCCCTGG - Exonic
968958778 4:3732253-3732275 AAACGACACCTGCTTTTCTCCGG - Intergenic
969785437 4:9453772-9453794 AAACAGCTTCTGCCTCTCGGGGG - Intergenic
969826483 4:9762310-9762332 AAACAGCTTCTGCCTCTCGGGGG - Intergenic
982293769 4:153806235-153806257 AACCGGCTCCCTCTGCTCGCGGG + Intergenic
983817432 4:172149540-172149562 ACACTGCTCCTGCTTATCTCTGG + Intronic
1004009521 6:11668893-11668915 AAGCTGCTCCAGCTTCTCTCTGG - Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1013078074 6:106788793-106788815 AAAAGGCTCCTGTTTCTAGTGGG - Intergenic
1047538634 8:125742979-125743001 AAACCCCTCCTGCTTGTCACAGG - Intergenic
1051841079 9:21399034-21399056 GAAGGTCTCCTGCTTCTGGCAGG + Intergenic
1057369402 9:94456386-94456408 GAGCTGCTCCTGCTTCTAGCAGG - Intronic
1059517214 9:114907202-114907224 AAACTGCCCCTGCTTCTGCCCGG - Intronic
1062193095 9:135257647-135257669 AAATCCCTCCTGCTTCTCCCAGG - Intergenic