ID: 1125508789

View in Genome Browser
Species Human (GRCh38)
Location 15:40282031-40282053
Sequence CCGCAGCGGCGGCGGCGGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1991
Summary {0: 1, 1: 18, 2: 171, 3: 447, 4: 1354}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125508778_1125508789 8 Left 1125508778 15:40282000-40282022 CCAGGGGGACTATCGGAGTTGGA 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1125508789 15:40282031-40282053 CCGCAGCGGCGGCGGCGGCGCGG 0: 1
1: 18
2: 171
3: 447
4: 1354
1125508775_1125508789 16 Left 1125508775 15:40281992-40282014 CCGGGCGGCCAGGGGGACTATCG 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1125508789 15:40282031-40282053 CCGCAGCGGCGGCGGCGGCGCGG 0: 1
1: 18
2: 171
3: 447
4: 1354
1125508771_1125508789 25 Left 1125508771 15:40281983-40282005 CCGCGGGGGCCGGGCGGCCAGGG 0: 1
1: 0
2: 2
3: 32
4: 458
Right 1125508789 15:40282031-40282053 CCGCAGCGGCGGCGGCGGCGCGG 0: 1
1: 18
2: 171
3: 447
4: 1354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125508789 Original CRISPR CCGCAGCGGCGGCGGCGGCG CGG Exonic
900091953 1:924508-924530 CAGCGGCGGCAGCGGCAGCGCGG - Intergenic
900233439 1:1574537-1574559 CCGCAGCGGGGACGACGGCATGG + Exonic
900237557 1:1599986-1600008 CAGCAGCAGCAGCAGCGGCGGGG + Exonic
900237572 1:1600057-1600079 CAGCGGGGACGGCGGCGGCGCGG - Exonic
900237616 1:1600163-1600185 CCGGCGCGGCGGCGGAGGCGGGG + Intergenic
900249293 1:1658913-1658935 CGGCAGCGGCGGCGGCGTAGGGG - Exonic
900305287 1:2003789-2003811 CCTCCGCGGCGCCGGCGGCGTGG + Exonic
900314613 1:2050598-2050620 GCGCAGCGCTGACGGCGGCGGGG + Exonic
900366772 1:2314826-2314848 CGGAAGAGGCGGCGGGGGCGGGG - Intergenic
900578039 1:3393999-3394021 CCGCGGCGGCGGCGGCTCCAGGG + Intronic
901022175 1:6261032-6261054 CGGCGGCGGCGGCGGCGCCTAGG - Intergenic
901056026 1:6448972-6448994 CAGGGGCGGCGGCGGCGGTGGGG - Exonic
901086090 1:6613387-6613409 TCGCTGCGGCGGTGGGGGCGGGG - Intronic
901425954 1:9182562-9182584 ACCCAGCGGCGGCGTGGGCGAGG - Intergenic
901433877 1:9234716-9234738 GCGCGGCGGGGGCGGGGGCGGGG - Intergenic
901433997 1:9235085-9235107 CCGGGGCCGGGGCGGCGGCGGGG - Intronic
901641334 1:10694583-10694605 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
901836370 1:11926353-11926375 CTGCTGCGGCGGTTGCGGCGGGG - Exonic
902053704 1:13583649-13583671 CCGCAGCTGCGGGGGCCGCCAGG - Exonic
902169500 1:14598790-14598812 CCCTAGCCGCGGCGGTGGCGAGG - Exonic
902236430 1:15060351-15060373 CTGCAGGGGCGGGGGTGGCGGGG + Intronic
902286200 1:15410066-15410088 GGGCAGCGGCGGCGGCGGCGGGG + Exonic
902377173 1:16035275-16035297 CAGCATCGGCGGCGGCTGCCCGG - Intergenic
902382351 1:16058534-16058556 CAGCATCGGCGGCGGCTGCCCGG - Exonic
902451463 1:16499247-16499269 CCGCACCGGGTGCGGCGGGGCGG + Intergenic
902451507 1:16499358-16499380 CCGAGGCGGGGGCGGGGGCGGGG + Intergenic
902823137 1:18955807-18955829 GCGCACGGGCGGCGGCGGCGTGG - Exonic
902823236 1:18956230-18956252 CGGGGGCGGCGGCGGCGGCGGGG - Exonic
902856522 1:19210198-19210220 CGGCAGCGGCTCCGGCGCCGGGG - Exonic
902950984 1:19882642-19882664 TGGCGGCGGCGGCGGCTGCGAGG + Exonic
903132731 1:21290232-21290254 GCGCGGCGGCGGCGGCGCCAGGG - Intronic
903263367 1:22142948-22142970 GGGCAGCGGCTGCGGCCGCGGGG + Exonic
903438310 1:23368894-23368916 CAACAGCGCCTGCGGCGGCGCGG + Intronic
903514748 1:23902874-23902896 CCGCGGCCGCGGCGCTGGCGGGG + Intronic
903750213 1:25616799-25616821 CCCGAGCGGCGGCGGCGGCGGGG + Intergenic
903822117 1:26111183-26111205 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
903950675 1:26994303-26994325 CGGCCGCGGCGGCCGCGGCGCGG - Exonic
904215398 1:28914774-28914796 GCGAGGCGGCGGCGGCGGCGCGG + Intronic
904620454 1:31772032-31772054 CCGTGGCGGCGGCGGCGGCGCGG + Intergenic
904642035 1:31938274-31938296 CTGGAGCGGCAGCGGCGGCCGGG - Exonic
904652235 1:32014174-32014196 CAGCAGCGGTGGCGGCTGCGTGG - Exonic
904720066 1:32500835-32500857 CGGCGGCGGCGGCGGCGGGAAGG + Intronic
904822955 1:33256831-33256853 CGGCGGCGGCGGCGGCAGCGGGG + Intronic
904940765 1:34164061-34164083 CGGCAGCGGCAGCGGCGGCGCGG - Intronic
905137076 1:35808176-35808198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905137124 1:35808343-35808365 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905212775 1:36385857-36385879 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
905347046 1:37318369-37318391 CCGCAGCGGCCACCGCGGCCCGG + Intergenic
905369204 1:37474401-37474423 GCGCAGCGGCCGCGGGGGCGGGG + Intergenic
905414378 1:37794379-37794401 CGGCGGCGGCGGGGGCGGCGCGG - Exonic
905414381 1:37794388-37794410 GCGGGGCGGCGGCGGCGGCGGGG - Exonic
905449325 1:38046762-38046784 GCGGAGCGGCGGCGGCGGCGCGG - Exonic
905569353 1:38991508-38991530 CTGAAACGGCGGCGGCGGCTCGG - Exonic
905580768 1:39081597-39081619 GCGCAGCGGCGGCTGGGGAGCGG + Intronic
905639148 1:39576587-39576609 GCGCTGCGGCGGCGGGCGCGGGG + Intronic
905867031 1:41382128-41382150 CCTGCACGGCGGCGGCGGCGCGG + Exonic
905947767 1:41918106-41918128 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
906027224 1:42683239-42683261 CGGCGGCGGCGGCGACTGCGTGG + Intronic
906480943 1:46198454-46198476 CGGCGGCGGCGGCGGAAGCGGGG - Intronic
906525243 1:46489841-46489863 TGGCAGCGGAGGCGGCGGCGCGG + Intergenic
906960831 1:50418739-50418761 CCGCAGCAGCGGCGGCCGAGCGG + Exonic
906960926 1:50419117-50419139 CGGCGGCGGCGGCGTCGACGCGG + Exonic
907051051 1:51330275-51330297 TGGCAGCGGCGGCGGCTGCCAGG + Intronic
907278088 1:53327951-53327973 GAGACGCGGCGGCGGCGGCGCGG - Exonic
907278105 1:53328015-53328037 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
907341539 1:53739168-53739190 CGGCGGCTGCGGCGGCTGCGGGG - Intergenic
907429960 1:54406034-54406056 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
907430105 1:54406547-54406569 CCGCGGAGGCGGCCGCAGCGGGG - Intronic
907689179 1:56645328-56645350 CGGCGGCGGCGGCGGCTACGCGG + Exonic
908129140 1:61057306-61057328 CGGCTGCGGCAGCGGAGGCGCGG + Intronic
908132170 1:61083756-61083778 TGGTGGCGGCGGCGGCGGCGGGG - Intronic
908356852 1:63330391-63330413 CCGCAGAGGCGGAAGCGGCGGGG - Intergenic
909075646 1:71047736-71047758 CCGCGGCCGCGGCGGCGCCAGGG + Exonic
910200114 1:84690467-84690489 CCGCAGCGGAGGAGGGGCCGCGG - Exonic
910251364 1:85201488-85201510 CCGCAGCTGCGGCTGCCGCCCGG + Intergenic
910277560 1:85465069-85465091 CGGCGGCGGCGGAGGCGGCCGGG + Exonic
910981239 1:92961539-92961561 CCGCGGCGGGGGCGGGGGAGTGG - Intergenic
911017242 1:93346184-93346206 CGGCGGCGGCAGCGGCAGCGGGG + Exonic
912174686 1:107141235-107141257 CTGCGGCGGTGGCGGCGGCTCGG + Intronic
912246322 1:107965070-107965092 CTGCAGCGGCGGCCGGGTCGCGG - Exonic
912305227 1:108560218-108560240 ACGCGGCGGCAGCTGCGGCGCGG - Exonic
912381299 1:109249606-109249628 CAGCAGCCGCGGCGGGGACGCGG + Intergenic
912515030 1:110211748-110211770 CAGCGGCAGCAGCGGCGGCGGGG + Exonic
912716966 1:111989874-111989896 GCGCGGCGCCGGCAGCGGCGGGG - Intergenic
912927903 1:113929714-113929736 CGGCGGCGGCGGCGGCGGGAAGG + Exonic
912993490 1:114511122-114511144 GGGCGGCGGCGGCGGCGACGCGG - Exonic
913109093 1:115641971-115641993 GTGCAGCGGCGGCGGCGGCGGGG + Exonic
913703471 1:121396583-121396605 AAGCAGCGGCGGTGGCGGAGGGG - Intergenic
913939234 1:125086691-125086713 CCGCGGCGGCGGCAGGGGGGTGG + Intergenic
913959459 1:143327601-143327623 GCGCAGCGGCGGCGCAGGCGCGG + Intergenic
913979847 1:143498414-143498436 AAGCAGCGGCGGTGGCGGAGGGG - Intergenic
914044323 1:144078001-144078023 CCGCGGCGGCGGGGGGGGGGGGG - Intergenic
914053819 1:144153174-144153196 GCGCAGCGGCGGCGCAGGCGCGG + Intergenic
914074196 1:144323898-144323920 AAGCAGCGGCGGTGGCGGAGGGG - Intergenic
914104980 1:144642548-144642570 AAGCAGCGGCGGTGGCGGAGGGG + Intergenic
914125327 1:144813191-144813213 GCGCAGCGGCGGCGCAGGCGCGG - Intergenic
914197336 1:145454429-145454451 CCGGGGCGGCGGGGCCGGCGGGG - Intergenic
914197409 1:145454635-145454657 CGGCGGCGGCTGCGGCGGTGGGG - Intergenic
914255322 1:145957760-145957782 CAGCGGCGGCGGGGGCGGTGCGG + Exonic
914702933 1:150150342-150150364 CCGCCGCGGCGCCGACGGAGCGG - Intronic
914815572 1:151059745-151059767 CCGCAGGGGCGGCGGCCTTGAGG - Exonic
914869159 1:151458949-151458971 CCGCGGCAGGGGCGGCCGCGGGG - Intronic
914889756 1:151612252-151612274 CGGAGGTGGCGGCGGCGGCGGGG + Exonic
915200116 1:154221009-154221031 CGGCGGCGGCAGCGGCAGCGCGG + Intronic
915325324 1:155078919-155078941 CGGCGGCGGCGGCGGCTCCGGGG + Exonic
915325331 1:155078982-155079004 CAGCAGCGGCAGCAGCGGCACGG - Exonic
915358864 1:155273466-155273488 TCACGGCGGCGGCGGCGGAGCGG - Intronic
915409300 1:155688325-155688347 CGGCAGCGGCGGCAGCAGAGTGG + Exonic
915568213 1:156728594-156728616 CGGCAGTGGCGGCGGAGGAGGGG + Exonic
915616990 1:157046224-157046246 CGGTGGCGGTGGCGGCGGCGGGG - Intergenic
916548310 1:165827530-165827552 TCGCCGAGGCGGAGGCGGCGAGG - Exonic
916651668 1:166839617-166839639 GGGCGGGGGCGGCGGCGGCGCGG + Intronic
916651692 1:166839671-166839693 CGGCAGAGGCGGGGGCGCCGAGG + Intronic
916890258 1:169106615-169106637 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
916890259 1:169106618-169106640 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
917846673 1:179025966-179025988 CTGTGGCGGCGGCGGCGGCTGGG + Exonic
917869594 1:179229627-179229649 CGGCGGCGGCGGCGGCGTTGGGG - Intronic
917962337 1:180154930-180154952 CAGCAGCGACGGCGGCGGCCCGG - Exonic
918064263 1:181089090-181089112 CTGCTGCGGTGGCGGCGCCGGGG - Exonic
918365654 1:183805140-183805162 CGGCGGCGGCGGGGGCAGCGCGG + Intronic
918423578 1:184387078-184387100 CGGCCGCGGCGGCCGCGGCACGG - Exonic
919463240 1:197902936-197902958 CCGGGGCGGCCGCGGCGGGGCGG - Intronic
919712098 1:200738942-200738964 CGGCGGCGGCGGCGGCTGAGGGG + Intergenic
919712133 1:200739107-200739129 CGGCAGCGGCGACGGCGGCAGGG + Intergenic
919847015 1:201648713-201648735 GAGCAGCGGCGGCGGCGACGAGG + Exonic
919847040 1:201648815-201648837 GCCCGGCGGCGGCGGCGGCATGG + Exonic
919981103 1:202643384-202643406 CCGCAGCGGCAGGGCCGGCGGGG - Exonic
920528505 1:206685321-206685343 CGGCGGCGGCGGCTGCGCCGGGG - Exonic
921039535 1:211416660-211416682 AGGCAGCAGCGGCGGCGCCGGGG + Intergenic
921060232 1:211578901-211578923 CCCAGGCGGCGGCGGTGGCGGGG + Intergenic
921155067 1:212432954-212432976 CCGCAGCCGCCGCCGCGGCGCGG - Exonic
921217736 1:212951476-212951498 CGGCAGCGGCGGCGGCGGCGGGG - Exonic
921355563 1:214281437-214281459 CGGCGGCGGCGGCGGCGGGCGGG + Intronic
921432798 1:215083015-215083037 CGGCGGCGGCGGCGGCGGGCAGG + Intronic
922648637 1:227318191-227318213 CAGCAGCTGCGGCGGCGGCGCGG + Exonic
922753741 1:228082874-228082896 CCGCGGCGGCGGCGGCGACAGGG + Intronic
922832256 1:228609820-228609842 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922832816 1:228612061-228612083 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922833377 1:228614302-228614324 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922833937 1:228616543-228616565 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922834494 1:228618784-228618806 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922835048 1:228620999-228621021 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922835605 1:228623219-228623241 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922836163 1:228625461-228625483 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922836721 1:228627700-228627722 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922837280 1:228629942-228629964 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922837841 1:228632183-228632205 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922838399 1:228634423-228634445 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922838957 1:228636648-228636670 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922839517 1:228638889-228638911 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922840078 1:228641120-228641142 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922840638 1:228643361-228643383 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922841201 1:228645592-228645614 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922958590 1:229625911-229625933 TCCCGGAGGCGGCGGCGGCGGGG - Exonic
922958619 1:229626014-229626036 GAGCGGCGGCGGGGGCGGCGGGG - Exonic
923369425 1:233295576-233295598 CGGCGGCGACGGCGGGGGCGCGG - Exonic
923369427 1:233295582-233295604 CGACGGCGGCGGCGACGGCGGGG - Exonic
923506253 1:234609045-234609067 CGGCTGCGGCGTCGGCGGCTGGG + Exonic
923592221 1:235328784-235328806 CGGCAGTGGCGGCGGCTGGGGGG + Intronic
924052425 1:240092265-240092287 AGGGGGCGGCGGCGGCGGCGGGG + Exonic
924289725 1:242524715-242524737 CCGGGGCGGCGGCGGCGGCGGGG + Intergenic
924289729 1:242524721-242524743 CGGCGGCGGCGGCGGGGGTGGGG + Intergenic
924414891 1:243849594-243849616 CTGGACCGGGGGCGGCGGCGAGG - Intronic
924415171 1:243850304-243850326 CGGCGGCGGCGGCGGCGGGAGGG + Intronic
924436683 1:244048905-244048927 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
924436684 1:244048908-244048930 CGGCGGCGGCGGCGGCCGGGAGG + Intergenic
924436699 1:244048952-244048974 ACGCGGCGGCGGCGGGGACGCGG + Intronic
924754779 1:246931477-246931499 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
924816701 1:247448215-247448237 CGGCGGCGGCGACGGCGGCGAGG + Intronic
1062759937 10:10733-10755 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1062759944 10:10762-10784 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1062843776 10:689664-689686 CCGAGGAGGAGGCGGCGGCGCGG + Exonic
1062982534 10:1737212-1737234 CAGCGGCGGCGGCGGCTGCCGGG - Exonic
1063418239 10:5890304-5890326 GCCCGGCGGCGGCGGCAGCGGGG + Intronic
1063652217 10:7949015-7949037 CAGCAGCGGCGGCAGCAGCCGGG - Intronic
1064208973 10:13347779-13347801 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1064209080 10:13348113-13348135 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1064209082 10:13348119-13348141 CGGCGGCGGCGGCGGGGGCCCGG + Exonic
1064230824 10:13528595-13528617 CGGCAGCGGCAGCGGCGGCGCGG + Intronic
1064230925 10:13528889-13528911 CGGCGGCGGCGGCGGAGGCGGGG + Intronic
1064244270 10:13656918-13656940 GCGCGGCGGCGGCGGCGACGAGG - Exonic
1064274196 10:13891771-13891793 CCGCGGCGGGGGCGGCGGCGGGG - Intronic
1064443048 10:15370870-15370892 CGGCGGCGGCGGCGGCGGGAGGG - Intronic
1064443106 10:15371058-15371080 CCGCGGGGCCGGCGGCGGCTCGG + Exonic
1064622442 10:17229379-17229401 CCTGGGCGGCGGCGGTGGCGCGG - Exonic
1064859772 10:19815550-19815572 AAGCCGCGGCGGCAGCGGCGGGG + Intergenic
1064981954 10:21174162-21174184 GCGCGGCGGCGGCGGCGAGGCGG - Intronic
1064981955 10:21174165-21174187 CCTGCGCGGCGGCGGCGGCGAGG - Intronic
1065023083 10:21516866-21516888 CGGCGGCGGCGGCCGCCGCGGGG - Exonic
1065023159 10:21517135-21517157 CGGCGGCGGCGGCGGCTGCCGGG + Exonic
1065100376 10:22325589-22325611 CCGCGGGGGCGGGGCCGGCGCGG - Intronic
1065188870 10:23192958-23192980 GAGCGGCGGCTGCGGCGGCGCGG + Exonic
1065520569 10:26567283-26567305 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1065589776 10:27252564-27252586 CGGCGGCGGCGGGGGCGGCGGGG - Intergenic
1065712750 10:28533211-28533233 CGGCAGCAGCGGCGGCGGCGGGG + Intronic
1066022736 10:31319444-31319466 CGGCAGCGGCGGCAGCGGAGGGG - Intronic
1066026101 10:31362028-31362050 TCGCAGACGGGGCGGCGGCGGGG + Intronic
1066080710 10:31928530-31928552 CGGCGGCGGCGGCGGCGCCGCGG - Intronic
1066094075 10:32056206-32056228 CGGCAGCGGCGGCGGCACCGGGG + Exonic
1066429338 10:35336877-35336899 CAGCAGCGGCGGCGGCGGCGGGG - Exonic
1066464513 10:35640823-35640845 CGGCAGGGGCGGTGGCGGCGGGG - Exonic
1066464801 10:35641984-35642006 CGGCGGCGGCGGCGGCGGCTTGG - Exonic
1066963970 10:42243674-42243696 TGGCAGCGGCGGCGGGGGGGGGG - Intergenic
1067478095 10:46579239-46579261 CCCCAGCGGGGGCGGCGGGGCGG - Intronic
1067616645 10:47762548-47762570 CCCCAGCGGGGGCGGCGGGGCGG + Intergenic
1067841034 10:49679673-49679695 CCTCTGCGGCGGCGGAGGCCTGG + Exonic
1067972715 10:50991307-50991329 CGGCGGCGGCGGCGGCGGCTGGG - Intergenic
1067972811 10:50991711-50991733 CCGCGGCGGCGGGGGCGGGTCGG + Intronic
1068204177 10:53827434-53827456 CGGAGGCGGCGGCGGCGGCGGGG + Exonic
1068669570 10:59709709-59709731 CCGCAGCGGCGGCGGCCACATGG + Exonic
1068690161 10:59906310-59906332 GGGCGGCGGCGGTGGCGGCGGGG - Exonic
1069424686 10:68279045-68279067 CAGCAGCGGCGGCGGGGGAGGGG + Intergenic
1069438502 10:68407186-68407208 CCATGGCGGCGGCGGCTGCGCGG + Exonic
1069698329 10:70404224-70404246 CGGCGGCGGCGGCGGCTGAGAGG + Intergenic
1069769346 10:70887919-70887941 CCGGGGCGGGGGCGGGGGCGGGG - Intronic
1069849699 10:71396929-71396951 CTTGAGCGGCGGCGGCGGCTCGG + Intronic
1070327916 10:75400080-75400102 CGGTGGCGGGGGCGGCGGCGGGG - Exonic
1070328333 10:75401880-75401902 CAGCGGCGGCGGCGGCGGCGCGG - Exonic
1070768310 10:79068814-79068836 CGCCGGCAGCGGCGGCGGCGCGG + Intergenic
1070800831 10:79243557-79243579 CGGCGGCGGCGGCGGCGCGGGGG - Intronic
1070800836 10:79243560-79243582 CCCCGGCGGCGGCGGCGGCGCGG - Intronic
1070877389 10:79826386-79826408 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
1070895838 10:79982361-79982383 CCGCCGCGGGAGCGGCTGCGCGG - Intronic
1070954301 10:80454342-80454364 CGGCGGCGGCAGCGGCGGCGCGG - Exonic
1071618172 10:87094969-87094991 CCGCGGCGGAGGCGGAGGCCCGG - Intronic
1071676384 10:87659715-87659737 CCGCCTAGGCGGCGGCGGCCGGG + Exonic
1071966574 10:90858048-90858070 CGGCGGCGGCGGCGGGCGCGAGG - Intergenic
1071997553 10:91162972-91162994 CCGCGCCGGCGGGGGCGGGGCGG - Intergenic
1072059811 10:91798702-91798724 CCGCTGCGCCGGCGGGGGAGCGG + Exonic
1072719499 10:97771929-97771951 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1072731497 10:97849968-97849990 CTTTGGCGGCGGCGGCGGCGGGG - Intergenic
1072757569 10:98030865-98030887 CGGCGGCGAAGGCGGCGGCGAGG + Intergenic
1073099603 10:100999789-100999811 GCGCCGCGGAGGCGGAGGCGGGG + Exonic
1073101059 10:101006902-101006924 CTGCAGCGGGAGCGGCGGCGGGG + Exonic
1073122655 10:101131892-101131914 CGGCAGCAGCGGCGGTGCCGGGG + Exonic
1073212701 10:101818032-101818054 CCGCAGAGGTGGCAGCGGCCGGG - Exonic
1073446580 10:103584584-103584606 CCGCAGCGACGGCCGCCGCAGGG - Exonic
1074182577 10:111077294-111077316 CCGGGACGGCGGCGGCGGCGGGG - Exonic
1074503355 10:114045005-114045027 CGGTGGCGGCGGCGGCGGCGGGG - Exonic
1074815148 10:117137194-117137216 CCCCGGCGGCGGAGGCTGCGAGG - Intronic
1074865720 10:117543420-117543442 CGGCGGCGGCGGCGGCCGAGTGG - Exonic
1075334490 10:121598458-121598480 CGGGGGCGGCGGCGGCGGCGCGG - Intronic
1075645468 10:124093343-124093365 AGGCAGCGCCGGCGGCGGCCGGG - Intronic
1075697482 10:124447614-124447636 GGGCGGCGGCGGCGGCGGCTCGG - Exonic
1075802008 10:125159900-125159922 CGGCGGCGGCGGCGGCGTCTCGG - Intronic
1076116839 10:127907032-127907054 CCGCGGCGGGGGCGGGGGCCTGG - Intergenic
1076116961 10:127907443-127907465 CCGCGGGGGCGGCGGGGCCGGGG - Intronic
1076372495 10:129964388-129964410 GCGCGGCGGCGGCGGCGGCGAGG - Intergenic
1076554240 10:131311645-131311667 CCGCGCTGACGGCGGCGGCGGGG + Exonic
1076722093 10:132397176-132397198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1076722094 10:132397179-132397201 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1076792824 10:132785985-132786007 GGGCAGGGGCGGCGGCGGCGGGG - Exonic
1076792883 10:132786114-132786136 CGGCGGCGGCGGCGGCTCCGGGG + Intergenic
1077018580 11:407469-407491 CCGCAGCTGGAGCGGCGTCGGGG - Exonic
1077043665 11:535285-535307 CGGCGGCGGCGGCGGCGGGTGGG - Intronic
1077053101 11:576499-576521 CGGCAGAGGCGGCGGCGGCCGGG + Exonic
1077074625 11:694771-694793 CGGCAGCGGCGGCCTCGTCGGGG + Exonic
1077213338 11:1383434-1383456 CAGCAGCGGAGGCCGCGGCCGGG + Intergenic
1077336640 11:2008059-2008081 CCGCAGAGGCAGCTGCGGCTGGG - Intergenic
1077459239 11:2700475-2700497 CTGCAGCGGCGCCGGCGGAGGGG - Intronic
1077514213 11:2992071-2992093 AGGCAGCGGCGGCCGCGGCGGGG - Intronic
1077898826 11:6474014-6474036 CCGCGGCGGCGGGCGGGGCGTGG - Intronic
1077922968 11:6655473-6655495 CGGCAGCGGCGGCGGAGCCGGGG - Intronic
1078190834 11:9091567-9091589 GGGCGGTGGCGGCGGCGGCGCGG + Exonic
1078210329 11:9265156-9265178 CGGTAGCGGCGGCGGCGGGAGGG - Exonic
1078210355 11:9265213-9265235 CGGCAGCCGCGGCGGCCGAGGGG - Exonic
1078210383 11:9265289-9265311 CTGCAGCGGCGGCGGCGCGGAGG - Exonic
1078210384 11:9265292-9265314 TAGCTGCAGCGGCGGCGGCGCGG - Exonic
1078245993 11:9573745-9573767 CGGTGGCGGCAGCGGCGGCGCGG - Exonic
1078316055 11:10294112-10294134 CCGGGTGGGCGGCGGCGGCGAGG - Exonic
1078474926 11:11622005-11622027 CGGCAGCGGCAGCGGCGGCGGGG + Exonic
1078659926 11:13278161-13278183 CCGCAGCGGCAGCCCCCGCGAGG - Intronic
1079076726 11:17389151-17389173 GTGCAGCGGCGGCGGCGGGCGGG - Intronic
1079172092 11:18106006-18106028 GCGACCCGGCGGCGGCGGCGAGG + Exonic
1079459766 11:20669497-20669519 CTGGCGCGGCGGCGGCGGCGTGG - Intergenic
1079689401 11:23403531-23403553 CGGCGGCGGCGGCGGCGCGGGGG - Intergenic
1079689404 11:23403534-23403556 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1080034872 11:27700414-27700436 GCGCGGCGGCGGCAGCGTCGGGG + Intronic
1080503768 11:32893157-32893179 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
1080503805 11:32893254-32893276 TGGCGGCGGCGGCGGCGGCTCGG - Exonic
1080551346 11:33376235-33376257 CTGCAGCGGCGGCGGGAGGGAGG + Intergenic
1080551537 11:33376815-33376837 CAGCAGCGTCGGTGGCCGCGGGG - Intergenic
1081574303 11:44309745-44309767 CTGCGGCTGCGGCGGCGGCTGGG + Exonic
1081773844 11:45665031-45665053 GCGGAGGGGTGGCGGCGGCGAGG - Intronic
1081831910 11:46121536-46121558 CGGCGGCGGCGGCGGCGGGCCGG - Intergenic
1082028693 11:47589847-47589869 CCGGCGGGGCGGCGGGGGCGAGG + Exonic
1082029506 11:47594264-47594286 GCGCTGCGGCAGGGGCGGCGGGG + Exonic
1082787507 11:57324889-57324911 TAGCAGCGGCGGCGGCGGCGGGG - Intronic
1083171096 11:60924507-60924529 CGGCGGCGGCGGCGGCGGCCGGG + Exonic
1083342433 11:61967448-61967470 CGGCGGCGGCGGTGGCTGCGCGG + Exonic
1083393284 11:62371277-62371299 CAGCAGCAGCAGCGGCGACGAGG + Intronic
1083448563 11:62727220-62727242 CGGCGGCGGCGGCGCCTGCGCGG - Exonic
1083617960 11:64035773-64035795 CCCTCGCGGCGGCGGCGGCGGGG - Intronic
1083623651 11:64060936-64060958 CCGCGGCGGCGGCGGCGGCGGGG + Intronic
1083656990 11:64234580-64234602 CAGCGGCGGCGGGGACGGCGGGG - Exonic
1083659807 11:64246782-64246804 CCGCGGCGAGGGCGGCGGCGGGG + Exonic
1083729065 11:64643300-64643322 CGGCAGCGGCAGCAGCGGCGCGG - Intronic
1083772986 11:64878680-64878702 CCGCCGCGGCGGGGGCAGGGCGG + Exonic
1083856794 11:65396937-65396959 CAGCAGCGACGGCGGGTGCGAGG + Exonic
1083876100 11:65525128-65525150 CCGAACCCGCGGCGGCGGTGGGG + Exonic
1083945043 11:65918999-65919021 CGGCGGCGGCGGCCGTGGCGGGG - Exonic
1083970301 11:66070400-66070422 CGGCGGCGGCGGCGGGGGCGCGG - Intronic
1083970306 11:66070406-66070428 CCCCCGCGGCGGCGGCGGCGGGG - Intronic
1084028445 11:66467034-66467056 CCGCCGGGGCGGAGGGGGCGGGG + Intronic
1084072393 11:66744828-66744850 CGGCGGCGGCGGCGGCGGGCGGG + Intronic
1084151355 11:67289317-67289339 CGGCGGCGGCGGCGGCAGCGCGG - Exonic
1084165302 11:67372613-67372635 CCGCGGCGGGGGCGGGGGCGGGG + Intronic
1084284167 11:68120947-68120969 CGGCTGCGGCGGCGGGGGCTGGG + Exonic
1084284177 11:68120983-68121005 CAGCGGCAGCGGCGGCGGAGGGG + Exonic
1084310289 11:68312731-68312753 CAGCAGCGGCCACGGCGGCCCGG - Exonic
1084546751 11:69818611-69818633 CCGCGGGGGAGGCGGCGCCGGGG - Intronic
1084665322 11:70573265-70573287 CTGCAGCGGTGGGGGCGGGGGGG + Intronic
1084837496 11:71813566-71813588 CCGCAGAGGCTGAGGTGGCGCGG - Intergenic
1085043969 11:73342943-73342965 CAGCAGCGCCGCCGGCGGCCGGG + Intronic
1085044013 11:73343108-73343130 CCGCTGGGGCGGGGGCGCCGGGG - Intronic
1085205827 11:74731359-74731381 TCCCAGCAGCGGCGGCGGCGCGG + Intronic
1085205830 11:74731362-74731384 CAGCAGCGGCGGCGGCGCGGCGG + Intronic
1085266433 11:75240610-75240632 CCGGAGGGGCGGGGGCGGAGAGG + Intergenic
1085284626 11:75351726-75351748 CGGGGGCGGCGGCGGCGGCCGGG - Intergenic
1085332959 11:75668223-75668245 CGGCGGCGGTGGCTGCGGCGGGG + Exonic
1085666234 11:78417699-78417721 CATGAGCGGCGGCGGCGACGTGG - Exonic
1086064563 11:82732560-82732582 CTGATGGGGCGGCGGCGGCGGGG + Exonic
1087014622 11:93543236-93543258 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1087014623 11:93543239-93543261 GCGCGGCGGCGGCGGCGGCGGGG - Intronic
1088172852 11:107017887-107017909 CGGCAGCGGCAGCTGCGGCCGGG + Exonic
1088172901 11:107018075-107018097 CGGCCGAGGCGGTGGCGGCGAGG + Exonic
1088400883 11:109422148-109422170 CGGCGGCGGCGGCAGCAGCGCGG + Exonic
1088653455 11:111977575-111977597 CGGCGGCGGCGGCGGCGTCTCGG - Intronic
1089253066 11:117179055-117179077 CCGCAGGGGAGGGGGCGGCCGGG - Exonic
1089432651 11:118436557-118436579 CACCGGGGGCGGCGGCGGCGGGG + Exonic
1089520041 11:119057243-119057265 GCGCCGGGGCGGCGGGGGCGGGG - Intergenic
1089543674 11:119206305-119206327 CGGCGGCGGCGGCGGCGGCCGGG + Exonic
1089700248 11:120240225-120240247 CTCCCGCGGCGGCGGCGGCCGGG + Intronic
1089845092 11:121452204-121452226 CCGGAGCGGCGCGGGCGGCCTGG + Exonic
1089993429 11:122882901-122882923 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1090042335 11:123301898-123301920 CAGCAGGGGCGGCGGCGGCCTGG + Intergenic
1090173205 11:124623109-124623131 CTGCAGCGGAGCCCGCGGCGAGG - Exonic
1090238280 11:125165145-125165167 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1090710057 11:129375912-129375934 CGGCAGCTGGGGAGGCGGCGGGG - Intergenic
1090817784 11:130314444-130314466 AGGCGGCGGCGGCGGCGGCCCGG + Exonic
1090836522 11:130458131-130458153 CCACAGAGGCGGCTGCGGGGTGG + Intronic
1202819624 11_KI270721v1_random:63241-63263 CCGCAGAGGCAGCTGCGGCTGGG - Intergenic
1091434019 12:459903-459925 CCGGGGCGGGGGCGGGGGCGGGG + Intergenic
1091498323 12:991332-991354 CCGCGGCGGCGGCGACAGCGCGG + Intronic
1091550286 12:1530981-1531003 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1091558577 12:1594153-1594175 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1091823259 12:3491755-3491777 GCTGAGCGGCGGCGGCGGCGCGG - Intronic
1092335408 12:7628703-7628725 GGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1092335416 12:7628724-7628746 CGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1092335426 12:7628751-7628773 CGGCAGGGGCGGCGGCGGCAGGG - Intergenic
1092335432 12:7628766-7628788 CGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1092383589 12:8018708-8018730 CGGGCGCGGCGGCGGCGGCCTGG - Intergenic
1092401202 12:8180504-8180526 CCGCAGAGGCTGAGGTGGCGCGG + Intronic
1092487433 12:8914619-8914641 CCGGAGCGGCGGGAGGGGCGGGG + Exonic
1092564205 12:9647962-9647984 CAGAAGCGCCGGCGGCTGCGGGG + Intergenic
1093039885 12:14365698-14365720 CGGCGGTGGCAGCGGCGGCGCGG + Intronic
1093465022 12:19440029-19440051 CAGCAGCAGCGGCGGGGGTGAGG + Exonic
1093894822 12:24563347-24563369 GCACAGTGCCGGCGGCGGCGGGG - Intergenic
1094041116 12:26122632-26122654 CGGCAGCGGCGGCGGCCCGGGGG - Exonic
1094041119 12:26122635-26122657 CGGCGGCAGCGGCGGCGGCCCGG - Exonic
1094840368 12:34340293-34340315 CCGCAGGAGCGGCGTTGGCGGGG - Intergenic
1095476155 12:42589413-42589435 CCGCAGAGGGGGCTGCGGCGCGG - Intronic
1095752684 12:45729287-45729309 TTTCGGCGGCGGCGGCGGCGGGG - Intergenic
1095801019 12:46269597-46269619 CCGAAGTGGCAGGGGCGGCGGGG + Intronic
1096786852 12:54021766-54021788 CAGGAGCGGCTGCGGCGCCGTGG - Intronic
1096863838 12:54549625-54549647 CGGCAGCAGCAGCGGCGGTGCGG + Exonic
1096946739 12:55415022-55415044 CCGGAGCGGCGGGAGGGGCGGGG - Intergenic
1096983748 12:55743420-55743442 CGGCGGCGGCGGCAGCGGCGGGG + Exonic
1097267803 12:57755773-57755795 CGGGGGCGGCAGCGGCGGCGCGG - Exonic
1097929631 12:65169838-65169860 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1097989926 12:65824205-65824227 CCTCGGCGGCGGCGGCGCCCGGG - Exonic
1098105963 12:67069314-67069336 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
1098255429 12:68611075-68611097 AAGCCGCGGCGGCGGCCGCGCGG + Intronic
1098550372 12:71755138-71755160 GGCCGGCGGCGGCGGCGGCGGGG + Exonic
1098550374 12:71755141-71755163 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1098893218 12:76030797-76030819 CGGCTGCGGCTGCGGCTGCGAGG + Exonic
1099713723 12:86264461-86264483 CTGCAGCGGGGGAGGCGGGGAGG + Intronic
1100611401 12:96194356-96194378 CCGGGGCGGCGGGGGAGGCGCGG + Intergenic
1100632295 12:96400598-96400620 CGGCGGCGGAGGCGGGGGCGGGG + Intergenic
1100963102 12:99984843-99984865 CGAGGGCGGCGGCGGCGGCGAGG + Intergenic
1101144785 12:101830840-101830862 CGGAAGCGGCGGCCGCGGCGCGG - Exonic
1101144828 12:101830950-101830972 AGGCGGCTGCGGCGGCGGCGGGG + Intergenic
1101371891 12:104138033-104138055 CCGCGGCGGCGTTGGCGGCGGGG + Intronic
1101592900 12:106139199-106139221 CGGCGGCGGCGGCGGCGGCCAGG + Exonic
1101813627 12:108129303-108129325 TGGCGGCGGCGGCAGCGGCGCGG + Intergenic
1102197156 12:111033973-111033995 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1102197157 12:111033976-111033998 CGGCGGCGGCGGCGGCGCGGCGG + Intergenic
1102371018 12:112382324-112382346 CGGCGGCGGCGGCGGCGGCAGGG - Intronic
1102457135 12:113077847-113077869 CGGCGGCGGCAGCGGGGGCGCGG - Exonic
1102457137 12:113077853-113077875 TGGCGGCGGCGGCGGCAGCGGGG - Exonic
1102853863 12:116277234-116277256 CCCCGGCGGCGGCGGCGGCCCGG - Exonic
1102853960 12:116277514-116277536 CCGCGGCGGCGGCGGCTCCGAGG - Intergenic
1103377716 12:120469643-120469665 CTGAGGCGGCGGCGGCGACGTGG - Exonic
1103410841 12:120710500-120710522 CGGCCGCGGCGTCGGCGGCTGGG + Exonic
1103433036 12:120904144-120904166 ACATGGCGGCGGCGGCGGCGCGG + Exonic
1103433068 12:120904248-120904270 GGGCGGCGGCGGCGGCGGCCGGG + Exonic
1103509876 12:121467057-121467079 TCGCGGCGGCGGCGGCGTCGCGG + Intronic
1103595357 12:122021824-122021846 TGCCGGCGGCGGCGGCGGCGCGG + Exonic
1103595557 12:122022577-122022599 CCGCGATGCCGGCGGCGGCGGGG + Intronic
1103623893 12:122204561-122204583 GCCGGGCGGCGGCGGCGGCGGGG - Exonic
1103749870 12:123151158-123151180 GAGCGGCGGCGGCGGCGGCGGGG + Intergenic
1103758804 12:123233074-123233096 CGGCAGCGGGAGCGGCGGCCAGG - Exonic
1103764669 12:123271665-123271687 GGGCGGCGGCGGCGGCGGCGAGG + Exonic
1103800356 12:123533735-123533757 CGGCGGCGGCGGCGGCAGCGGGG + Intergenic
1103800357 12:123533738-123533760 CGGCGGCGGCGGCAGCGGGGAGG + Intergenic
1103908674 12:124340166-124340188 CGGCAGCAGCGGCGGGGGTGGGG - Exonic
1103908678 12:124340172-124340194 GAGCAGCGGCAGCAGCGGCGGGG - Exonic
1103954266 12:124567621-124567643 CGGCGGCGGCGGCGGCGGGAGGG + Intergenic
1103968624 12:124655763-124655785 CCTCAGCTGGGGAGGCGGCGGGG - Intergenic
1104030921 12:125065446-125065468 GGTCAGCGACGGCGGCGGCGGGG - Exonic
1104049563 12:125186488-125186510 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
1104444712 12:128823860-128823882 CGGCGGCCGCGGCGGCGGCTGGG - Exonic
1104568136 12:129903419-129903441 CCGCAGCGGGGCCGGTGGCGAGG + Exonic
1104802775 12:131565933-131565955 CTGCAGGGGCCGCGGCGTCGTGG + Intergenic
1104841458 12:131828041-131828063 GCGCTGCGGCGGCGGCTCCGGGG + Intergenic
1104880090 12:132064777-132064799 CTGCTGCTGCGGCGGCTGCGAGG - Exonic
1104891908 12:132144240-132144262 CCGATGCGGCAGCTGCGGCGGGG - Exonic
1104961623 12:132490766-132490788 TCGCGGCGGCGGCGGCGCGGGGG - Exonic
1104983306 12:132583364-132583386 CCGGGGCGGGGGCGGCAGCGGGG - Exonic
1105217489 13:18297632-18297654 GGGCAGCGGCGGCGGCGGCTAGG + Intergenic
1105472071 13:20703737-20703759 TCGGGGCGGCGGCGGCGGCGGGG + Intronic
1105472074 13:20703743-20703765 CGGCGGCGGCGGCGGGGGCCGGG + Intronic
1105502882 13:20988336-20988358 CCGCAGCCGGGGCGGGGGCGGGG + Exonic
1105502887 13:20988342-20988364 CCGGGGCGGGGGCGGGGGCGGGG + Exonic
1105512407 13:21061466-21061488 CCCGGGCGGCGGCGGTGGCGTGG + Exonic
1105578630 13:21674461-21674483 CCGGAGCGGAGGCGGGGGCGCGG - Intronic
1105943551 13:25171217-25171239 CGACAGCGGCGGGGGCGGCGGGG - Exonic
1105943641 13:25171586-25171608 CCGGAGCCGCGGCGGCGGCGGGG - Exonic
1106057711 13:26254267-26254289 CTGCTGCGGCGGGAGCGGCGGGG - Exonic
1106157458 13:27171665-27171687 TCACAGCGGCGGCGGCGGGCGGG + Exonic
1106187805 13:27424565-27424587 GCGCAGCAGCGGCGCCGACGCGG + Exonic
1106226930 13:27793017-27793039 CGGCAGCAGCAGCGGCGGCCGGG - Exonic
1106227088 13:27793783-27793805 CCATCGTGGCGGCGGCGGCGGGG + Exonic
1106241999 13:27920263-27920285 CGGGTGCGGCGGCGGCGGCGGGG - Exonic
1106304099 13:28495051-28495073 CCCCGGCAGCGGCGGCGGCTCGG - Exonic
1106322966 13:28659278-28659300 TGGCGGCGGCGGCGGCAGCGTGG + Intronic
1106340263 13:28820310-28820332 GCGCAGCCGCGGCGCGGGCGTGG + Intergenic
1106478031 13:30114805-30114827 GGGAGGCGGCGGCGGCGGCGGGG + Intergenic
1106516977 13:30464819-30464841 GCGCGGCGGCGGCGGCGGGCGGG + Intronic
1106517086 13:30465187-30465209 CGGCGGCGGCGGCGGCCGGGCGG - Intronic
1106517087 13:30465190-30465212 TCGCGGCGGCGGCGGCGGCCGGG - Intronic
1106517166 13:30465403-30465425 CCGGGGCGGCGGGGCCGGCGCGG - Intronic
1106568512 13:30906694-30906716 CCGGGGAGCCGGCGGCGGCGCGG + Exonic
1107133326 13:36919686-36919708 CCGCGGCGGGGGCGGCGGTCGGG - Intronic
1107133521 13:36920351-36920373 CCGCAGAGGAGGGGGCTGCGCGG + Intronic
1107548894 13:41457487-41457509 CCGGAGCGGAGGCGGGGCCGGGG - Intergenic
1107548962 13:41457734-41457756 CTGCGGCCGCGGCGGCCGCGGGG - Exonic
1107604015 13:42040760-42040782 CGGCGGCGGCGGCGGCCGAGAGG + Intronic
1107604033 13:42040814-42040836 CCGGCGCAGCGGCGGCGGCGGGG + Intronic
1109284858 13:60397600-60397622 AGGCGGCGGCGGCGGCGGCCTGG + Intronic
1110318599 13:74135550-74135572 CCGGAGGGTCGGCGGGGGCGGGG + Intergenic
1110450815 13:75636181-75636203 CCACAGAGGCGGCCGCGGCCGGG + Intronic
1110558471 13:76886097-76886119 ACCCAACGGGGGCGGCGGCGGGG - Exonic
1110558511 13:76886257-76886279 TGGCGGCGGCGGCGGCGGCGGGG - Exonic
1110573012 13:77026777-77026799 CCGCTGCGACGGCGGAGCCGGGG - Intronic
1110596585 13:77326776-77326798 CGGCGGCGGCGGCGGCGGCGAGG - Intronic
1110596630 13:77326955-77326977 CAGTAGCGGCGAGGGCGGCGCGG - Intronic
1110630265 13:77698452-77698474 CAGCAGCGTGGGGGGCGGCGAGG - Intronic
1110705865 13:78601961-78601983 CAGCGGCGGCGGCGGCGGCCGGG - Exonic
1110705949 13:78602197-78602219 CCCGGGCGGCGGCGGCGGCCCGG - Exonic
1110887202 13:80654961-80654983 CCGCAGCGGGGGCAGCAGCACGG - Intergenic
1111397095 13:87677814-87677836 CTGCAGCTGCAGCTGCGGCGGGG - Exonic
1112091797 13:96090809-96090831 CGGCGGCGGCGGCGGCAGGGCGG - Intergenic
1112091798 13:96090812-96090834 CGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1112216256 13:97434108-97434130 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1112271904 13:97976481-97976503 CGGCGCCGGCGGCCGCGGCGGGG + Intronic
1112328277 13:98458545-98458567 CCGCCTCGGGGCCGGCGGCGTGG - Intronic
1112504968 13:99970086-99970108 TGGTGGCGGCGGCGGCGGCGCGG + Intronic
1112505042 13:99970434-99970456 CGGCGGCGGCGGCGGCAGCCCGG + Exonic
1112505083 13:99970584-99970606 CGGCGGCGGCGGCGGCGCCGGGG + Exonic
1112506990 13:99981403-99981425 CCGCGGCGGGGGCGCCGGGGCGG - Intergenic
1112507195 13:99982130-99982152 CCGCCGCCGCCGCGGCGGAGTGG - Exonic
1112507851 13:99985565-99985587 CAGTGGCGGGGGCGGCGGCGGGG + Exonic
1113085620 13:106567413-106567435 TCGGAGAGGCGGCGGCGGGGCGG - Intronic
1113200736 13:107866164-107866186 CGGCGGCGGCGGCGGCGGCAAGG - Exonic
1113350127 13:109521560-109521582 CGGCAGCAGAGGCGGAGGCGTGG - Intergenic
1113377897 13:109782132-109782154 CAGCACCGGCGGCGGGTGCGGGG - Exonic
1113377931 13:109782235-109782257 CGGCGGCGGCGGCTGCGGCTGGG + Exonic
1113378816 13:109785570-109785592 ACGCGGCGGGCGCGGCGGCGGGG + Exonic
1113379060 13:109786486-109786508 CAGCAGCCCCGGCGGCGGCGCGG - Exonic
1113493627 13:110712411-110712433 CCGCGGCGGCCGCAGCGGGGCGG + Intronic
1113541771 13:111115145-111115167 GCGGGGCGGCGGCGGCGGCTGGG - Intronic
1113541867 13:111115434-111115456 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1113655920 13:112067745-112067767 CGGCGGCGGGGGCGGAGGCGGGG + Exonic
1113655928 13:112067763-112067785 CGGGGGCGGCGGCGGCGGCGGGG + Exonic
1113789919 13:113022768-113022790 CCACCGCGGCGGCGGCTGAGGGG + Intronic
1113789921 13:113022771-113022793 CCGCGGCGGCGGCTGAGGGGAGG + Intronic
1113967340 13:114161480-114161502 CCGCGGCGGCCACAGCGGCGGGG + Intergenic
1114634179 14:24178115-24178137 CGGCGACGACGGCGGCGGCGAGG - Exonic
1115028336 14:28767242-28767264 GGGAAACGGCGGCGGCGGCGCGG - Exonic
1115028391 14:28767464-28767486 CGGCGGCGGCGGCGGTTGCGGGG - Exonic
1115235793 14:31207670-31207692 GGGCGACGGCGGCGGCGGCGCGG + Intronic
1115399144 14:32938833-32938855 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1115474558 14:33800587-33800609 CGGGAACGGCGGCGGGGGCGGGG + Exonic
1115474562 14:33800593-33800615 CGGCGGCGGGGGCGGGGGCGGGG + Exonic
1115474566 14:33800605-33800627 CGGGGGCGGGGGCGGCGGCGCGG + Exonic
1115754275 14:36517673-36517695 CGGCGGCGGCGGGGGCGGCGGGG - Exonic
1115761311 14:36581057-36581079 CGGCGGCGGCGGCGGTGGCGAGG - Exonic
1115851784 14:37595141-37595163 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1115851785 14:37595144-37595166 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1116018241 14:39432044-39432066 CAGCAGCTGCGACGGCTGCGGGG - Exonic
1116186578 14:41606860-41606882 CGGCGGCGGCGGCGGGCGCGCGG - Intergenic
1116436180 14:44897479-44897501 CGGCGGCGGCGGCGGCAGCCCGG + Exonic
1116817863 14:49599795-49599817 CCGCGGCGGCGGCAGCGCCGCGG + Intronic
1116895515 14:50311972-50311994 CAGCAGCGCAGGCGGCGGGGAGG + Intronic
1116905090 14:50396640-50396662 TCCCCGCGGAGGCGGCGGCGAGG + Intronic
1116928618 14:50668076-50668098 CGGCGGCGGAGGCGGCGGCTCGG - Exonic
1117424424 14:55580264-55580286 CGGCGGCGGCGGCGGCGCCTCGG + Intronic
1117647367 14:57865997-57866019 CGGCGGCGGCGGCGGCGGAGCGG + Intronic
1117842123 14:59870644-59870666 CCGGCGCGGCGACGGCGGCTTGG + Exonic
1117875931 14:60249727-60249749 GCGCGGCGGCGGCGGCGGGCAGG + Intronic
1117898271 14:60509374-60509396 AGGCAGTGCCGGCGGCGGCGAGG - Exonic
1117920792 14:60723768-60723790 GCGCGGCGGCGGCGGCGGCGTGG + Exonic
1117920793 14:60723771-60723793 CGGCGGCGGCGGCGGCGTGGTGG + Exonic
1118186544 14:63543136-63543158 CGGCGGCGGCGGCGACGACGTGG + Exonic
1118366675 14:65102361-65102383 CCACTGCAGCGGCGGCGGGGAGG + Exonic
1118809215 14:69261206-69261228 GCACAGCGGGGGCGGCGGCGGGG + Intronic
1118849484 14:69573097-69573119 CGGCGGCGGCGGCGGCCGCGGGG + Exonic
1119158779 14:72435752-72435774 CAGCAGGGGCGGGGGCGGGGTGG - Intronic
1119410308 14:74426150-74426172 GCGCGGCGGCGGCGGCGGCGGGG - Intergenic
1119484917 14:74980924-74980946 CCACGGTGGCGGCGGCGGCGCGG + Intergenic
1119759659 14:77141547-77141569 GCAGTGCGGCGGCGGCGGCGCGG - Intronic
1120167902 14:81220357-81220379 CGGCGGCGGCGGCGGCCGCGCGG + Intronic
1121050439 14:90816332-90816354 GCGCCGCGGCGGCGGCGGTGGGG - Exonic
1121050492 14:90816453-90816475 CGGCGGCGGCGGGCGCGGCGGGG + Intronic
1121074973 14:91060398-91060420 TGGCAGCAGCGGCGGCGCCGCGG - Exonic
1121137233 14:91510015-91510037 CTGAGGAGGCGGCGGCGGCGCGG - Exonic
1121253055 14:92513803-92513825 GCGCGGCGGCAGCGGCGGCCTGG + Exonic
1121417509 14:93789097-93789119 CGGCGCTGGCGGCGGCGGCGGGG - Intergenic
1121630440 14:95418010-95418032 CCGCAGACTCGGCGGTGGCGAGG - Exonic
1121767800 14:96502536-96502558 CGGCAGCGGCGGCGGTTGCGGGG + Exonic
1122081692 14:99271296-99271318 CGGCAGCGGCGGCAGCGGCGCGG - Intronic
1122130725 14:99603446-99603468 AAGCGGTGGCGGCGGCGGCGGGG - Exonic
1122162375 14:99793592-99793614 CGGCGGCGACGGCGACGGCGGGG + Intronic
1122183495 14:99971987-99972009 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1122208373 14:100159639-100159661 CTGTCGCGGCGGCCGCGGCGCGG + Exonic
1122220977 14:100239071-100239093 CGGGCGCCGCGGCGGCGGCGGGG - Exonic
1122221170 14:100239799-100239821 CCTCAGCGGCGGGGCCGGCGCGG + Exonic
1122418388 14:101561012-101561034 CCGCACGAGCGGCAGCGGCGTGG + Intergenic
1122445019 14:101761787-101761809 CGGCGGCGGCGGCGGCCGCGGGG + Exonic
1122470798 14:101964700-101964722 GCCCGGGGGCGGCGGCGGCGAGG + Exonic
1122486761 14:102087141-102087163 GCGCGGCCGCGGCGGCGGCTGGG - Intronic
1122517623 14:102319807-102319829 TGGCGGCGGCGGCGGCGGCCCGG + Exonic
1122603025 14:102930568-102930590 CCGCCGCGGCAGGGGCTGCGGGG - Exonic
1122620962 14:103057473-103057495 CTGCGGCGGCGGCGGCGGGGAGG - Intergenic
1122620963 14:103057476-103057498 AGTCTGCGGCGGCGGCGGCGGGG - Intergenic
1122689120 14:103523186-103523208 CAGCCCCCGCGGCGGCGGCGAGG + Intergenic
1122736669 14:103847515-103847537 AGGCGGCGGCGGCGGCGGCCGGG - Exonic
1122779157 14:104136372-104136394 GCGCGGCGGCGGCGGGCGCGCGG + Intergenic
1122941882 14:104985127-104985149 CCACAGAGGGGTCGGCGGCGCGG + Intergenic
1122970610 14:105150663-105150685 CCACAGCGGCGGCCTCTGCGAGG - Exonic
1122975252 14:105168328-105168350 GCGGGGCGGCGGGGGCGGCGGGG - Intronic
1122975332 14:105168543-105168565 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1122975336 14:105168549-105168571 CGGCGGCGGCGGCGCGGGCGGGG + Exonic
1123024891 14:105419899-105419921 CGGCGGCGGCGGCAGCAGCGCGG + Exonic
1123024925 14:105420011-105420033 CCGGGCCGGCGGCGGCGGAGGGG - Exonic
1123037986 14:105479073-105479095 CCGGGGCGGGGGCGGGGGCGGGG - Intronic
1123040182 14:105487214-105487236 CGGCAGCGGCTGGGGCGGCACGG - Exonic
1202899792 14_GL000194v1_random:28393-28415 CCACAGCGCCGGCGCAGGCGCGG - Intergenic
1202940252 14_KI270725v1_random:138210-138232 CCGCAAAAGCCGCGGCGGCGGGG + Intergenic
1123675782 15:22709598-22709620 CCCAAGAGGCGGAGGCGGCGGGG - Intergenic
1123684351 15:22786685-22786707 CGGCGGCGGCGGCGGCGGCCGGG + Exonic
1123898067 15:24848237-24848259 CGGGGGCGGCGGCGGGGGCGGGG + Intronic
1123898071 15:24848243-24848265 CGGCGGCGGGGGCGGGGGCGGGG + Intronic
1124029701 15:25999308-25999330 AGGCGGCGGCGGCGGCGGCCTGG - Intergenic
1124327779 15:28782521-28782543 CCCAAGAGGCGGAGGCGGCGGGG - Intergenic
1124427040 15:29570927-29570949 GCGGCGCGGCGGCGGCGGCATGG - Intergenic
1124469271 15:29968790-29968812 CGGCGGCGGCGGAGGCGGCGGGG - Intronic
1124496796 15:30192114-30192136 CCGCAGCGGCAGGGCCGGCGGGG - Intergenic
1124746780 15:32346533-32346555 CCGCAGCGGCAGGGCCGGCGGGG + Intergenic
1124922311 15:34038911-34038933 CGGCGGCGGAGGCGGCGGCGGGG - Exonic
1124929143 15:34101889-34101911 CAGCGGCGGCGGTGGCGGCCGGG - Exonic
1124971126 15:34490500-34490522 GGGCGGCGGGGGCGGCGGCGGGG - Intergenic
1125033067 15:35092456-35092478 CAGCAGGGGCGGCGGCGGGTGGG + Intergenic
1125200730 15:37098988-37099010 GCGCAGCGGCTGCGGCAGCGCGG + Intronic
1125508789 15:40282031-40282053 CCGCAGCGGCGGCGGCGGCGCGG + Exonic
1125516613 15:40324318-40324340 CTTCGGGGGCGGCGGCGGCGGGG + Intergenic
1125522928 15:40358232-40358254 TGGCGGCGGCAGCGGCGGCGGGG - Exonic
1125522960 15:40358342-40358364 CAGCAGCGGCGGCAGCGGTCCGG + Exonic
1125539581 15:40462217-40462239 CGGCGGCGACGGCGGCGGCGAGG - Exonic
1125626830 15:41115987-41116009 CCGCCGCCGTCGCGGCGGCGGGG - Exonic
1125626837 15:41115992-41116014 CCGCCGCGACGGCGGCGGAGGGG + Exonic
1125626841 15:41115995-41116017 CCGCGACGGCGGCGGAGGGGGGG + Exonic
1125677578 15:41511200-41511222 CGGCTTCGGGGGCGGCGGCGGGG - Exonic
1126034959 15:44537199-44537221 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1126109483 15:45167146-45167168 CAGCCGGGGCGGGGGCGGCGGGG + Intergenic
1126852399 15:52805379-52805401 AGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1127144112 15:56007290-56007312 CGGGGGAGGCGGCGGCGGCGGGG + Intergenic
1127144120 15:56007308-56007330 CGGGGGAGGCGGCGGCGGCGGGG + Intergenic
1127144128 15:56007326-56007348 CGGGGGAGGCGGCGGCGGCGGGG + Intergenic
1127144136 15:56007344-56007366 CGGGGGAGGCGGCGGCGGCGGGG + Intergenic
1127144144 15:56007362-56007384 CGGGGGAGGCGGCGGCGGCGGGG + Intergenic
1127144149 15:56007371-56007393 CGGCGGCGGCGGGGGAGGCGGGG + Intergenic
1127165765 15:56243783-56243805 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1127165776 15:56243817-56243839 CGGCGGCCGCGGCGGCGGCGGGG - Intergenic
1127439028 15:58987745-58987767 CGGCAGTGGCGGCGACGGCGAGG + Intronic
1127515521 15:59689393-59689415 GCGTGGCGGCGGCGGAGGCGTGG + Exonic
1127753439 15:62068015-62068037 CTACGGCGGCGGCGGCGGCCCGG + Exonic
1127763622 15:62164576-62164598 CTGCGGCGGCGGCGGAGGCCCGG - Exonic
1127849073 15:62897297-62897319 CCGCAGGGGTGGGGGCCGCGGGG + Intergenic
1128056469 15:64703223-64703245 CGGCGGCGGCGGTGGCGGCCGGG - Exonic
1128067858 15:64775603-64775625 CGGCGGCGGCAGCGGCGGCGGGG + Intergenic
1128067862 15:64775609-64775631 CGGCAGCGGCGGCGGGGGGCGGG + Intergenic
1128279929 15:66386606-66386628 CCGCAGAGGTGGAGGCCGCGCGG + Intronic
1128322518 15:66703342-66703364 CGGCGGCGGTGGCGGCGACGAGG + Exonic
1128322667 15:66703914-66703936 GAGCAGCAGCTGCGGCGGCGCGG - Exonic
1128344127 15:66842819-66842841 GGGCGGCGGCGGCGCCGGCGCGG + Intergenic
1128454156 15:67823353-67823375 GCGCGGCGGCGGGGACGGCGCGG - Intronic
1128454949 15:67827103-67827125 TGGGAGCGGCGGCGGCGGCGCGG + Intronic
1128455188 15:67827977-67827999 CCGAGGCGGCGCCGGGGGCGGGG - Intronic
1128547740 15:68579199-68579221 CGGGGGCGGCGGCGGCGGCCCGG - Exonic
1128841472 15:70854235-70854257 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
1129116413 15:73367761-73367783 CTGCTGGGGCGGCGGCGGCGAGG + Exonic
1129287993 15:74541195-74541217 CCGCACCGGAAGCGGCGCCGCGG - Exonic
1129299243 15:74615926-74615948 CGACAGCGGCGGCGGCGGCCGGG + Intronic
1129348281 15:74938166-74938188 CCGCGCGGCCGGCGGCGGCGGGG + Exonic
1129752791 15:78077598-78077620 CGGCGGCGGCGGCGAGGGCGCGG - Exonic
1129752822 15:78077691-78077713 GCGCAGCGGCCGCGGCGCGGAGG - Intronic
1129893783 15:79089485-79089507 CGGCGGCGGCGGCGGCGCAGGGG + Intronic
1130023644 15:80251957-80251979 CCGCTGCCGCGGCGCCTGCGGGG - Intergenic
1130362959 15:83207681-83207703 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1130540344 15:84817355-84817377 CGGGAGCGGCGGCGGCGGGCAGG + Exonic
1130564426 15:84981697-84981719 CGGCGGCGGCGGCGGGAGCGGGG + Intronic
1130656435 15:85794779-85794801 CTGAGGCGGCGGCGGCGGCGGGG - Exonic
1131094813 15:89648497-89648519 CCGCCGCGGAGGCGGTGGCTGGG + Exonic
1131144431 15:90002021-90002043 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1131257556 15:90872038-90872060 CGGCAGCCCCGGTGGCGGCGGGG - Intronic
1131367664 15:91853715-91853737 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1131367719 15:91853881-91853903 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1131466086 15:92655748-92655770 CTGCGGCGGAGGCGGCTGCGCGG + Exonic
1131475398 15:92734255-92734277 GGAGAGCGGCGGCGGCGGCGCGG - Intronic
1131693881 15:94855573-94855595 CTGAGGCGGCGGCGGCGGCGAGG + Intergenic
1131827015 15:96330404-96330426 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1132055558 15:98648545-98648567 TGGCAGCGGCGGCGGCGGCGCGG + Intergenic
1132055675 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG + Exonic
1132079489 15:98852345-98852367 CCACGGCGGCGGCGCGGGCGCGG - Intronic
1132111599 15:99105720-99105742 CCGCAGGCGTGGCGGCGGCGCGG - Exonic
1132604651 16:788627-788649 GCGCGACGGCGGCGGCGGCGCGG + Exonic
1132641879 16:981786-981808 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
1132641881 16:981792-981814 CGGCGGCGGCGGCAGGGGCGAGG + Exonic
1132915348 16:2340818-2340840 CCGGAGCGGCCGAGGCGGCCGGG - Intergenic
1132915440 16:2341229-2341251 CCGAAGGCGAGGCGGCGGCGAGG + Intergenic
1132942240 16:2514048-2514070 CCGAGGCGGTGGCGGAGGCGGGG - Exonic
1133040884 16:3059247-3059269 GCGCAGGGGCGGCGGCGGCGGGG + Exonic
1133079288 16:3305688-3305710 CTGGAGCGGCGGCGGCCGCAGGG + Intronic
1133156451 16:3880136-3880158 CGGCGGCGGCGGCGGCGGCCGGG - Exonic
1133156574 16:3880479-3880501 CGGCGGCGGCGGCGGCGGAACGG - Exonic
1133212873 16:4272868-4272890 TGGCGGCGGCGGCGGCGGCGAGG + Exonic
1133220140 16:4316233-4316255 CCTCAGCGGCGGGGGCGGTCGGG - Intronic
1133273789 16:4624899-4624921 CGGGAGCGGCGACAGCGGCGGGG - Exonic
1133304874 16:4802536-4802558 TGGCAGCGACGGCGGCGGAGCGG - Exonic
1133464738 16:6018970-6018992 CGGCGGCGGCGGCGCTGGCGAGG + Intergenic
1133784357 16:8963367-8963389 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1133784358 16:8963370-8963392 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1133801927 16:9091702-9091724 CAGCGGCGGCGGCGGCAGTGGGG + Exonic
1133802027 16:9092003-9092025 ACGCGGCGGCGGTGGCGGCGAGG + Exonic
1133802126 16:9092361-9092383 CCGCGACGGCGGCGGCCTCGGGG + Intronic
1134149873 16:11797189-11797211 CGGTGGCGGCGGCGGCGGCGGGG + Intronic
1134172080 16:11976756-11976778 AAGCGGCAGCGGCGGCGGCGCGG + Exonic
1134419324 16:14071340-14071362 GAGCGGCGGCGGCGGCGGCCGGG + Intronic
1134441529 16:14302121-14302143 CGGCAGCGGCCCAGGCGGCGGGG - Intergenic
1134482315 16:14630290-14630312 CCTGCGCGGCGGCGGGGGCGGGG + Intronic
1134532006 16:14990276-14990298 CTGCTGCGGCGGTTGCGGCGGGG - Intronic
1135250866 16:20900307-20900329 AAGAAGAGGCGGCGGCGGCGGGG - Exonic
1135296538 16:21283936-21283958 CAGCGGCGGAGGCGGCGGCGAGG + Intronic
1135419673 16:22297463-22297485 CTGCAGAGACGGCGGCGGCCCGG - Exonic
1135517669 16:23149156-23149178 CCGCGCTGGCGGCGGCGGCGCGG - Exonic
1135597461 16:23755127-23755149 CCGCGTCGGCGGCTGCGGAGGGG + Intronic
1135691319 16:24539913-24539935 CCGAGGCGGCGGCGGCGGCGGGG + Intronic
1135821870 16:25692319-25692341 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1136110894 16:28063205-28063227 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1136110983 16:28063545-28063567 CGGCGGCGGCGGACGCGGCGCGG + Intergenic
1136414737 16:30096220-30096242 CCGCAGCGGCGGCAGCAGCTGGG - Intronic
1136511007 16:30738333-30738355 CGGCGGCGGCGGCAGCAGCGGGG + Exonic
1136536416 16:30902395-30902417 CGGCTGAGGCGGTGGCGGCGGGG - Exonic
1136574895 16:31117698-31117720 CTGCTGCGGCGGTTGCGGCGGGG + Exonic
1136696529 16:32085525-32085547 CCGCGGCGGCGGGGGCGGAAAGG + Intergenic
1136768595 16:32812007-32812029 CCGCGGCGGCGGGGGGGGGGGGG + Intergenic
1136797027 16:33028799-33028821 CCGCGGCGGCGGGGGCGGAAAGG + Intergenic
1136861549 16:33707235-33707257 CCACGGCGGCGGCGCAGGCGCGG - Intergenic
1136867785 16:33770573-33770595 CGGCAAAAGCGGCGGCGGCGGGG - Intergenic
1137426572 16:48385377-48385399 CGGCGGCGGCGGCGGCGGCCAGG - Intronic
1137617264 16:49855507-49855529 CGGCGGCGGCGGCGGCGGAGGGG - Intronic
1137617692 16:49856917-49856939 AGGCGGCGGCGGCGGCGGCCGGG + Intronic
1137668617 16:50266484-50266506 CAGCGGCGGCGGCGGCAGCAAGG - Intronic
1137708014 16:50548611-50548633 CCGCGGCGGCGACGGCGGCGGGG - Intronic
1138105626 16:54285957-54285979 CGGCAGCGGCGGCAGCGCGGGGG - Exonic
1138105698 16:54286157-54286179 GCGCAGCGCGGGCGGCAGCGCGG - Exonic
1138105710 16:54286212-54286234 CGGCGGCGACGGCGGCGGCGAGG + Exonic
1138105714 16:54286224-54286246 CGGCGGCGAGGGCGGCGGCGAGG + Exonic
1138179320 16:54931408-54931430 CGGCGGCGGCGGCGGCCGCGGGG - Exonic
1138247625 16:55479279-55479301 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1138247628 16:55479285-55479307 CGGCGGCGGCGGCGGGGGCTGGG + Exonic
1138328067 16:56191748-56191770 AGGAGGCGGCGGCGGCGGCGCGG - Intronic
1138450773 16:57092561-57092583 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
1138561335 16:57802450-57802472 CCGAGGAGGAGGCGGCGGCGTGG - Exonic
1138686946 16:58734147-58734169 TGGCAGAGGCCGCGGCGGCGAGG + Exonic
1139402925 16:66696598-66696620 CGGCGGCGGCGGCGGCGATGCGG - Exonic
1139446268 16:67000604-67000626 AGGTAGCGGCGGCGGCCGCGGGG - Intronic
1139451167 16:67029123-67029145 CGGCGGCGGCGGCGGCGGCCGGG + Intronic
1139451188 16:67029194-67029216 CGGCGGCGGCGGCGGCGGCGTGG + Intronic
1139459410 16:67109967-67109989 CTGCAGCAGCCGCGGCAGCGGGG - Exonic
1139469448 16:67170484-67170506 CAGCTGCGGCGGGGGCGGGGCGG - Intronic
1139469449 16:67170487-67170509 CAGCAGCTGCGGCGGGGGCGGGG - Intronic
1139546627 16:67652855-67652877 CAGCGGCGGCGGCGGGGGAGGGG + Intronic
1139631827 16:68235982-68236004 CCGCGGCGGGGTCGGCCGCGGGG + Exonic
1140223313 16:73058921-73058943 CGGCGGCGGCGGCTGCGGCCGGG + Intronic
1140927577 16:79599185-79599207 CGGCGGAGGCGGCGGGGGCGCGG - Exonic
1140927579 16:79599191-79599213 CGGCGGCGGCGGAGGCGGCGGGG - Exonic
1141079183 16:81035881-81035903 CGGAGGCGGCGGCGGCGGCGGGG + Exonic
1141141179 16:81497796-81497818 CAGCAGCAGAGGAGGCGGCGGGG - Intronic
1141608579 16:85169249-85169271 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1141669748 16:85485552-85485574 ACGCGGCGGCGGCGGCAGCCGGG - Intergenic
1141682596 16:85553290-85553312 CAGCGGCGGCGGCGGCGGCCTGG - Intergenic
1141831164 16:86510608-86510630 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1141831168 16:86510620-86510642 CGGCGGCGGGGGAGGCGGCGCGG + Exonic
1141839638 16:86566668-86566690 CCGCGGAGGCCGGGGCGGCGGGG + Intergenic
1141989702 16:87602832-87602854 GGGCAGGAGCGGCGGCGGCGGGG - Intronic
1142054570 16:87985026-87985048 CGGCAGCGGGGGCGCCGGGGAGG + Intronic
1142136241 16:88453208-88453230 CCGGAGCGCCGGGGGCGGGGCGG + Intergenic
1142184068 16:88686177-88686199 GCGCAGCGGCTGCGGCTGCAGGG - Intronic
1142239548 16:88938964-88938986 CCCCAGAGGCGGCAGCGGCGAGG + Intronic
1142336096 16:89490350-89490372 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1142395346 16:89828562-89828584 GGGCAGCTGCGGCGGCGCCGCGG + Exonic
1203070913 16_KI270728v1_random:1073770-1073792 AAGCAGCGGCGGTGGCGGCGGGG + Intergenic
1203070916 16_KI270728v1_random:1073773-1073795 CAGCGGCGGTGGCGGCGGGGGGG + Intergenic
1203104383 16_KI270728v1_random:1345678-1345700 CGGCAAAAGCGGCGGCGGCGGGG + Intergenic
1203129131 16_KI270728v1_random:1616690-1616712 CGGCAAAAGCGGCGGCGGCGGGG - Intergenic
1142509772 17:386106-386128 GCTCAGCGGCGGGGCCGGCGGGG - Intronic
1142611009 17:1109229-1109251 CGGCGGCGGCGGCGGCGGAGCGG - Intronic
1142683354 17:1562694-1562716 CCGGCGCGGCGACCGCGGCGAGG - Exonic
1142762425 17:2050235-2050257 CGGGCGCGGCGGCGGCGGCCGGG + Intergenic
1142799711 17:2337553-2337575 CGGCGGCGGCGGCGGCGGGCCGG + Exonic
1142836798 17:2593599-2593621 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1142863374 17:2776690-2776712 CGTGCGCGGCGGCGGCGGCGAGG + Intergenic
1143063341 17:4222164-4222186 TAGCAGCAGCGGCGGCGGCGGGG - Intronic
1143223654 17:5282376-5282398 GGGCGGCGGCGGCGGCGGCTCGG + Exonic
1143329058 17:6120672-6120694 ACTCAGCGGGGGCGGCGGCGTGG - Exonic
1143371668 17:6444343-6444365 CCGGGGCGGTGGCGGTGGCGGGG + Intergenic
1143519204 17:7436132-7436154 CCGGGGCGGGGGCGGGGGCGTGG - Intronic
1143527220 17:7479595-7479617 CGGCGGCGGCGGCGGCAGCGGGG - Intronic
1143527257 17:7479684-7479706 CGGCGGCGGCGGCGGCGCTGGGG - Intronic
1143590782 17:7885057-7885079 CGGCGGGGGCGGCGGCGGCGGGG - Exonic
1143590873 17:7885300-7885322 CGGCGGCGGCGGCGGGGGAGGGG - Intronic
1143590877 17:7885306-7885328 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1144021030 17:11240630-11240652 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1144021161 17:11241057-11241079 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1144109998 17:12021459-12021481 CCACTGCGGCGGCGGGGCCGAGG - Intronic
1144724540 17:17495253-17495275 CGGCGGCGGCGGCGGCGACCCGG - Exonic
1144775650 17:17783341-17783363 GGGCTGCGGAGGCGGCGGCGCGG + Intronic
1144840790 17:18184324-18184346 CGGCAGCGGCGGCGGCCTCCCGG - Exonic
1144910054 17:18673029-18673051 CGGCGGCGGCGGCGGCGCCCGGG - Exonic
1144930919 17:18858217-18858239 CTGCAGCTGAGGCTGCGGCGGGG + Exonic
1145248459 17:21284769-21284791 CGGCGGCGGCGACTGCGGCGAGG - Exonic
1145694205 17:26774511-26774533 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1145694324 17:26774952-26774974 CCGCAAAAGCAGCGGCGGCGGGG - Intergenic
1145925649 17:28644943-28644965 CGGCGGCGGCGGCGGCGGGAGGG - Intronic
1145928000 17:28662218-28662240 CGGCGGCGGTGGCGGCGGAGGGG + Exonic
1146132634 17:30291961-30291983 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1146132635 17:30291964-30291986 CGGCGGCGGCGGCGGCGGGGAGG + Exonic
1146214909 17:30971270-30971292 CCGCAGGTGCGGCTGCTGCGCGG - Exonic
1146255884 17:31391531-31391553 CGGCGGGGGCGGCGGCGGCGGGG - Intergenic
1146332339 17:31937419-31937441 CCTCCGCGGCGGCAGCGGCGGGG + Exonic
1146339604 17:32007668-32007690 CGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1146339607 17:32007674-32007696 CGTGGGCGGCGGCGGCGGCGGGG - Intergenic
1146356923 17:32142450-32142472 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1146371092 17:32266006-32266028 GCGAGGAGGCGGCGGCGGCGCGG + Intergenic
1146371132 17:32266152-32266174 CGGGGGCGGCGGCGGCTGCGGGG - Intergenic
1146371282 17:32266607-32266629 CCGCAGAGGCGGCCGCGTCACGG + Intronic
1146398559 17:32487001-32487023 CGGCGGCGGCGGCGGCAGCTAGG - Exonic
1146398658 17:32487295-32487317 CCGCAGCGGCGGCGGCGGGCGGG + Intronic
1146492383 17:33292272-33292294 CGGCAGCGGCGGCGCCGGGCGGG - Exonic
1146896592 17:36545664-36545686 CGGCGGCGGCGGCGGCAGCTGGG + Exonic
1146955861 17:36936118-36936140 CCGGAGGCGCGGCGCCGGCGCGG - Intergenic
1147161767 17:38572767-38572789 CCGCGGCTGCGGAGGCGGCCGGG - Intronic
1147179506 17:38675102-38675124 CCGGCGCGGCGGCGGCTGGGAGG + Exonic
1147393183 17:40122366-40122388 CGGCAGCAGAGGCGGCGGCGAGG + Intronic
1147486364 17:40818905-40818927 CGGCGGCGGCGGCGGCTACGGGG - Exonic
1147571158 17:41571935-41571957 CCGCAGCGGCGGGGGTGGCGGGG - Exonic
1147720440 17:42536467-42536489 CAGCCTGGGCGGCGGCGGCGCGG + Exonic
1147970972 17:44219078-44219100 CCGGGGCGGGGGCGCCGGCGGGG - Intronic
1147971174 17:44219742-44219764 CTGAGGCTGCGGCGGCGGCGGGG - Intronic
1147994633 17:44354054-44354076 CGCGGGCGGCGGCGGCGGCGCGG + Exonic
1147994707 17:44354407-44354429 GGGCGGCGGGGGCGGCGGCGAGG - Exonic
1148021784 17:44558185-44558207 CTGCAGTCCCGGCGGCGGCGCGG - Exonic
1148126934 17:45241982-45242004 GGGCAGCGGCGGCGCAGGCGGGG - Exonic
1148178080 17:45584879-45584901 GGGCAGCGGCAGCGGCGGCGGGG + Intergenic
1148178083 17:45584885-45584907 CGGCAGCGGCGGCGGGGCCGGGG + Intergenic
1148323643 17:46771490-46771512 ACGCGGGGGCGGCGGGGGCGGGG + Intronic
1148467236 17:47872503-47872525 CGGCGGCGGCGGCGGCGATGGGG + Intergenic
1148551068 17:48551101-48551123 GGGCGGTGGCGGCGGCGGCGGGG - Exonic
1148556182 17:48580158-48580180 GCGCGGCGGCGGCGGAGGCAAGG - Intronic
1148556596 17:48582227-48582249 GCGCACCGGCGGCGGCGGCGCGG + Intronic
1149599707 17:57885522-57885544 GAGCAGCAGCGGCAGCGGCGGGG - Exonic
1149610527 17:57955323-57955345 CAGGCTCGGCGGCGGCGGCGCGG + Exonic
1149678604 17:58488163-58488185 CCGCTGGGACGGCCGCGGCGAGG - Exonic
1149712572 17:58756335-58756357 CTGGGGCGGCGGCGGCGGCACGG - Exonic
1149994712 17:61400376-61400398 CGGCAGCAGCGGCCGAGGCGGGG + Exonic
1149997254 17:61411760-61411782 CCACAGCAGCGGCGGGGGAGTGG - Exonic
1150060582 17:62065366-62065388 CGGCGGCGGCGGCGGGGGGGTGG - Intergenic
1150060583 17:62065369-62065391 CGGCGGCGGCGGCGGCGGGGGGG - Intergenic
1150060586 17:62065372-62065394 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1150373506 17:64661883-64661905 CCCCGGCGGCGGGGGCGGCGGGG + Exonic
1150407976 17:64919169-64919191 GGGCGGCGGCGGCGGCGGCGGGG + Intronic
1150407979 17:64919175-64919197 CGGCGGCGGCGGCGGGGCCGGGG + Intronic
1150488660 17:65560558-65560580 CGGCAGTGGCGGGGGCGGAGAGG - Intronic
1150561923 17:66302329-66302351 CGGCGGCGGCGGCGGCGGCCGGG - Intergenic
1150643455 17:66964584-66964606 CGGCGGCGGCGGGGGAGGCGCGG + Intergenic
1150692297 17:67377231-67377253 CAGCAGCGGCCGCGGCGGGGAGG - Intergenic
1150692298 17:67377234-67377256 CATCAGCAGCGGCCGCGGCGGGG - Intergenic
1150747244 17:67825792-67825814 CGGCGGCGGCGGTGGCGGCGGGG - Exonic
1150764625 17:67993545-67993567 GCGCGGCGGCGGCGCGGGCGCGG + Intronic
1150785913 17:68162460-68162482 CTGCAGGGGCGGGGGCGGGGAGG + Intergenic
1150791890 17:68205754-68205776 CGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1150791893 17:68205760-68205782 CTTGGGCGGCGGCGGCGGCGGGG - Intergenic
1151438474 17:74113398-74113420 CCACGGCGGGGGCGGGGGCGGGG + Intergenic
1151478543 17:74356878-74356900 CAGCAGCGGCGGCGACGCGGCGG - Exonic
1151828694 17:76537570-76537592 GCTCGGCGGCGGCGGTGGCGGGG + Exonic
1152049183 17:77959081-77959103 CGGCGGCTGCGGCGGCGGCGCGG - Intergenic
1152049232 17:77959232-77959254 CGGCGGCGGCGGCGGCTCCGCGG - Intergenic
1152222211 17:79075062-79075084 CGGCCGCGGCGGCGGCGGCCGGG + Exonic
1152362538 17:79839347-79839369 GGCGAGCGGCGGCGGCGGCGGGG - Exonic
1152433119 17:80260542-80260564 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433132 17:80260572-80260594 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433145 17:80260602-80260624 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433158 17:80260632-80260654 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433171 17:80260662-80260684 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433184 17:80260692-80260714 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433197 17:80260722-80260744 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433210 17:80260752-80260774 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433223 17:80260782-80260804 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433236 17:80260812-80260834 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152468017 17:80476598-80476620 CCGCAGCGCAGGCGGCAGTGGGG - Exonic
1152581134 17:81166074-81166096 CCGCACCTGCGGCGGCCGCTGGG - Intronic
1152587290 17:81194707-81194729 CCGCAGCGGAGGCCGTGACGGGG + Intronic
1152628601 17:81399638-81399660 GCGCAGAGGCGGCGGCGTCCGGG - Exonic
1152711206 17:81871216-81871238 CGGCGGCGCCGGCGGGGGCGGGG - Intronic
1152721879 17:81927468-81927490 GCGGCGCGGCGGGGGCGGCGGGG - Intronic
1152729025 17:81960944-81960966 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1152921390 17:83068219-83068241 CGACAGCGGGGGCGGCAGCGGGG + Intergenic
1152921553 17:83068661-83068683 CGACAGCGGGGGCGGCAGCGGGG + Intergenic
1152924158 17:83079889-83079911 CAGCAGCGGGAGCGGCGGCGGGG - Exonic
1152924486 17:83080866-83080888 CCGCGGCGGGGGCGGGGGCGGGG - Intronic
1203192332 17_KI270729v1_random:200551-200573 AAAAAGCGGCGGCGGCGGCGGGG - Intergenic
1152952808 18:10929-10951 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952815 18:10958-10980 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952822 18:10987-11009 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952829 18:11016-11038 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952836 18:11045-11067 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1153488824 18:5628751-5628773 CCGCAGCGGCGGCGCCAGGGCGG + Intronic
1154173772 18:12068425-12068447 CCCCGGCGGCGGCGGCGGCGCGG - Intergenic
1154174488 18:12076537-12076559 CGGCGGCGGCGGCGGCGCCGCGG - Intergenic
1155053822 18:22169041-22169063 CTCCCGCCGCGGCGGCGGCGCGG + Intergenic
1155392722 18:25352309-25352331 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
1155392757 18:25352413-25352435 CGGCGGCGACGGCGGCGGCGCGG - Intergenic
1155474679 18:26226401-26226423 CCGGGGCGGTGGCGGCGGCCTGG + Exonic
1156099661 18:33578454-33578476 CGGCGGCGGCGGCGGCGGGTGGG - Intergenic
1156243036 18:35271861-35271883 CAGCAGCTGCGGAGGGGGCGCGG - Intronic
1156446939 18:37243912-37243934 CGGCGGCGGCGGCGGCGACCCGG + Exonic
1157136675 18:45063475-45063497 CAGGGGCGGCGGCGGTGGCGGGG - Exonic
1157383818 18:47246661-47246683 CAGGGGCGGCGGCGGGGGCGGGG + Intronic
1157383938 18:47247081-47247103 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1157384298 18:47248308-47248330 CGGTGGCGGCGGCGGCGGCGGGG + Intronic
1157848976 18:51030255-51030277 CCGCAGCGGCGACGACGACCAGG - Exonic
1157849137 18:51030715-51030737 CGGCGGCGGCGGCGGCGGCTGGG + Intronic
1157867051 18:51196766-51196788 CGGCCGCGGCGGCGGCGGCGGGG - Exonic
1157867202 18:51197234-51197256 CGGTGGCGGCGGCGGCGGCGGGG + Exonic
1158259107 18:55588152-55588174 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1158259108 18:55588155-55588177 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1158404295 18:57147327-57147349 CGGCGGCGGCAGCGGCGGTGCGG + Exonic
1158435946 18:57435678-57435700 CGGGGGCGGCGGGGGCGGCGGGG - Exonic
1158435996 18:57435833-57435855 CAGTGGCGGGGGCGGCGGCGGGG + Exonic
1158436001 18:57435842-57435864 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1158436007 18:57435854-57435876 GGGCGGCGGGGGCGGCGGCGGGG + Exonic
1158601938 18:58863501-58863523 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
1158954139 18:62523552-62523574 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1159040576 18:63320037-63320059 CAGCGGCGGCGGCGGCAGCGCGG + Exonic
1159322212 18:66866788-66866810 TCGGAGCGGCGGCGGCGGGCCGG + Intergenic
1159798106 18:72867785-72867807 CGGCGGCGCCGGCGGCGGCGGGG + Exonic
1159798107 18:72867788-72867810 CGGCGCCGGCGGCGGCGGGGTGG + Exonic
1160025389 18:75211660-75211682 AGGCGGCGGCGGCGGCCGCGCGG - Intronic
1160453340 18:78979743-78979765 GCCCGGCGGCGGCGGCGGGGGGG + Intergenic
1160453344 18:78979749-78979771 CGGCGGCGGCGGGGGGGGCGCGG + Intergenic
1160453445 18:78980154-78980176 GCGGGGCGGCGGCGGCTGCGCGG - Intergenic
1160680328 19:409175-409197 ATACGGCGGCGGCGGCGGCGGGG - Intergenic
1160708101 19:539303-539325 CCGCAGAGGTGGCGGCTGTGGGG - Intronic
1160719164 19:589998-590020 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1160738811 19:676606-676628 GGGGCGCGGCGGCGGCGGCGGGG + Intronic
1160738813 19:676612-676634 CGGCGGCGGCGGCGGGGGCGAGG + Intronic
1160763558 19:797553-797575 CCGGCGCGGCGGCGGGGGCAGGG - Intronic
1160769180 19:822534-822556 CCGGCGCGGCGGAGGGGGCGAGG - Intergenic
1160771198 19:831951-831973 CCGGAGCGGGGGCAGGGGCGGGG - Exonic
1160790456 19:920575-920597 CGGGGGCGGCGGGGGCGGCGCGG - Exonic
1160790460 19:920584-920606 CCGGGCCGGCGGGGGCGGCGGGG - Exonic
1160812976 19:1020933-1020955 CAACGGCGGCGGCGGCGGCCCGG - Exonic
1160858683 19:1228560-1228582 CGGCAGCAGCGGTGGCGGCGCGG + Exonic
1160861232 19:1237969-1237991 GCGCAGCGGGGGCGGCGGGCCGG - Exonic
1160888227 19:1362392-1362414 GCTCAGAGGCAGCGGCGGCGGGG + Intronic
1160896940 19:1407554-1407576 GCGCAGGGGCGGCGGCGCGGCGG + Intronic
1160930465 19:1567639-1567661 CCGGGGCGGCGGCGGCGGCGGGG + Exonic
1160930585 19:1567992-1568014 CGGCGGCGGCGGCGGCGTGGGGG - Exonic
1160930588 19:1567995-1568017 GGGCGGCGGCGGCGGCGGCGTGG - Exonic
1160930621 19:1568095-1568117 CGCGGGCGGCGGCGGCGGCGCGG - Intergenic
1160930664 19:1568191-1568213 CGGGCGGGGCGGCGGCGGCGCGG + Intergenic
1160930703 19:1568310-1568332 CCGAGGCGGCGGCGGCGGCGCGG + Intergenic
1160967699 19:1753830-1753852 CGGCGGCGGCGGCGGCGGTGGGG + Exonic
1160967715 19:1753875-1753897 GGGCAGCGCGGGCGGCGGCGCGG + Exonic
1160967778 19:1754117-1754139 ACGCTGCGGCGGGGGTGGCGGGG - Exonic
1160991602 19:1862580-1862602 CCACCCCGGCGGCGGCGACGCGG + Intronic
1160991662 19:1862813-1862835 CCGCCCCGGCGGCAGTGGCGGGG - Intronic
1161051069 19:2164303-2164325 CCCCAGGGGCGGCGGAGGAGGGG - Intronic
1161215742 19:3094405-3094427 CGGTGGCTGCGGCGGCGGCGCGG + Exonic
1161264830 19:3359436-3359458 CCGCAGCCGGGGCCGCGGCGCGG + Intergenic
1161293116 19:3506360-3506382 CGTCAGCGGCGGCCGCGGCCGGG + Intronic
1161309357 19:3585545-3585567 CGGATCCGGCGGCGGCGGCGAGG + Exonic
1161397981 19:4054692-4054714 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1161431191 19:4233319-4233341 CGGCAGTGGGGGCGGGGGCGGGG + Intronic
1161443289 19:4304625-4304647 CCGGGGGCGCGGCGGCGGCGAGG + Exonic
1161443349 19:4304788-4304810 CCGCAGGGGCGTCGGGGGCGGGG + Intronic
1161450700 19:4343850-4343872 CGGAGGAGGCGGCGGCGGCGGGG + Exonic
1161461888 19:4402658-4402680 CCGCGGCGGCAGCAGCGGCGCGG + Exonic
1161477444 19:4494343-4494365 GGGCAGCGGCGGCAGCAGCGGGG + Exonic
1161628829 19:5341079-5341101 CGGCTGCGGCGGCGGCGGGAAGG + Intergenic
1161816392 19:6502257-6502279 GGGGAGCTGCGGCGGCGGCGAGG + Exonic
1161925123 19:7294123-7294145 CCGCAGCGGCCGGGGGGTCGGGG - Intergenic
1162027709 19:7903919-7903941 GCGCGGCGGCGGTGGCGGCGGGG + Exonic
1162027787 19:7904179-7904201 CCGCAGCGGGGGGGGCGGAGAGG - Intronic
1162033206 19:7926052-7926074 CGGCGGCGGCGGCGGCGGCCCGG + Exonic
1162145510 19:8610664-8610686 AGACAGCGGCGGCGACGGCGCGG - Intronic
1162372928 19:10289862-10289884 CGGCAGAGGCGGCGGGGGGGCGG - Intergenic
1162396633 19:10421043-10421065 TGGCACCGGCAGCGGCGGCGCGG + Exonic
1162435356 19:10654715-10654737 TGGCGGCTGCGGCGGCGGCGAGG + Intronic
1162470875 19:10871493-10871515 CGGTGGCGGCGGCGGCGGCGAGG + Exonic
1162470914 19:10871633-10871655 CGGCGGCAGCGGCGGCGGCCTGG + Exonic
1162470927 19:10871662-10871684 GCGCAGCGGCGGCGGCGGCGGGG + Exonic
1162470940 19:10871707-10871729 CAGCGGCGGCGGCGGCGGTGGGG + Exonic
1162535837 19:11262472-11262494 CGGCGGCGGCGGCGGGGCCGGGG - Intronic
1162535840 19:11262478-11262500 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1162572144 19:11480030-11480052 CAGCAGCGGCGGCGGGCCCGCGG + Intronic
1162740220 19:12769864-12769886 CGGCAGGTGCGGCGGGGGCGGGG - Exonic
1162751755 19:12833843-12833865 CGGCGGCGGCGGCGGCTGAGGGG - Intronic
1162752683 19:12838505-12838527 AGGCGGCGGCGGCGGCGGCGCGG - Intronic
1162802329 19:13118394-13118416 CCGCAGCGGCGGCTGGGGCCGGG - Exonic
1162935333 19:13979005-13979027 CGGCGGCTCCGGCGGCGGCGTGG + Intronic
1162954333 19:14090070-14090092 CTGCTGTGGCGGCGCCGGCGGGG + Exonic
1162954499 19:14090776-14090798 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1162954500 19:14090779-14090801 GTGCGGCGGCGGCGGCGGCGGGG - Intronic
1162959467 19:14117544-14117566 CCATCGCGGCGGCGGCGGCCGGG + Exonic
1163023510 19:14496137-14496159 CCGCAGCGGCGCCTGGGGGGCGG + Intronic
1163106329 19:15125029-15125051 CAGCGGGGGCGGCGGCCGCGGGG + Exonic
1163111116 19:15161386-15161408 CCGCAGGGGCCCCGGGGGCGGGG - Exonic
1163138809 19:15332498-15332520 CGGCGGCGGCGGCGGCGGCTGGG - Intronic
1163144956 19:15373805-15373827 CGGGAGCGGCGGCGGTGGGGAGG - Exonic
1163154494 19:15432540-15432562 TGGGGGCGGCGGCGGCGGCGCGG + Intronic
1163158037 19:15449681-15449703 CCGGGGCGGGGGCGGGGGCGGGG - Intronic
1163220033 19:15912048-15912070 CCGCGGCTGCGGCGGCAGAGGGG - Intergenic
1163364576 19:16868862-16868884 CAGCAGCGGAGGCGGGGGCTTGG + Intronic
1163441292 19:17323805-17323827 CGGCATTGGCGGCGGCGGCGCGG + Exonic
1163583704 19:18153176-18153198 CCGTGGCGGCGGCGGAGGCGGGG + Exonic
1163631397 19:18419620-18419642 GGGCCCCGGCGGCGGCGGCGTGG + Exonic
1163664141 19:18595189-18595211 CAGCAGGGGCGGCGGGGGCCGGG - Intronic
1163678682 19:18668516-18668538 CCGCAGCGGCGAGGGCGCAGTGG + Exonic
1163708535 19:18832021-18832043 CGGCGGCAGCGGCGGCGGCTCGG + Exonic
1164594638 19:29525393-29525415 CGGCAGGGGCGGCGGGGGTGGGG - Intergenic
1164594964 19:29526524-29526546 GCGGAGAGGCGGCGGCCGCGTGG - Exonic
1164693587 19:30227733-30227755 CGGCGGCGGCGGCGGCTGCCGGG - Intergenic
1164835580 19:31353138-31353160 CAGAAGCGGCCGCGGCGGCGCGG + Intergenic
1165204513 19:34172431-34172453 CGGCGGCAGCGGCGGCGGCGCGG - Intergenic
1165432569 19:35780985-35781007 CGGCAGCGGCTGCGGCAGCGGGG + Exonic
1165489582 19:36115490-36115512 CGGCGGCGGCGGCTGCGGAGCGG + Exonic
1165493913 19:36141038-36141060 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1165493918 19:36141047-36141069 CGGCGGCGGCGGGGGAGGCGGGG + Exonic
1165803135 19:38565188-38565210 CGGCGGCCACGGCGGCGGCGGGG + Exonic
1165803139 19:38565200-38565222 CGGCGGCGGGGGCGACGGCGCGG + Exonic
1165961616 19:39539777-39539799 GCCCGGCGGCGGCGGCGGCCAGG - Exonic
1166105965 19:40598206-40598228 CCCGAGCCGCGGCGGGGGCGGGG + Intronic
1166106369 19:40600090-40600112 CTGAAGCGGCGGCGGCCCCGGGG + Exonic
1166304250 19:41928589-41928611 TGGAGGCGGCGGCGGCGGCGCGG + Intronic
1166358671 19:42242514-42242536 CGGCGGCAGCGGCGGCGGCTGGG - Exonic
1166361247 19:42253856-42253878 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
1166539271 19:43594861-43594883 CGGCAGCAGCGACGGCTGCGAGG - Exonic
1166888057 19:45973451-45973473 TTGCGGCGGCGGCGGCGGCGGGG + Exonic
1166888064 19:45973469-45973491 CGGGGGCGGCGGCGGCTGCGGGG + Exonic
1166938069 19:46347006-46347028 CGGCAGCGGCGGCGGCCACCCGG + Exonic
1167019090 19:46861081-46861103 CGGCGGCGGCTCCGGCGGCGGGG - Intergenic
1167040608 19:47020786-47020808 GCGCGGGGGAGGCGGCGGCGGGG + Intronic
1167040698 19:47021065-47021087 CGGCAGTGGCGGCGGAAGCGAGG + Exonic
1167157124 19:47745656-47745678 GCGCTGAGGCGGCGGCGGCGAGG + Exonic
1167258106 19:48443025-48443047 CGGCGGTGGCCGCGGCGGCGGGG - Exonic
1167258270 19:48443584-48443606 CCGCAGCGGGCCCGGCGTCGGGG - Exonic
1167369654 19:49072834-49072856 CGCGGGCGGCGGCGGCGGCGGGG - Exonic
1167434942 19:49474081-49474103 CCGCAGCGGGGGCTGCAGTGGGG - Intronic
1167466482 19:49653170-49653192 CCGCAGTGGAGGTGGCAGCGGGG + Exonic
1167557470 19:50205297-50205319 CGGCGGCGGCGGCGGCGCCAGGG - Intronic
1167578497 19:50328972-50328994 CGGCAGCGGTGGCGGCGGCGGGG + Exonic
1167613319 19:50517660-50517682 CCCCAGCGGCGGGGGCTGCGGGG - Exonic
1167643702 19:50695085-50695107 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1167679801 19:50912323-50912345 CCGCAGCAGGGGCGGTTGCGGGG + Intergenic
1168064060 19:53909426-53909448 CGGTGGCGGCGGCGGCGGCCGGG + Exonic
1168072827 19:53962311-53962333 CCCCTGGGGCGGAGGCGGCGCGG + Intergenic
1168073074 19:53963343-53963365 CCGCGGGGGCGGCGGCGCCTCGG + Exonic
1168076326 19:53982549-53982571 CGGCGGCGGCGGCGGCGCCGTGG + Exonic
1168076352 19:53982606-53982628 CGGCGGCGGAGGCGGCGGCGGGG + Exonic
1168076353 19:53982609-53982631 CGGCGGAGGCGGCGGCGGGGCGG + Exonic
1168093759 19:54102848-54102870 CCGCGGCGGCGACAGCGGCGAGG - Exonic
1168339125 19:55613809-55613831 CTGCGGCGGGGGCTGCGGCGGGG - Exonic
1168694423 19:58396604-58396626 CAGAGGCGGCGGGGGCGGCGGGG - Exonic
1202683498 1_KI270712v1_random:30083-30105 CCGCGGCGGCGGCGGGTGGGGGG - Intergenic
1202683843 1_KI270712v1_random:31294-31316 CCGCGGCGGCGGGGGGGGAGGGG - Intergenic
1202693295 1_KI270712v1_random:105832-105854 GCGCAGCGGCGGCGCAGGCGCGG + Intergenic
924962169 2:45578-45600 GCACAGCGGCGGCGACGACGAGG - Exonic
925609792 2:5693150-5693172 CGGCGGCGGCGGCGGGAGCGCGG + Exonic
925609844 2:5693339-5693361 CGGCTCGGGCGGCGGCGGCGCGG + Exonic
925609914 2:5693768-5693790 CAGCAGCGGCAGCAGCGGCGAGG + Exonic
926089878 2:10043201-10043223 GCGGGGCGGCGGGGGCGGCGGGG - Intronic
926202635 2:10812721-10812743 CTGAAGCGGCGGCGGCGGTGGGG - Intronic
926217105 2:10912366-10912388 CAGCGGCGGCGGCGGCTGCAGGG + Exonic
926784739 2:16508337-16508359 CCGCAGACGCCGCAGCGGCGGGG - Intergenic
926914412 2:17878701-17878723 CCGCCGCGGCGGCAGGCGCGGGG + Intronic
927156552 2:20224461-20224483 CCGCCGCGGTGGCCGGGGCGAGG + Intronic
927181001 2:20446850-20446872 CCGCAGCGGCAGCAGCAGCGCGG + Intergenic
927181099 2:20447287-20447309 CTGCCGCGGCGGGGGCGGTGGGG - Exonic
927472218 2:23385245-23385267 CGGGGACGGCGGCGGCGGCGCGG - Exonic
927472268 2:23385399-23385421 CCGCAGCCGCGGCGGCCGCGGGG - Exonic
927472273 2:23385401-23385423 CCGCGGCCGCCGCGGCTGCGGGG + Exonic
927652299 2:24920051-24920073 CCGCGGCGGCGGCGGCTGCTAGG + Intergenic
927698282 2:25252059-25252081 CCGCAGCAGCCGCGGCGTCCCGG - Intronic
927957388 2:27217357-27217379 CAGCAGAGACTGCGGCGGCGCGG - Intergenic
928303685 2:30147842-30147864 CGGCGGCGGCGGTGGCGGCGGGG - Intronic
928421113 2:31138375-31138397 CGGCAGCCGCGGTGGCGGCGTGG - Intronic
929133500 2:38602158-38602180 GCGCGGCGGCGGCGGCGGGGAGG - Intronic
929133501 2:38602161-38602183 GCGGCGCGGCGGCGGCGGCGGGG - Intronic
929174230 2:38960549-38960571 CGGCGACGGCGGCGGCGGCCGGG - Exonic
929218116 2:39437111-39437133 CGGCGGCGGCGGCCGCAGCGTGG - Exonic
929242370 2:39665943-39665965 GCCCACCGGCGGCTGCGGCGGGG + Exonic
929604396 2:43225533-43225555 CGGCAGCAGCTGCGGCAGCGCGG - Exonic
929701949 2:44169474-44169496 GCCCAGCGGAGGCGGCGGCCGGG - Intronic
929966848 2:46542851-46542873 CCGCGGCGGCGGCAGCGCCCCGG + Exonic
930011421 2:46941034-46941056 CCGCGGCGGGGGCGGCGGCGGGG + Intronic
930136110 2:47905619-47905641 CTGCGGCGGCGGCTGCTGCGGGG + Exonic
930358216 2:50346865-50346887 CGGCGGCGGCGGCGGCGCAGGGG - Intronic
930667718 2:54115882-54115904 ACACAGCAGCGGCGGCGGGGAGG + Intronic
931253509 2:60552425-60552447 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
931274873 2:60735751-60735773 CCGCGGGGACGGAGGCGGCGAGG + Intergenic
931348871 2:61470930-61470952 GCGCCGAGGCGCCGGCGGCGGGG + Intergenic
931681132 2:64750833-64750855 GAGCAGGGGCGGCCGCGGCGGGG + Intronic
931762499 2:65430907-65430929 CAGCAGCGGCGGCCGCCGCGCGG + Intronic
932306354 2:70706358-70706380 CCCCTGCGGGGGCGGCGGCGAGG + Exonic
932496428 2:72147904-72147926 CCGGAGCGGCGGGGGAGGGGAGG + Exonic
932621891 2:73269590-73269612 CCGCAGCGGGGGCAGCGGTACGG + Exonic
932699858 2:73985085-73985107 CGGTGGTGGCGGCGGCGGCGCGG + Intergenic
933279957 2:80322562-80322584 GCGCGGCGGCGGAGGCCGCGGGG + Intronic
933666715 2:84970837-84970859 CGGCGGCGGCGGCGGCGGCCAGG + Intergenic
933666855 2:84971274-84971296 CGGCGGCGGCGGCGGCGGGGAGG - Exonic
933666856 2:84971277-84971299 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
933666980 2:84971628-84971650 CCGTGGCGGCAGCGGCGCCGCGG - Intronic
933684717 2:85133711-85133733 CGGCGGCGGCGGCGGCAGCGGGG + Exonic
933772774 2:85754554-85754576 AGGCGGCGGCGGCGGCGGCGTGG - Exonic
933908291 2:86914936-86914958 CGGCGGCGGCGGCGGCGGCCTGG + Intronic
933953273 2:87348727-87348749 GCGCAGCGGCGGCGCAGGCGCGG - Intergenic
934031859 2:88055592-88055614 CCCCGGCGGCGGGGGCGGCCCGG - Intronic
934237504 2:90245072-90245094 GCGCAGCGGCGGCGCAGGCGCGG - Intergenic
934248017 2:90324088-90324110 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248189 2:90324702-90324724 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248362 2:90325312-90325334 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248373 2:90325350-90325372 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248405 2:90325467-90325489 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934261189 2:91478099-91478121 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
934296816 2:91749019-91749041 GGGCCGCGGCGGCGGCGGCGAGG - Intergenic
934304213 2:91809035-91809057 CCGCAGCGGCGGGGGGGGGGGGG - Intergenic
934329042 2:92043715-92043737 CCGCAGCGGCGGGGGGGGGGGGG + Intergenic
934459928 2:94208378-94208400 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
934467094 2:94273030-94273052 CGGCAGCGGGGGCGGGGGCGGGG + Intergenic
934566976 2:95346595-95346617 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
934566977 2:95346598-95346620 GGGGCGCGGCGGCGGCGGCGCGG - Intronic
934882444 2:97995710-97995732 TCGGCGAGGCGGCGGCGGCGCGG + Exonic
935196524 2:100819870-100819892 CAGCAGAGGCTGCGGCGGCCTGG + Intergenic
935592444 2:104855295-104855317 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
935592558 2:104855612-104855634 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
935592610 2:104855816-104855838 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
935592737 2:104856230-104856252 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935592783 2:104856392-104856414 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935592897 2:104857084-104857106 CGGCGGCGGCGGCGGCGGCAGGG - Exonic
936122700 2:109760441-109760463 GGGCGGCGGCGGCGGCGGCGCGG + Intergenic
936126703 2:109794590-109794612 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
936126706 2:109794593-109794615 CGGCGGCGGCGGCGGCGGGGGGG + Intronic
936221993 2:110611032-110611054 GGGCGGTGGCGGCGGCGGCGCGG - Intergenic
936390783 2:112071310-112071332 GGGCAGTGGTGGCGGCGGCGGGG - Intronic
936939640 2:117871067-117871089 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
937045146 2:118847177-118847199 GCGCGGCGGCCGGGGCGGCGGGG - Exonic
937160955 2:119760249-119760271 CCGCTGCGGCGGCGGCTGCTCGG + Exonic
937397192 2:121547260-121547282 CCGCAGCGGCAGTGGCAGAGAGG - Intronic
937844085 2:126558232-126558254 CGGCGGCGGCAGCAGCGGCGAGG + Intergenic
938018397 2:127885998-127886020 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
938271855 2:129979678-129979700 GGGCTGCGGCGGCGGCGGCTGGG + Exonic
938301114 2:130213667-130213689 CCGCCGCGGCGGCAGCGCCCCGG - Intergenic
938443112 2:131353268-131353290 CCGGAGCGGTGGCGGCTGTGGGG - Intronic
938444146 2:131364122-131364144 GGGCTGCGGCGGCGGCGGCTGGG - Intergenic
938451443 2:131425012-131425034 CCGCCGCGGGGGCGGCGGCCAGG + Intergenic
938451542 2:131425324-131425346 CGGCGGCGGCGGCGGCGGCTCGG - Intergenic
938496935 2:131802637-131802659 CCCCAGCGCCGGCGCAGGCGCGG - Intergenic
939432660 2:142130786-142130808 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
939612934 2:144332295-144332317 CAGCAGCGGCGGCTGCGGCGCGG - Intronic
939613004 2:144332514-144332536 CCGCGGCGGCCGCGGGGGAGGGG - Intronic
939613009 2:144332520-144332542 CGGCATCCGCGGCGGCCGCGGGG - Intronic
939629759 2:144517166-144517188 CGGCGGCGGCGGCGGCGCCCAGG - Intronic
939900447 2:147844397-147844419 CGGCGGCGGCAGCGGCGGCCGGG - Intergenic
939969666 2:148644971-148644993 CCCGGGCGGCGGCGGCGGGGCGG - Exonic
939969668 2:148644974-148644996 CAGCCCGGGCGGCGGCGGCGGGG - Exonic
940265135 2:151828362-151828384 GTGCCGCGGCGGCAGCGGCGGGG - Exonic
940300982 2:152176036-152176058 CTGCAGTGCCAGCGGCGGCGCGG + Intergenic
940421003 2:153478869-153478891 CCGCGGCGGCTGCAGCGGCGGGG + Intergenic
940962203 2:159798132-159798154 CCGCGACGGCAGCAGCGGCGAGG + Exonic
941020851 2:160407271-160407293 CGGCCCGGGCGGCGGCGGCGAGG + Intronic
941119109 2:161507855-161507877 CCGCGGCGGCGGCGGCGGCGGGG - Intronic
941580696 2:167293121-167293143 CGGCAGCGCCGGCGGCGCGGCGG - Intergenic
941666422 2:168247540-168247562 CGGCGGCGGCGGCGGCGGGCGGG - Exonic
941666458 2:168247624-168247646 AGGCAGCGCCGGCGGAGGCGGGG + Exonic
941906116 2:170716873-170716895 CAGCAGCGGCCGCAGAGGCGGGG - Exonic
941951452 2:171160697-171160719 GCGCGGCGGCGGAGGCGTCGAGG + Exonic
942046188 2:172100734-172100756 CGGCAGCGGCGCCGGCAGCTCGG - Exonic
942277973 2:174336426-174336448 CTGCCGCGGCGGCAGCGGCCGGG + Exonic
942346219 2:175005266-175005288 CGGCGGCGGCGGCGGCGACGGGG + Intronic
942446143 2:176080247-176080269 CGGCGGCGGCGGGGGCGCCGGGG - Exonic
942450900 2:176107586-176107608 CGGCGGCGGCGGCGGCAGCGCGG + Exonic
942450922 2:176107634-176107656 CGGCGGGGGCGGCGGCGGCGCGG + Exonic
942451048 2:176108072-176108094 AGGCAGCGGTGGCGACGGCGAGG + Exonic
942471919 2:176269475-176269497 CAGCAGCGGCGGCTGCAGTGAGG - Exonic
942890494 2:180981011-180981033 CCGGGGCGGCGGCGGCGGTGGGG + Intronic
944451757 2:199850942-199850964 ACGCAGCAGCGGCGAGGGCGCGG + Exonic
944715934 2:202376262-202376284 CGGAGGCGGCGGCGGAGGCGGGG + Intergenic
944743725 2:202635597-202635619 CGGCGGCGGCGGCGGCCGTGGGG - Exonic
945189029 2:207166931-207166953 CGGCGGCGGCGGCGCCCGCGGGG - Intronic
945241553 2:207681459-207681481 CCGCGGCGAGGGCGGCGGCGGGG - Intergenic
945465966 2:210171168-210171190 CCGAAGGTGCGGCGGCGGAGGGG - Exonic
945466006 2:210171292-210171314 CGGCGGCGGCGGCGGCGGCCGGG - Exonic
945648936 2:212537138-212537160 CGGCGGCGGCGGCGGCGGAGCGG + Intronic
946019842 2:216633546-216633568 CGGCGGCGGCAGCGGCAGCGCGG - Exonic
946019857 2:216633601-216633623 CGCGAGTGGCGGCGGCGGCGGGG + Exonic
946219861 2:218217205-218217227 TGGCGGCGGCGGCGGCGGCTCGG + Exonic
946306585 2:218859920-218859942 GCGCAACGGCGGCGGCCGGGAGG - Exonic
946325287 2:218981765-218981787 CGGCGGCAGCGGTGGCGGCGGGG + Exonic
946431027 2:219627546-219627568 CGGCGGCGGCGGCGGAGGTGCGG + Exonic
946692403 2:222319472-222319494 CGGCGGCGGCGGCTGCGGTGGGG + Intergenic
946692489 2:222319771-222319793 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
946843246 2:223837790-223837812 CTGCAGCCGAGGCGGGGGCGGGG - Intronic
946921427 2:224585155-224585177 GGGCAGCCGCGGCGGCGGCGGGG + Exonic
946921437 2:224585182-224585204 CGGCGGCGGCGGCGGCGGCTCGG + Exonic
947418484 2:229921708-229921730 TCCCGGCGCCGGCGGCGGCGGGG - Intronic
947506657 2:230713050-230713072 CCGCGGCGGCGGCGGCTGCGCGG - Exonic
947749183 2:232523924-232523946 CTGCAGCGCCGGCGGCGATGCGG + Exonic
947754320 2:232550791-232550813 CCCCAGCGGGGGCGGGCGCGGGG - Intronic
947840502 2:233204557-233204579 CAGCGGCGGCCGCGGCGTCGGGG - Exonic
948438128 2:237967396-237967418 TGACCGCGGCGGCGGCGGCGGGG + Intronic
948492141 2:238320558-238320580 ACCGGGCGGCGGCGGCGGCGGGG + Exonic
948645369 2:239400852-239400874 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
948801585 2:240435739-240435761 AGCCGGCGGCGGCGGCGGCGCGG - Exonic
948806033 2:240453698-240453720 ACGCAGCAGCGCCGGCGGCCCGG - Intronic
948824681 2:240568504-240568526 GCCGGGCGGCGGCGGCGGCGGGG - Intronic
948824773 2:240568865-240568887 GCGTCTCGGCGGCGGCGGCGGGG - Exonic
948824796 2:240568924-240568946 GGGCAGCGGGGGCGGCGGCGCGG - Exonic
948926591 2:241102496-241102518 CCGCGGCAGAGGCGGCGGCACGG - Intergenic
948945680 2:241217929-241217951 GCGCAGGGGCGGGGGCGGGGGGG + Intronic
1168802628 20:653180-653202 CCGCGGCGGCGGCGACGATGGGG - Exonic
1168883252 20:1225636-1225658 CGGCGGCGGCGGCGGCGGCTGGG - Intergenic
1169065570 20:2692815-2692837 CGGCGGCGGCGGCGGCGGGATGG + Intergenic
1169065595 20:2692870-2692892 GGGCGGCGGCGGCCGCGGCGGGG + Exonic
1169065596 20:2692873-2692895 CGGCGGCGGCCGCGGCGGGGCGG + Exonic
1169278454 20:4248789-4248811 CGCGGGCGGCGGCGGCGGCGTGG - Exonic
1169278487 20:4248870-4248892 CTCCAGCGCGGGCGGCGGCGGGG - Exonic
1169557618 20:6767679-6767701 CGACGGCGGCGGCGGCGCCGTGG - Exonic
1170163961 20:13343584-13343606 CCACAGTGGGGGCGGGGGCGGGG - Intergenic
1170190319 20:13638845-13638867 GCGCGGAGGCGGCAGCGGCGCGG + Intronic
1170629729 20:18056791-18056813 CGGCAGCGGCAGCAGCAGCGCGG - Exonic
1170756804 20:19212486-19212508 GCGGCGCGGCGGGGGCGGCGGGG - Intergenic
1170889969 20:20368416-20368438 CGGCGGCGGCGGCAGCGGCCCGG - Exonic
1170924745 20:20712594-20712616 CGGCGGCGGCGGCAGCAGCGGGG - Intergenic
1171011501 20:21511858-21511880 CCCCGGCGGCGGTGGCGGCGAGG - Exonic
1171217386 20:23362213-23362235 CTGCAGCGGGGGCGCCGGCTGGG + Exonic
1171346526 20:24469895-24469917 GCGCAGACCCGGCGGCGGCGTGG + Intronic
1172037337 20:32019235-32019257 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1172073657 20:32277705-32277727 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1172083220 20:32358681-32358703 CTGGGGCGGCGGCGGCGGTGGGG - Exonic
1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG + Intronic
1172335428 20:34111945-34111967 CCGGAGCGGCAGAGCCGGCGAGG - Intronic
1172474488 20:35226764-35226786 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1172474532 20:35226890-35226912 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1172474535 20:35226896-35226918 CGGCGGCGGCGGCGGGGGCAGGG + Exonic
1172596592 20:36154710-36154732 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
1172698077 20:36835848-36835870 CAGCGGCGGCGGCGGCGGGGAGG - Intronic
1172698078 20:36835851-36835873 GAGCAGCGGCGGCGGCGGCGGGG - Intronic
1173251604 20:41366698-41366720 GACCAGCGGCGGGGGCGGCGCGG - Exonic
1173741655 20:45406391-45406413 GCGCACCGGCGTCGGTGGCGAGG + Intronic
1173800463 20:45891579-45891601 CAGGAACAGCGGCGGCGGCGCGG - Exonic
1174053915 20:47785433-47785455 CGGCAGCGGCAGCGGCGGCGCGG - Intronic
1174246818 20:49188058-49188080 CCACCGCGGCGGCGCCCGCGAGG + Intronic
1174287772 20:49484204-49484226 CGGCGGCGGCGGCGGCTGCCTGG + Intergenic
1174317524 20:49713915-49713937 CAGCGGCGGGGGCGGAGGCGGGG + Intergenic
1174330409 20:49812964-49812986 CCCGGGCGGCGGAGGCGGCGGGG + Intronic
1174357823 20:50010104-50010126 CAGCGGCGGCGGCGGCGGCGAGG + Intergenic
1174357826 20:50010107-50010129 CGGCGGCGGCGGCGGCGAGGGGG + Intergenic
1174380716 20:50153740-50153762 GCGCGGCGGCGGCGCGGGCGGGG + Intergenic
1174607095 20:51768662-51768684 CTGCAGCGGTCGCGGCGGCGCGG - Intergenic
1174611663 20:51802286-51802308 CCCCAGCGGCGCCCGCGGCGGGG - Exonic
1175036138 20:56003640-56003662 CTGCTGCGGCGGCGGGGGAGAGG - Intronic
1175149862 20:56925246-56925268 CCGGAGCGGCGGCGGGCGCGGGG + Intergenic
1175399544 20:58692760-58692782 CCGGAGCGGCGGGGGAGGCGGGG + Exonic
1175429100 20:58890246-58890268 CCGCGGCGGCGGCGGCCTCGGGG - Intronic
1175429371 20:58891234-58891256 CGGCGGCGGCGGCGGCTGGGAGG - Intronic
1175429372 20:58891237-58891259 CCGCGGCGGCGGCGGCGGCTGGG - Intronic
1175429534 20:58891705-58891727 TGGCGGCGGCGGCGGCGGCGGGG - Intronic
1175715516 20:61252449-61252471 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
1175847000 20:62064788-62064810 CGGCTGCGGCGCCGGCGCCGGGG - Exonic
1175911444 20:62407158-62407180 CCGCAGGCGCTGCGGAGGCGCGG - Exonic
1175926774 20:62475194-62475216 CGGCAGCGGCGGCAGCGCGGGGG - Exonic
1175944136 20:62550976-62550998 CGGCAGCGGCGGCGGGCGCAGGG - Exonic
1176016798 20:62938111-62938133 CCGCGGCGGAGGCGGGGGCGGGG - Exonic
1176029798 20:63006476-63006498 GAGCAGCGGCGGCGGCGGCGCGG - Exonic
1176048083 20:63102901-63102923 CCGCAGGGGCGGCGGTGGGGAGG - Intergenic
1176062255 20:63177611-63177633 CGGCGGCGGCGGCGGGCGCGGGG + Intergenic
1176068951 20:63216134-63216156 CAGCGGCGACGGCGGCGGCAGGG + Exonic
1176157031 20:63627063-63627085 ATTCGGCGGCGGCGGCGGCGCGG + Intergenic
1176180417 20:63747136-63747158 CCATGGCGGCGGAGGCGGCGAGG - Exonic
1176380695 21:6111021-6111043 CCGCCCGGGCGGCGGGGGCGGGG + Intergenic
1176418971 21:6499175-6499197 CGGCAGCGGCGGCGGCGGGTGGG - Intergenic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176548427 21:8211775-8211797 CGGCAGCGGCCCCGACGGCGTGG + Intergenic
1176548595 21:8212230-8212252 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176556251 21:8255724-8255746 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176556489 21:8256438-8256460 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176567358 21:8394810-8394832 CGGCAGCGGCCCCGACGGCGTGG + Intergenic
1176567526 21:8395265-8395287 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176575190 21:8438766-8438788 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176575428 21:8439480-8439502 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176576572 21:8443299-8443321 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1176576574 21:8443305-8443327 CGGCGGCGGCGGCGGGGGTGTGG + Intergenic
1176582892 21:8548734-8548756 CCGCAAAAGCCGCGGCGGCGGGG - Intergenic
1176591106 21:8651704-8651726 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1176952661 21:15064943-15064965 CGGCGGAGGAGGCGGCGGCGAGG - Exonic
1177011093 21:15730519-15730541 CCGGGAAGGCGGCGGCGGCGAGG - Intronic
1177166790 21:17612693-17612715 CGGCGGCGGCAGCGGCGGTGAGG - Exonic
1177894548 21:26844432-26844454 CCCCTGGGGCGGCGGTGGCGAGG + Exonic
1178487050 21:33025861-33025883 CGGCAGCGGTGGCGGGGGCGGGG - Intronic
1178513834 21:33229902-33229924 CCCCCGCGCCGGCGGCGGCGCGG + Intronic
1178610301 21:34073776-34073798 CGGCAGCGGGGGCGCCCGCGCGG - Intronic
1178865096 21:36320404-36320426 CGGCGGCGGGGGCTGCGGCGGGG + Intronic
1178914674 21:36699670-36699692 CCGCTCGGGCTGCGGCGGCGGGG - Exonic
1178992264 21:37366346-37366368 GGGCTGCGGGGGCGGCGGCGCGG + Intronic
1179411775 21:41168127-41168149 CGGGACCGGCGGCGGCGGGGAGG - Exonic
1179437166 21:41369832-41369854 CGGGAGCGGGGGCGGGGGCGGGG - Intronic
1179561584 21:42219215-42219237 CGGCGGCGGCGGCGGGGACGAGG - Exonic
1179561585 21:42219221-42219243 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1179663569 21:42893590-42893612 GGGCAGCGGCGGCGGCGGACCGG - Intronic
1179674888 21:42974681-42974703 CGGCGGCGGCGGCGGCGGAGCGG - Intronic
1179694464 21:43107497-43107519 CGGCAGCGGCGGCGGCGGGTGGG - Exonic
1179742777 21:43427219-43427241 CCGCCCGGGCGGCGGGGGCGGGG - Intergenic
1179810168 21:43865145-43865167 AGGAAGTGGCGGCGGCGGCGCGG + Intergenic
1180018175 21:45101079-45101101 CCGCGGCGGCGGCCGCTGCCGGG + Intronic
1180064341 21:45405141-45405163 CAGCGGCGGCGGCTGCAGCGCGG + Intronic
1180265724 22:10525781-10525803 CCGCAAAAGCCGCGGCGGCGGGG - Intergenic
1180273934 22:10628737-10628759 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1180342442 22:11629097-11629119 CCGCGATGGCGGCGGCGGTGGGG + Intergenic
1180614773 22:17120233-17120255 CCGCGGGGGCGCCGGCGGCGCGG - Exonic
1180733872 22:18001415-18001437 CCACAGCGACGCCGGCGCCGAGG - Intronic
1180914887 22:19479154-19479176 CGGCAGCGGCAGCGGCGGCTGGG - Exonic
1180949414 22:19714469-19714491 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1180949415 22:19714472-19714494 CGGCGGCGGCGGCGGCGCGGAGG + Exonic
1181003272 22:19997930-19997952 GCGCAGTGGAGGCGGAGGCGGGG + Intronic
1181006743 22:20017034-20017056 CCTCTGCGGCGGCGGTGGCAGGG + Intronic
1181024042 22:20117623-20117645 GCGCGGCGGCGGCGGCGGCTCGG - Exonic
1181085122 22:20436386-20436408 ATGCAGCGGCGGCGGCGGGCGGG - Intronic
1181299196 22:21867449-21867471 CGGCGGAGGCGGCGGCGGCCCGG - Exonic
1181312526 22:21952876-21952898 CCGCGGCGCCCGCGGCGGCCAGG - Intergenic
1181356268 22:22298069-22298091 GCACAGCGGCGGCGCAGGCGCGG + Intergenic
1181356273 22:22298098-22298120 GCACAGCGGCGGCGCAGGCGCGG + Intergenic
1181356280 22:22298127-22298149 GCACAGCGGCGGCGCAGGCGCGG + Intergenic
1181471344 22:23142036-23142058 CAGCAGCGTCCGCGGCGCCGCGG + Exonic
1181478025 22:23180573-23180595 CGGCGGCGGCGGCGGCGGCACGG + Exonic
1181669658 22:24420267-24420289 CCTCAGGCCCGGCGGCGGCGGGG - Intronic
1181714150 22:24712246-24712268 CCGCAGCGGCTGGGGCGGGACGG - Intergenic
1181811306 22:25405236-25405258 CAGCAGCGGCCACGGCGGCCCGG + Intronic
1182321342 22:29480109-29480131 CCGCAGGGGAGGAGGCGGAGAGG + Intergenic
1182355360 22:29720295-29720317 GGGCGGCGGCGGCAGCGGCGAGG - Exonic
1182475519 22:30574588-30574610 CGGCAGCGGCGGCGGGGGCGGGG - Intergenic
1182475523 22:30574594-30574616 GCGGCGCGGCAGCGGCGGCGGGG - Intergenic
1182576474 22:31276574-31276596 CCGCGGCGAGGGCGGCGGCGGGG - Intronic
1183247219 22:36703246-36703268 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
1183247220 22:36703249-36703271 CGGCGGCGGCGGCGGCAGGGCGG + Exonic
1183358932 22:37373464-37373486 CAGCGGCGGGGGCAGCGGCGGGG - Exonic
1183427210 22:37746315-37746337 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1183441392 22:37825019-37825041 GCGCGGCGGCGGCCGAGGCGCGG + Exonic
1183466703 22:37983791-37983813 AGGCGGCGGCGGCGGCGGCCGGG - Exonic
1183524929 22:38317279-38317301 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1183525000 22:38317492-38317514 CCGGGGCGGCGGCGGCGGGCCGG - Intronic
1183702234 22:39457288-39457310 CCGGGGCGGCGGCGGGGGCCCGG - Intergenic
1183702322 22:39457502-39457524 CAGCGGCGGCGGCGGCTCCGCGG - Exonic
1183744779 22:39686063-39686085 CCGCGGTGGCGCGGGCGGCGGGG + Exonic
1183912949 22:41092442-41092464 CCGGTGCGGCGGCGGCGGCGCGG + Exonic
1184207656 22:43015164-43015186 CGGGAGCGGCGGGGGCGGTGCGG - Intergenic
1184412231 22:44331877-44331899 CGGCGGCGGCGGGCGCGGCGCGG - Intergenic
1184465898 22:44668775-44668797 TGGCAGCGGCGGCGGCGGCGCGG + Intronic
1184523803 22:45009869-45009891 CGGCGGCGGCGGCGGCTGGGCGG - Intronic
1184523804 22:45009872-45009894 AGGCGGCGGCGGCGGCGGCTGGG - Intronic
1184557392 22:45240745-45240767 GCTCGGGGGCGGCGGCGGCGGGG + Intronic
1184557393 22:45240748-45240770 CGGGGGCGGCGGCGGCGGGGAGG + Intronic
1184557424 22:45240893-45240915 GCGCGCGGGCGGCGGCGGCGCGG - Intergenic
1184620330 22:45671916-45671938 CTGCAGCGGCGGCGGCGGTTAGG + Exonic
1184680941 22:46071805-46071827 TCGCAGCGGCGGGGGACGCGCGG + Intronic
1184681131 22:46072547-46072569 GCGCGGCGCCGGCGGCGGCCAGG + Intronic
1184767031 22:46577395-46577417 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1185055202 22:48575677-48575699 CGGCCGCGGCGGCGGAGGCGCGG + Intronic
1185055269 22:48575874-48575896 CGGCGGTGGCGGCGGCGGCGCGG + Intronic
1185055360 22:48576110-48576132 CGGCTCCGGGGGCGGCGGCGGGG + Intronic
1185229540 22:49672275-49672297 CCCCAGCGGGGGTGGGGGCGGGG + Intergenic
1185255079 22:49827422-49827444 CCGAGGCGGCGGCGGCGGCCGGG + Intronic
1185278857 22:49961380-49961402 CACGGGCGGCGGCGGCGGCGGGG + Intronic
1185296700 22:50058282-50058304 GTGCAGCGGCGGCGGCCCCGGGG + Intergenic
1185296761 22:50058450-50058472 CGGCTGCGGGGTCGGCGGCGCGG + Intergenic
1185321137 22:50200714-50200736 CTGCACCGGCGCCGGCAGCGGGG - Intergenic
1185409414 22:50674363-50674385 CCCCGGGGGCGGGGGCGGCGGGG - Intergenic
1185409435 22:50674426-50674448 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203253239 22_KI270733v1_random:127821-127843 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203253479 22_KI270733v1_random:128535-128557 CCGCGGCGTCGGCGGCGGCGCGG - Intergenic
1203254622 22_KI270733v1_random:132357-132379 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203254624 22_KI270733v1_random:132363-132385 CGGCGGCGGCGGCGGGGGTGTGG + Intergenic
1203261294 22_KI270733v1_random:172902-172924 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203261533 22_KI270733v1_random:173613-173635 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203262678 22_KI270733v1_random:177436-177458 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203262680 22_KI270733v1_random:177442-177464 CGGCGGCGGCGGCGGGGGTGTGG + Intergenic
950316306 3:12004643-12004665 CGGCGGCGGCGGCGGCTGCTGGG - Exonic
950438284 3:12993450-12993472 CAGCAGCGGTGGTGGAGGCGGGG + Intronic
950487782 3:13283023-13283045 GCGGCGGGGCGGCGGCGGCGCGG + Intergenic
950729789 3:14947615-14947637 CGGCGGCGGCGGCGGCACCGGGG + Intronic
950940344 3:16884973-16884995 CCGAGGCGGCGGCGGGGACGCGG + Intronic
951080464 3:18445285-18445307 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
951543609 3:23806045-23806067 CAGCAGCCGCCGCGGCGGCACGG + Exonic
951898384 3:27632901-27632923 GCGCGGAGGCAGCGGCGGCGCGG - Intergenic
951898388 3:27632918-27632940 GCGCGGAGGCAGCGGCGGCGCGG - Intergenic
951898392 3:27632935-27632957 GCGCGGAGGCAGCGGCGGCGCGG - Intergenic
951898396 3:27632952-27632974 GCGCGGAGGCAGCGGCGGCGCGG - Intergenic
951907803 3:27721610-27721632 CAGCGGCGGGGGCGGCGGCCCGG - Exonic
952744452 3:36764222-36764244 CGGGGGCGGCGGCGGCTGCGGGG + Intergenic
953657082 3:44862275-44862297 CCGCAGCGCCGCCCGCGGCCCGG - Intronic
953705341 3:45226242-45226264 CCCCGGCGCCGGGGGCGGCGGGG - Exonic
953773477 3:45796527-45796549 CTGCGTCGGCGGCGGAGGCGCGG - Exonic
953908875 3:46882163-46882185 CCGCGTCGGCGGCTGCGGAGGGG + Intronic
953947779 3:47164026-47164048 CGGCGGCGGCGGCGGCGGCAGGG + Intergenic
953989879 3:47475828-47475850 CGGCGGCGGCGGCGGCGACGGGG + Exonic
954004223 3:47578875-47578897 CAGCGGCGGCAGCGGCGGCGCGG - Exonic
954367598 3:50154832-50154854 GCGAAGCGGGGGCGGGGGCGAGG + Intergenic
954367813 3:50155515-50155537 CCCGGGCGGCGGCGGCGGCACGG - Exonic
954437423 3:50503467-50503489 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
954540633 3:51391266-51391288 GCGCGGCGGTGGCGGCGGGGCGG - Exonic
954540634 3:51391269-51391291 TCGGCGCGGCGGTGGCGGCGGGG - Exonic
954540717 3:51391570-51391592 CCGCGGCAGCGGAAGCGGCGGGG + Exonic
954615555 3:51967344-51967366 CGGCGGCGGCGGCGGCGGCACGG + Exonic
954618628 3:51983382-51983404 CGCCAGCGGCCGCGTCGGCGCGG - Exonic
954909024 3:54087773-54087795 CCGCGGCGGCGGGGACTGCGTGG - Intergenic
955387606 3:58492053-58492075 CGGCGGCGGCGGCGGCAGAGGGG - Intergenic
955769232 3:62372517-62372539 TGGCGGCGGCGGCGGCGGGGGGG - Exonic
955769235 3:62372520-62372542 CGGTGGCGGCGGCGGCGGCGGGG - Exonic
955818776 3:62874801-62874823 GAGCAGCGGCGGCGGGGCCGGGG - Exonic
955911570 3:63863949-63863971 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
956064157 3:65379372-65379394 CGGCGGCGGGGGCAGCGGCGTGG - Exonic
956658976 3:71581620-71581642 GGGCAGCGGCAGCGGCGCCGGGG - Intronic
956659490 3:71583813-71583835 CGGCGGCGGCGGCAGAGGCGCGG + Intronic
956675022 3:71725289-71725311 CGGCGGCAGCGGCGGCGGCGCGG + Exonic
956678145 3:71754073-71754095 TGGCAGCGGCGGCGGCGAGGCGG + Exonic
958026891 3:88059269-88059291 CGGCGGCGGCGGCGGCGCAGGGG + Exonic
959056656 3:101574190-101574212 CTGCAGGGGAGGCCGCGGCGGGG + Exonic
959849759 3:111072115-111072137 CAGCAGCGGAGGTGGCGTCGGGG - Exonic
960914368 3:122681193-122681215 CCGGGGCGGGGGCGGGGGCGGGG + Intronic
961612735 3:128153489-128153511 CCGAGGCGGCGGCGGCGGCATGG + Exonic
961827160 3:129605271-129605293 CGGCGGCGGGGGCGGGGGCGGGG - Intronic
961827164 3:129605277-129605299 CGGCGGCGGCGGCGGGGGCGGGG - Intronic
961827168 3:129605283-129605305 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
961858238 3:129893624-129893646 CGGCGGCGGCTGAGGCGGCGCGG - Intergenic
962277954 3:134030034-134030056 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
962277955 3:134030037-134030059 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
962301863 3:134250565-134250587 CAGCAGCGGCGGCGGCGGCGGGG + Exonic
962498633 3:135966499-135966521 CCTCCGCGGCGGCGGCGGCCAGG - Intronic
962575526 3:136752164-136752186 GGGCGGCGGCGACGGCGGCGGGG - Intronic
963236727 3:142963620-142963642 CTGCGGCAGCGGCGGCGGCGCGG + Exonic
963253044 3:143119853-143119875 CGGCGGCGGCGGCTGCGGCGGGG + Exonic
963870192 3:150408301-150408323 CGGCAGCGGCGGCGGCAGCGGGG + Intergenic
963904456 3:150762660-150762682 GGGCCCCGGCGGCGGCGGCGGGG - Exonic
964482779 3:157159572-157159594 CAGCGGCGGCGGCGGCGGGAGGG - Intronic
965165658 3:165192837-165192859 CCACCGCGGCGGCAGCGGCAGGG - Intronic
965881762 3:173396063-173396085 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
966182080 3:177197186-177197208 AGGCGGTGGCGGCGGCGGCGAGG - Intronic
966182289 3:177197848-177197870 CCGCGGCGGTGGGGGCGGGGCGG - Intergenic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
966696410 3:182793907-182793929 CCGCAGCGGAGACGGGCGCGGGG + Intronic
966866098 3:184259958-184259980 CGGCCGCGGTAGCGGCGGCGCGG - Exonic
966866519 3:184261473-184261495 CGGCGGCGGCGGCGGTGGCGGGG + Intronic
966915826 3:184583715-184583737 CCGGGCCGGCTGCGGCGGCGCGG - Intronic
966982703 3:185152945-185152967 ACGCGGCGGCGGCGGGAGCGCGG + Exonic
967916720 3:194583896-194583918 CGGCGGCGGCTGCGGCGGCGGGG + Intergenic
967916721 3:194583899-194583921 CGGCGGCTGCGGCGGCGGGGCGG + Intergenic
967930636 3:194687833-194687855 CAGCAGCAGAGGCGGCGGCCCGG - Exonic
968213402 3:196868026-196868048 CCGCGACGGGGCCGGCGGCGGGG + Exonic
968434110 4:576196-576218 GGGCTCCGGCGGCGGCGGCGCGG - Intergenic
968514231 4:1009718-1009740 CGGTGGCGGCGGCGCCGGCGCGG - Intergenic
968640501 4:1712222-1712244 AGGCTGAGGCGGCGGCGGCGCGG + Exonic
968659508 4:1793296-1793318 GCGCGGTGGCGGCGGCGTCGCGG + Exonic
968674719 4:1871352-1871374 CTGCGGCGGCGGCGGCGGGCGGG + Intergenic
968775435 4:2536963-2536985 GCGGGGCGGCGGCGGCGGCTCGG + Intronic
968820183 4:2844065-2844087 CTGAGGCGGCGGCGGGGGCGCGG + Intronic
968850494 4:3074635-3074657 ACGCTGCGCCGGCGGAGGCGGGG - Intergenic
968850579 4:3075028-3075050 TGGCGGCGGGGGCGGCGGCGGGG - Exonic
969285703 4:6200668-6200690 CCGGGGCGGGGGCGGGGGCGGGG - Intergenic
969330801 4:6472541-6472563 TGGCTGCGGCGACGGCGGCGAGG + Intronic
969357752 4:6640550-6640572 AGGCACCGGCGGCGGCGTCGCGG - Exonic
969394212 4:6910024-6910046 CTGCAGCGCCGGCCGAGGCGGGG + Intronic
969413311 4:7043342-7043364 CTGCGGCGGCGGTGGCGGCCGGG + Intronic
969436591 4:7192612-7192634 CGGCAGCGGAGCCGGCGGCGGGG - Exonic
969715851 4:8867786-8867808 GAGCAGCGGTGGGGGCGGCGCGG + Exonic
969715873 4:8867848-8867870 GCCCAGCGGCGGCTGCGGCCGGG + Exonic
969718903 4:8882299-8882321 CTGCAGCGGGTGCGGCGGGGAGG + Intergenic
970194637 4:13542442-13542464 GTGCAGCGGGGCCGGCGGCGGGG - Exonic
970202891 4:13627516-13627538 CTGCGGCTGCGGCTGCGGCGGGG + Exonic
970333012 4:15003723-15003745 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
970333016 4:15003729-15003751 CGGCGGCGGCGGCGGGGGCGGGG + Exonic
970333032 4:15003782-15003804 GGGCAGCGGCGGCGGCGACGCGG - Exonic
970456221 4:16226550-16226572 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
970456347 4:16226984-16227006 CTGGCGCGGCCGCGGCGGCGGGG + Intronic
970456349 4:16226990-16227012 CGGCCGCGGCGGCGGGGGCCCGG + Intronic
971018946 4:22515673-22515695 CGGCGGCGGCGGCGGCGCCGCGG - Exonic
971279798 4:25233913-25233935 CGGCGGCGGCGGCGGCAGCGGGG - Intronic
971406031 4:26321258-26321280 GGGCGGCGGCGGCGGCGGCGAGG + Intronic
971457807 4:26860791-26860813 GCGCCGCGGCGGCGGCGGCGCGG + Intronic
971635140 4:29047799-29047821 CCACGGCGGGGGCGGCGGCTGGG - Intergenic
972265338 4:37454004-37454026 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
972671456 4:41216410-41216432 CCGCGGCGGCGGGGGGGGGGGGG + Intronic
972765828 4:42151849-42151871 ACGAAGCGGCGGCGGCGGCCCGG + Exonic
973137315 4:46724423-46724445 GGGCCGCGGCGGCGGCGGCAGGG + Intergenic
973279219 4:48341712-48341734 CGGAGGCGGCGGCGGCGGCGGGG + Exonic
973613592 4:52659007-52659029 CTGGGGCGGCGGGGGCGGCGGGG - Intronic
973635944 4:52862208-52862230 GCGGAGCGGCGCCGGGGGCGGGG + Intergenic
974047140 4:56907872-56907894 CGGTGGCGGCGGCGGCGGCGCGG + Intronic
975710579 4:77157241-77157263 CCGCTGAGGCGGCGGGGGTGCGG + Exonic
975778966 4:77819619-77819641 CGGCGGCGGCGGCGGCGACGGGG + Intergenic
975778967 4:77819622-77819644 CGGCGGCGGCGGCGACGGGGCGG + Intergenic
975778985 4:77819675-77819697 CGGCGGCGGCGGTGGCGGCGGGG + Intergenic
975870832 4:78776579-78776601 CGGCAGCGGCGGCGGAGCGGCGG + Exonic
975986259 4:80203237-80203259 CGGCTGCGGCGGCGGCCGCGGGG + Exonic
976068318 4:81214974-81214996 ACGCAGGGGCGGCCGCGCCGAGG - Exonic
976246470 4:83010793-83010815 TGGCGGCGGCGGCGGCGGCCCGG - Exonic
976431407 4:84966514-84966536 AGGCTGAGGCGGCGGCGGCGGGG - Intergenic
977257549 4:94757921-94757943 CGGCGGCGGCGGCGGCGGAGCGG + Intergenic
977257685 4:94758383-94758405 GGGCAGCGGCGGCGGCGGGCGGG + Intronic
977693882 4:99946624-99946646 CCGCCGCCGCGGAGGAGGCGAGG + Exonic
977693906 4:99946698-99946720 CGGCAGCGGCTGCGACGGCCCGG + Exonic
977810066 4:101347530-101347552 CGGCGGCGGCGGCGGCGGAGGGG - Intronic
977908136 4:102501088-102501110 CCGCAGGGGCCGCGGCGTCCAGG + Intergenic
978072568 4:104491415-104491437 CGGCGGCGGAGGCGGGGGCGGGG - Exonic
978072572 4:104491421-104491443 CGGCGGCGGCGGCGGAGGCGGGG - Exonic
978072588 4:104491457-104491479 CGGGGGCGGGGGCGGCGGCGGGG - Exonic
978366653 4:107989906-107989928 TGGCAGCGGCGGCGACAGCGAGG - Exonic
978776981 4:112514938-112514960 TCACTGCGGGGGCGGCGGCGGGG - Exonic
978903283 4:113978870-113978892 CCGCAGCGGCGCGGGGCGCGTGG - Exonic
980130451 4:128811909-128811931 TGGGAGCGGCAGCGGCGGCGAGG - Intronic
980923947 4:139115461-139115483 CCGCGGCGAGGGCAGCGGCGGGG + Intronic
981504108 4:145481723-145481745 CGGCAGCGGCGGCGGCGCGCGGG + Intronic
981615458 4:146639371-146639393 CAGCAGCGGCGGCGGGGGCTCGG + Exonic
981782205 4:148442728-148442750 CCGCAGCCGCGGCGGGAGCTTGG + Intronic
982257627 4:153466237-153466259 CAGCAGCTGCGGCAGCGGCGGGG + Intergenic
982257630 4:153466246-153466268 CGGCAGCGGCGGGGGTGGTGCGG + Intergenic
982712204 4:158768942-158768964 CCACGGCGGCGGCGGCGGCGCGG - Intergenic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
982745823 4:159103435-159103457 AGGCGGCGGCGGCGGCGGCTGGG + Intergenic
982745824 4:159103438-159103460 CGGCGGCGGCGGCGGCTGGGCGG + Intergenic
982745993 4:159104020-159104042 AAACCGCGGCGGCGGCGGCGCGG - Intergenic
983577006 4:169271016-169271038 GGGAGGCGGCGGCGGCGGCGTGG - Exonic
983940283 4:173529553-173529575 AGGCGGCGGCGGCGGCGGCCAGG - Exonic
984668066 4:182449093-182449115 CGGCGGCGGCGGCGGCGGCCTGG + Intronic
984680917 4:182608628-182608650 CTGCAGGGTCCGCGGCGGCGGGG + Intronic
984778676 4:183505164-183505186 CGGAGGCGGCGGCGACGGCGCGG + Exonic
984908298 4:184649516-184649538 CCGCAGCGGAGGCGGCGCGAGGG - Intergenic
984928367 4:184826037-184826059 GCTCAGCCGCGGCGGTGGCGGGG - Intronic
984973434 4:185209954-185209976 CAGCAGCAGCGGCGGCGCCGGGG + Intronic
985515875 5:344257-344279 CGGCAGAGGCGGAGGCGGCGGGG + Intronic
985778369 5:1857080-1857102 CCGCACAGGCTGGGGCGGCGTGG + Intergenic
985964049 5:3326214-3326236 ACGCAGCGCCCGCCGCGGCGCGG - Intergenic
986297088 5:6448739-6448761 CGGCGGCGGCGGCTGCGGCGGGG + Exonic
986330579 5:6713838-6713860 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
986330679 5:6714135-6714157 CGGCCGCGGCGGGGGCGGCCGGG + Intergenic
986330681 5:6714138-6714160 CCGCGGCGGGGGCGGCCGGGCGG + Intergenic
986608624 5:9546177-9546199 GCGGCGCGGCGGCGGGGGCGGGG - Intergenic
986813662 5:11385167-11385189 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
986858794 5:11903689-11903711 CGGCGGCGGCGGCTGCTGCGGGG - Intronic
987050805 5:14144910-14144932 CGGCGGCGGCGGCGGCCTCGGGG + Intronic
987087978 5:14487507-14487529 CGGCGGCGGCGGCGGCAGCGGGG + Exonic
987087983 5:14487519-14487541 CGGCAGCGGGGGCAGCGGCGGGG + Exonic
987258268 5:16179474-16179496 CGGCGTCGGCGGCGGCGGCGGGG + Exonic
988482081 5:31639344-31639366 CCGCGGTGGCGGCAGCTGCGCGG + Intergenic
988609540 5:32711863-32711885 TGGCGGCGGCGGCGGTGGCGCGG + Exonic
989368568 5:40681677-40681699 CCGAGGCGGCCGCGGCCGCGTGG - Exonic
989812570 5:45695868-45695890 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
990165537 5:52989491-52989513 CAGCAGCAGCGGCAGCGGCGCGG - Exonic
990607143 5:57422569-57422591 CCCCCGCGGTGTCGGCGGCGGGG + Intergenic
990825433 5:59893362-59893384 CGGCGGCGGGGGCGGCGGCAGGG + Exonic
990955028 5:61332326-61332348 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
990955035 5:61332353-61332375 CAGCGGCGGCGGCGGCGGCGCGG + Exonic
990955102 5:61332653-61332675 CAACACCGGCGGCGGCGCCGCGG + Exonic
990955116 5:61332692-61332714 CAGCGGTGGCGGCGGCGGCGCGG + Exonic
991371611 5:65925711-65925733 CTGCGGCGGGGGCGGGGGCGGGG - Intergenic
991692092 5:69235086-69235108 CCGCAAAGGTGGAGGCGGCGCGG - Intronic
992105525 5:73447222-73447244 CGGCGGCGGCAGCGGCGGCCGGG + Exonic
992105723 5:73448035-73448057 GGGCGGCGGCGGCGGCGGCGCGG - Exonic
992468531 5:77030786-77030808 CGGCGGCGGCGACCGCGGCGGGG - Exonic
992530143 5:77645318-77645340 CGGCGACGGCGGCGGCGGCGCGG - Intergenic
992940039 5:81751838-81751860 CCGCTGCGGTGGCGGCGCCCGGG + Intergenic
994067115 5:95555452-95555474 CAGCACAGGCGGCGGCGGTGAGG - Intronic
994072824 5:95620838-95620860 CGGCGGCGGCGGCAGCGGCGAGG - Exonic
995106233 5:108381004-108381026 CGGCGGCGGCGGCGGTGGCGGGG - Exonic
995552443 5:113294633-113294655 CGGCAGCGGCGGAGCCCGCGCGG + Intronic
995571703 5:113488382-113488404 CCGCGGCGGCAGCGGCTGCGGGG - Exonic
995574309 5:113513634-113513656 GCGCAGCGGCGGCCGCGCTGAGG + Intergenic
995784876 5:115816936-115816958 CCACAGCGGCGGAGGTGGAGCGG - Exonic
996405620 5:123099753-123099775 CGGCAGCTCCGGCGGGGGCGCGG - Exonic
996690918 5:126338946-126338968 CGGCAGCGGTGGCGGCTGGGAGG - Intergenic
996948193 5:129094802-129094824 CAACAGCGGCGCCGGGGGCGCGG + Exonic
997013532 5:129905151-129905173 CCGCTGCAGCAGCGGCGGCGAGG + Exonic
997201314 5:132011640-132011662 CGGCAGCGGCGGCGGCGGCGCGG - Exonic
997560976 5:134846058-134846080 AGGCAGCGAGGGCGGCGGCGAGG - Exonic
997652888 5:135535464-135535486 CAGGAGAGGCGGCGGCGCCGCGG - Exonic
997654175 5:135543615-135543637 CGGCGGCGACGGCGGCGGCAAGG - Intergenic
998119097 5:139561538-139561560 CGGCGGCGGCGGTGGCGGCTAGG + Exonic
998166673 5:139848286-139848308 GCGCGGCCGCGGCGGCGGCGGGG + Exonic
998200488 5:140114307-140114329 CAGTGGCGGCGGCGGCGGCGGGG + Exonic
998583618 5:143404200-143404222 TCGGCCCGGCGGCGGCGGCGCGG - Intronic
999140462 5:149358110-149358132 CGCCAGCAGCGGCGGCGGCGAGG - Exonic
999300239 5:150486234-150486256 AGGAGGCGGCGGCGGCGGCGTGG + Intronic
999322613 5:150624744-150624766 CGGTGGCGGTGGCGGCGGCGAGG + Intronic
999328210 5:150656531-150656553 CGGTGGCGGCGGCAGCGGCGGGG - Intronic
1000220187 5:159208223-159208245 GCCCCGCGGCGGCGGCGGCCCGG - Intronic
1001035089 5:168291775-168291797 CGGCAGCGGCAGCGGCGGCGTGG + Intronic
1001065057 5:168529543-168529565 CGGCCGCGGGGGCGGCGGCTGGG + Exonic
1001065073 5:168529582-168529604 CCGAGGCGGCGGCGGCGGCGCGG + Exonic
1001065119 5:168529699-168529721 GCGCGGCGGCGGCGACGGCAAGG + Exonic
1001646154 5:173283859-173283881 CCGCTGGGGTGGCGGGGGCGTGG - Intergenic
1002193838 5:177491907-177491929 CCGCGGCGGGGGCGGAGGCCTGG + Exonic
1002212804 5:177608638-177608660 CCGCAGCTGAGGTGGCGGCGGGG - Intronic
1002291663 5:178204719-178204741 CCGCGGCGTCATCGGCGGCGAGG + Exonic
1002401660 5:178994569-178994591 CGGCCGCGGCGACGGCGACGAGG - Exonic
1002524237 5:179806663-179806685 AGGCGGCGGCGGCGGCGGCAGGG + Intronic
1002591067 5:180291966-180291988 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
1002591068 5:180291969-180291991 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1002621973 5:180494461-180494483 TGGCGGCGGCGACGGCGGCGCGG + Exonic
1002788869 6:424257-424279 CAGCAGCGCCCGCGGCGGCCTGG - Intergenic
1002897857 6:1389746-1389768 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
1002926693 6:1609451-1609473 CCCCAGCGCTGGCGTCGGCGGGG + Intergenic
1002927000 6:1610525-1610547 GCGCGGCGGCCGCGGCGGCCGGG + Exonic
1002927244 6:1611567-1611589 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1002927247 6:1611570-1611592 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1002927308 6:1611786-1611808 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1003123239 6:3335266-3335288 CAGCAGCGGCGGAGGCTCCGAGG + Intronic
1003175859 6:3751864-3751886 CTGCGGAGGCGGCGGGGGCGCGG - Exonic
1003291277 6:4780408-4780430 CCGGGGCGGGGGCGGGGGCGGGG - Intronic
1003482478 6:6546322-6546344 CCGCAGCCGCAGCCGCGGAGGGG + Intergenic
1003645526 6:7910633-7910655 CGGCGGCGGCGGCGGCGGACGGG - Exonic
1003995811 6:11538216-11538238 GGGCGGCGGCGGCGGCTGCGAGG - Intergenic
1004043987 6:12009250-12009272 ACGCAGCGGCGGGGGCGGGCAGG + Intronic
1004044686 6:12012442-12012464 CGGCGGCGGCGGCGGCGCCTGGG - Exonic
1004216779 6:13711242-13711264 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1004216848 6:13711479-13711501 CGGCGGCGGCGGCGGCTGCCCGG + Exonic
1004272928 6:14211274-14211296 GGGCATCGGCGGCAGCGGCGCGG - Intergenic
1004504727 6:16238651-16238673 CGGCGGCGGCGACGGCGGGGCGG - Exonic
1004504728 6:16238654-16238676 CTGCGGCGGCGGCGACGGCGGGG - Exonic
1004561939 6:16760463-16760485 CGGCGGTGGCGGCGGCGGCCAGG + Intronic
1004650181 6:17600580-17600602 CGGCTGCGGCGGCAGCCGCGAGG - Exonic
1004650251 6:17600891-17600913 CTGCGGGGGCGGCGGCGCCGCGG - Exonic
1004690346 6:17987691-17987713 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1004732208 6:18368677-18368699 CAGCAGCAGCAGCGGCTGCGCGG - Intergenic
1004924337 6:20403326-20403348 TGGCAGCGGCGGCGCCCGCGTGG + Intronic
1005267359 6:24126158-24126180 CGGCGGCGGCGGCGGCTGCGCGG + Intronic
1005327891 6:24720279-24720301 CGGAAGAGGCGGCGGCGGCGGGG + Exonic
1005928971 6:30466617-30466639 CCGCCGCGGCGCCGACAGCGAGG + Intergenic
1006091616 6:31631965-31631987 CCCAAGCGGCGCCGGCAGCGGGG + Exonic
1006137146 6:31902047-31902069 CGGCGGCGGCGGCGTCGGCTAGG + Intronic
1006337431 6:33427987-33428009 GCGCGGTGGGGGCGGCGGCGGGG - Intronic
1006369179 6:33633741-33633763 TCGCCGCGGGGGCGGGGGCGGGG + Intronic
1006458269 6:34144176-34144198 CAGCAGCATCGGCGGCGGCAGGG - Intronic
1006472663 6:34237336-34237358 CCGCGGCGGCGGCGGCGGAGGGG + Intronic
1006725499 6:36196789-36196811 CGGGAGCGGCGGCGGCGGCCGGG + Exonic
1006950813 6:37819895-37819917 CGGCAGCGGTGGCGGCGGCTGGG - Exonic
1007032370 6:38639906-38639928 CAGCAGCCGGGGCGGCGGCGAGG - Exonic
1007390238 6:41546500-41546522 CGGCGCAGGCGGCGGCGGCGCGG + Exonic
1007557818 6:42782018-42782040 CGGCGGCGGCGGCGGGCGCGGGG - Exonic
1007665295 6:43509940-43509962 CTGCGGCGGAGGCTGCGGCGGGG + Exonic
1007680287 6:43629051-43629073 CGGCAGCAGCAGCGGCTGCGGGG - Exonic
1007781400 6:44256970-44256992 CTGCAGCGGAGGGGGCGGGGAGG - Intronic
1007902046 6:45422031-45422053 CCGCCGCGGAGGCGGCGGCGCGG + Intronic
1008387741 6:50913279-50913301 CTGCGGCGGCGGTGGCTGCGTGG + Intergenic
1008520901 6:52362003-52362025 TCGCAGCGGCGGCAGCGGCGCGG + Intronic
1009431756 6:63572984-63573006 CCGGAGCGACGGGGGCGGCGCGG + Intronic
1010141923 6:72622254-72622276 CAGCGGCGGCGGCGGCGGGCGGG + Exonic
1010428165 6:75749151-75749173 CCGAAGGGGCGGGGGCGCCGGGG - Intergenic
1011194007 6:84763998-84764020 CTGCAGCCGCGGCGGCGGCGCGG - Exonic
1011734390 6:90296813-90296835 CTGCTGAGGCGGCGGCGGCTCGG + Intronic
1011983851 6:93418685-93418707 CTGCGTCGGAGGCGGCGGCGCGG - Intronic
1012400005 6:98835086-98835108 CGGGGGCGGTGGCGGCGGCGGGG + Exonic
1013099482 6:106974874-106974896 TGGCAGTGGCGGCGGCGGCGGGG - Intronic
1013155806 6:107490270-107490292 CGGGAGCGGCAGCGGCAGCGAGG + Exonic
1013170828 6:107635069-107635091 CGGCGGCGGCGGCGGCTGCTCGG - Exonic
1013230511 6:108157785-108157807 CGGCTGCGGCGGGGGCGGCCGGG - Intronic
1013230515 6:108157794-108157816 CCGCTGGTGCGGCTGCGGCGGGG - Intronic
1013836605 6:114342429-114342451 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1014137535 6:117907171-117907193 CGGCGGCGGCGGCGGCAGAGCGG - Intergenic
1014137625 6:117907484-117907506 GGGCGGCGGCGGCGGCGGCACGG + Intergenic
1014246896 6:119078799-119078821 CGGCGGCGGCGGCGGCTGCGCGG - Intronic
1014798314 6:125749653-125749675 GCGCGGCTCCGGCGGCGGCGCGG - Exonic
1014913361 6:127118780-127118802 CGGCTGCGGCTGCAGCGGCGGGG - Exonic
1015149271 6:130019994-130020016 CGGCGGCGGCGGCCGCGCCGGGG + Intronic
1015220639 6:130801497-130801519 CGGCAGCGGCGGCAGCGGCGGGG + Intergenic
1015773541 6:136792285-136792307 CCGGAGAGGAGGCGGCGGCGCGG - Exonic
1015799336 6:137044684-137044706 CGGCAGCGGCAGCGGCCGCAGGG + Exonic
1015965589 6:138693082-138693104 CGGCGGCGGCCGCGGCGGCGAGG + Intergenic
1016034547 6:139373383-139373405 CAGCAGCTCGGGCGGCGGCGCGG - Exonic
1016329875 6:142945123-142945145 CCGCAGCCGCAGCGGTGGCCGGG + Exonic
1016447761 6:144150516-144150538 CAGATGCGGCCGCGGCGGCGCGG + Exonic
1016713992 6:147203726-147203748 CCGCGGCGGTGGCGGCAGCAGGG - Intergenic
1016863817 6:148747233-148747255 CCGCTCGGGCCGCGGCGGCGGGG + Intergenic
1016965846 6:149718036-149718058 CGGCGGCGGCGGCGGTGGCCTGG - Exonic
1017103090 6:150865717-150865739 CGGCGGCGGCGGCGGCGGGAAGG - Exonic
1017164139 6:151391487-151391509 CAGAGGCGGCGGCGGCGGGGAGG - Exonic
1017164140 6:151391490-151391512 AGGCAGAGGCGGCGGCGGCGGGG - Exonic
1017164162 6:151391559-151391581 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1017324581 6:153130967-153130989 CCCCGGCGGGGGCGGCTGCGCGG - Intronic
1017671968 6:156777703-156777725 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1017671970 6:156777709-156777731 CGGCGGCGGCGGCGCGGGCGCGG + Intergenic
1017672499 6:156779568-156779590 CCGCGGGGGCGGCGGGGGCGCGG + Intronic
1017842506 6:158232775-158232797 CGGCAGGGGAGGTGGCGGCGCGG - Intronic
1018023933 6:159789549-159789571 CAGCAGTGGCTGCGACGGCGTGG + Exonic
1018400326 6:163414600-163414622 CGGCAGCAGCGGCGGCGGCGGGG - Intronic
1018400358 6:163414733-163414755 CGGCAGCGGCAGAGGCGCCGCGG + Exonic
1018613056 6:165662158-165662180 CCGGGGCGGCGGCGGCGGCCGGG + Intronic
1018613154 6:165662532-165662554 GCGCGGCGGCGGCTGCGGCTGGG - Intronic
1018613394 6:165663259-165663281 CGGCGGCGGCGGCGGCGGCGTGG - Intronic
1019111906 6:169723945-169723967 CGACGGCGGCGGCGGCGGCGCGG - Exonic
1019111916 6:169723980-169724002 CGGCAGCGGCGGCGGCGGCCGGG - Exonic
1019298498 7:291162-291184 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1019343754 7:519997-520019 CTGCCGCGGCGGCGGCGCCCGGG - Intronic
1019450640 7:1095943-1095965 CGGCAGCAGCGGCAGCGGGGAGG + Intronic
1019472876 7:1230425-1230447 CCTCGGCTGCGGCGGCGCCGCGG - Intergenic
1019577678 7:1745420-1745442 CGGCGGAGGCGGGGGCGGCGGGG - Exonic
1019828333 7:3301616-3301638 CGGTGGCGGCGGCGGCGGCGCGG + Exonic
1019989558 7:4682256-4682278 CGGCGGCTGCAGCGGCGGCGCGG - Intergenic
1019989613 7:4682457-4682479 TGGCGGCGGCGGCGGCGGCCCGG - Exonic
1020178102 7:5898804-5898826 CTGCAGCGGCGGCCGGGGCCGGG + Exonic
1020204571 7:6104983-6105005 CGGCGGCGGCGGCGGCCGAGGGG + Exonic
1020238466 7:6374467-6374489 TGGGAGCGGCGGCGCCGGCGCGG + Intergenic
1020238525 7:6374699-6374721 GGGCCGCGGCGGCGGCGGCAGGG - Exonic
1020274293 7:6615498-6615520 CGACGGCGGCGGCGGCGGCGGGG + Intergenic
1020274296 7:6615504-6615526 CGGCGGCGGCGGCGGGGGCCGGG + Intergenic
1020278310 7:6637517-6637539 CGGGGGCGGCGGCGGCGGCGGGG + Intronic
1020281636 7:6653105-6653127 CCGACGCGGCGGGGGCTGCGCGG + Exonic
1020304825 7:6826171-6826193 CTGCAGCGGCGGCCGGGGCCGGG - Exonic
1021101101 7:16586564-16586586 CTGCTGCGGTGGCGGCTGCGTGG + Intergenic
1021163007 7:17298962-17298984 CTACACCGGCGGAGGCGGCGCGG - Exonic
1021313150 7:19117060-19117082 CTGTGGCGGCGGCGGCGGCGCGG - Exonic
1021313185 7:19117171-19117193 GCGCAGCGCGGGCGGCGGCGCGG - Exonic
1021451051 7:20784421-20784443 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
1021451251 7:20785336-20785358 GGGCAGCGGCGGCGGCGGCGGGG - Exonic
1021510502 7:21427998-21428020 GCGCGGCGCGGGCGGCGGCGCGG - Intergenic
1021827987 7:24573550-24573572 GAGCGGCGGCAGCGGCGGCGCGG + Exonic
1021828053 7:24573757-24573779 AGGCGGCGGCGGCGGCGCCGCGG + Intronic
1022094478 7:27130299-27130321 CTGCAGGGGCGGCGGCAGCTGGG + Exonic
1022101918 7:27174003-27174025 GGGCAGCGGTGGCGGTGGCGGGG - Exonic
1022103793 7:27184541-27184563 CGGCGGCGGCGGCGGCTGCCGGG - Exonic
1022106288 7:27199922-27199944 CTGCAGCGGCGGCGGCTGCCGGG - Exonic
1022285969 7:28956540-28956562 CCGCGGCGGCAGCGACGGAGGGG + Exonic
1022400023 7:30028298-30028320 TCGCGGCAGCGGCGGCGGGGCGG - Intronic
1022715067 7:32891602-32891624 CCGGCGCGGCGGCGGGGGCGTGG + Exonic
1022715152 7:32891892-32891914 GCGCGGCGGGGGCGGGGGCGGGG - Exonic
1022723026 7:32957596-32957618 CAGGAGCAGCGGTGGCGGCGGGG - Exonic
1023405882 7:39833523-39833545 CGGTAGCGGCGGCGGCGGCGAGG + Intergenic
1023418121 7:39950739-39950761 CAGCAGCGGCGGCTGCTGAGGGG - Exonic
1023581589 7:41689999-41690021 CCTCATCGCCGGCGTCGGCGGGG - Exonic
1023637588 7:42228070-42228092 CCCAGGCCGCGGCGGCGGCGCGG + Intronic
1023951278 7:44848025-44848047 CGAGAGCGGCGGCGGCGGCGCGG - Exonic
1024043863 7:45574567-45574589 AGGCGGCGGCGGAGGCGGCGCGG + Exonic
1024580000 7:50793506-50793528 CGGCGGCGGCGGCAGAGGCGGGG - Intergenic
1025007521 7:55365944-55365966 CCTCGGAGGAGGCGGCGGCGGGG + Exonic
1025069689 7:55887623-55887645 CGGCGGCGGCGGCGGCGTCAGGG + Intronic
1025076912 7:55951738-55951760 CCGCGGCGGTGGCGGGGTCGGGG - Intergenic
1026765165 7:73155458-73155480 GCGAAGCGGCGGCGGGGGCGGGG - Intergenic
1026806739 7:73433803-73433825 TGGCAGCGGCGGTGGCGGCTAGG + Exonic
1026817142 7:73521930-73521952 CCATCGCGGCGGCGGCGGTGGGG + Exonic
1026822293 7:73557653-73557675 ACGCTGCGGCGGCGGCGGGCGGG - Exonic
1026853479 7:73738659-73738681 CAGCAGCAGCGGCGGCCGAGGGG - Exonic
1027025865 7:74851337-74851359 CGGCGTCGGCGGCGGGGGCGGGG + Intronic
1027041638 7:74965213-74965235 GCGAAGCGGCGGCGGGGGCGGGG - Intronic
1027061894 7:75092773-75092795 CGGCGTCGGCGGCGGGGGCGGGG - Intronic
1027061898 7:75092779-75092801 CGTCGGCGGCGTCGGCGGCGGGG - Intronic
1027082004 7:75237156-75237178 GCGAAGCGGCGGCGGGGGCGGGG + Intergenic
1027244653 7:76358921-76358943 CAGCTGAGGCGGCGGCTGCGCGG + Exonic
1027390276 7:77696898-77696920 CAGCGGCGGCGGCGGCGGGCAGG - Exonic
1027978357 7:85186416-85186438 CCGCAGCTGCTGAGGCGGGGTGG + Intronic
1028585568 7:92447894-92447916 CGGCGGCGGCGGCTTCGGCGCGG + Exonic
1028922338 7:96322036-96322058 TCCCGGCGGCGGCGGCGGTGGGG + Exonic
1029054945 7:97732262-97732284 CCGCAGCGGCGCCCCCAGCGCGG - Intronic
1029080756 7:97972228-97972250 CTGCAGCGGCGGCCGGGGCTGGG - Intergenic
1029118687 7:98252086-98252108 CCCCAGCTGCAGCGGCGGCCAGG - Intronic
1029123187 7:98281711-98281733 CGGCGGCGGCGGCGGGGACGCGG - Exonic
1029123188 7:98281717-98281739 GGGACGCGGCGGCGGCGGCGGGG - Exonic
1029123216 7:98281768-98281790 CCGGAGCGGCGGGCGCGGCCGGG + Exonic
1029238791 7:99144012-99144034 CGGCGGAGGCGGCGGCGGCTCGG - Exonic
1029238812 7:99144079-99144101 CGGCAGCGGCGGAAGCGGCGAGG - Exonic
1029281563 7:99438956-99438978 CGGCGGCGGCGGCGGCGGCGAGG + Intronic
1029390587 7:100271701-100271723 GCGAAGCGGCGGCGGGGGCGGGG + Intronic
1029456207 7:100673813-100673835 CGGCGGCGGCGGCGGCGGCGCGG - Exonic
1029640405 7:101816403-101816425 CGCTGGCGGCGGCGGCGGCGCGG - Intronic
1029640539 7:101816757-101816779 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1029708329 7:102286808-102286830 TCGCGGCGGGGGCGGGGGCGGGG + Intronic
1029730127 7:102433488-102433510 CAGCGGCTGCGGCGGCCGCGGGG + Intronic
1029730131 7:102433494-102433516 CTGCGGCGGCCGCGGGGGCGGGG + Intronic
1029896399 7:103989353-103989375 CGGCGGCGGCGGCGGCGGCATGG - Exonic
1030033443 7:105388914-105388936 CGGCGGCGGCGGCGCAGGCGCGG - Intronic
1030138701 7:106284564-106284586 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
1030739066 7:113086574-113086596 CGGCGGCGGCTGCGGTGGCGAGG + Intronic
1030820727 7:114087628-114087650 CGGCGGCGGCGCCGGCGGCGCGG + Intronic
1031361978 7:120857965-120857987 AGGCGGCGACGGCGGCGGCGGGG - Exonic
1031531865 7:122886178-122886200 GCGCGCGGGCGGCGGCGGCGCGG - Exonic
1032119318 7:129144956-129144978 CGGGGGCGGTGGCGGCGGCGGGG + Exonic
1033099979 7:138461132-138461154 CAGCGGCGGCGGCGGCGGCGCGG - Intronic
1033186546 7:139231762-139231784 CGGGAACGGCGGCGGCGGCTCGG - Exonic
1033186555 7:139231792-139231814 CCGCGGCGGGGGCGGCTGCAAGG - Exonic
1034192706 7:149224038-149224060 CCGCAGCACCGGGGGCGGCGGGG + Exonic
1034306280 7:150047662-150047684 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1034441060 7:151086355-151086377 CAGGAGGGGCGGGGGCGGCGGGG + Intronic
1034455403 7:151167491-151167513 CAACGGCGGGGGCGGCGGCGGGG - Exonic
1034469718 7:151248750-151248772 CGGCGGCGGCGGCGGCGGGCGGG - Exonic
1034483543 7:151341739-151341761 CGACAGCGGCGGCGGGGGCGGGG + Exonic
1034800566 7:154052988-154053010 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1035169564 7:157010032-157010054 GGGCGGCGGCGGCGGCGGCACGG - Exonic
1035169605 7:157010203-157010225 AGGTGGCGGCGGCGGCGGCGGGG - Exonic
1036276351 8:7355037-7355059 CCGCAGAGGCTGAGGTGGCGCGG - Intergenic
1036344993 8:7955310-7955332 CCGCAGAGGCTGAGGTGGCGCGG + Intergenic
1036432323 8:8702367-8702389 CTGCAGGGGCGCCGTCGGCGCGG + Exonic
1036561440 8:9903289-9903311 GCGCAGCGGCCGCGGGCGCGAGG - Intergenic
1036723729 8:11201069-11201091 CCGCAGCGCCGCCGCCGACGGGG - Exonic
1036788658 8:11703851-11703873 CCGCAGCGGCGGGCGAGGGGCGG - Intronic
1036789497 8:11708660-11708682 CAGCGGCGGCGGCGGCCGCCAGG - Exonic
1037529218 8:19757329-19757351 CAGCGGCGGCGGCGGCGGCTCGG + Intronic
1037769189 8:21789074-21789096 CTGCAGCGGCGGCGGCGACAAGG + Intronic
1037769203 8:21789118-21789140 TGGCGGCGGCGGCGGCGCCGGGG + Intronic
1038296001 8:26291546-26291568 CGGCGGCGGCGGCAGCGGCAGGG - Intronic
1038304032 8:26383281-26383303 CCGCGCCGGTGGCGGCGGCCGGG - Intronic
1039595450 8:38787122-38787144 CGGGGGCGGCGGCGGCGCCGGGG - Intronic
1039921461 8:41896788-41896810 CGGCGGCGGCGGCGGCGAAGCGG + Intergenic
1039949007 8:42153262-42153284 CCGCAGCCGCGGCGCCGGGAAGG - Intronic
1040038839 8:42896759-42896781 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1040038840 8:42896762-42896784 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1040055897 8:43056553-43056575 CCCCCGCGGCGGCCGCGGCTCGG + Intronic
1040415237 8:47189237-47189259 CTGCTGCGGCGGCCGCGGCCGGG - Intergenic
1041201645 8:55455263-55455285 CTGCGGCTGCGGCGGCGGCCCGG + Intronic
1041689925 8:60678793-60678815 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1041689928 8:60678796-60678818 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1041690083 8:60679352-60679374 CCGCCGGGCCGGCGGCGGCGGGG + Intronic
1041690145 8:60679618-60679640 GAGCAGCGGCGGCGGCGGCTCGG + Intronic
1041919831 8:63168975-63168997 CGGCAGCGGCGGCGACGGGGAGG - Intronic
1042040040 8:64580747-64580769 CGGCAGCGGGCGCGGCGGCCCGG + Exonic
1042040127 8:64581060-64581082 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
1042040128 8:64581063-64581085 CGGCGGCGGCGGCGGCGGGGTGG + Exonic
1042040221 8:64581387-64581409 CCTGGGCGGCGGCGGCGGCGGGG + Exonic
1042532859 8:69832990-69833012 CGGCGGCGGCGGCGGCGGAGGGG - Exonic
1042785093 8:72537379-72537401 CAGCGGCGGCGGCGGCCGCGGGG - Exonic
1042962186 8:74315450-74315472 CGGCGGCGGCTGCGGCGTCGTGG + Exonic
1043464033 8:80487182-80487204 CTTCCGAGGCGGCGGCGGCGGGG + Exonic
1043484664 8:80687334-80687356 CGAGAGCGGCGGCGACGGCGTGG + Exonic
1043563476 8:81522253-81522275 CTGCAGCGGCGGCGCTGGAGCGG + Intergenic
1043769722 8:84183352-84183374 AGGCGGCGGCGGCGGCGACGGGG - Intronic
1043847281 8:85177515-85177537 CGGCGGCGGGGGCGGCTGCGGGG - Exonic
1044306355 8:90645608-90645630 CGGGAGTGGCGGCGGCGGCGTGG - Exonic
1044685604 8:94823224-94823246 CCGAAGGCGCGGCGGTGGCGCGG + Intronic
1044692899 8:94896269-94896291 GCGCGCTGGCGGCGGCGGCGGGG - Intronic
1044698802 8:94948895-94948917 TGACAGAGGCGGCGGCGGCGCGG - Intronic
1044988542 8:97775781-97775803 CTGCAGCGGCGGGGACGGGGAGG - Exonic
1044988543 8:97775784-97775806 CCGCTGCAGCGGCGGGGACGGGG - Exonic
1045305228 8:100951985-100952007 CGGCGGCGGCAGCAGCGGCGAGG + Exonic
1045516292 8:102863625-102863647 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1045583224 8:103500817-103500839 TGGCAGCGGCGGCACCGGCGCGG - Intronic
1046547418 8:115669074-115669096 GCGGGGCGGCGGCGGCGGCGCGG - Intronic
1046659968 8:116938488-116938510 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1047024555 8:120811811-120811833 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1047292287 8:123541109-123541131 CCGCGACGGGGGCGGCGGGGCGG + Exonic
1047382023 8:124372653-124372675 CGGCGGCGGCGGCTGCGGCTCGG - Exonic
1048214124 8:132480460-132480482 CGGGGGCGGCGGAGGCGGCGGGG - Exonic
1048345596 8:133572266-133572288 CGGAGGCGGCGGCTGCGGCGCGG + Intergenic
1048981176 8:139703928-139703950 GCGCGGCGGCGGCGGCGGGAGGG + Intergenic
1048981713 8:139705995-139706017 CCGCAGCGAGGCCGGCTGCGCGG - Intergenic
1049145971 8:141001240-141001262 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1049194518 8:141308109-141308131 CCGGGGCCGCGGGGGCGGCGGGG + Intronic
1049405436 8:142450073-142450095 CAGCAGCGGCCCCGCCGGCGAGG - Exonic
1049419586 8:142510871-142510893 CGTCAGCGGCGGCGGGGACGCGG - Intronic
1049419587 8:142510877-142510899 GCGGAGCGTCAGCGGCGGCGGGG - Intronic
1049585299 8:143430160-143430182 CGGCGGCGGCGGCGGCGCGGGGG - Exonic
1049585303 8:143430163-143430185 CACCGGCGGCGGCGGCGGCGCGG - Exonic
1049585446 8:143430648-143430670 CCGAGGCGGCGGCCGCGGGGAGG - Intergenic
1049689785 8:143953444-143953466 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1049689786 8:143953447-143953469 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1049746960 8:144267086-144267108 AGGCGGCGGGGGCGGCGGCGGGG - Exonic
1049762169 8:144336602-144336624 CCGCGGCGGCGGGGGGGGGGAGG - Intergenic
1049762171 8:144336605-144336627 CCGCCGCGGCGGCGGGGGGGGGG - Intergenic
1049762273 8:144336902-144336924 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1049793128 8:144482069-144482091 CGGCGGCGGCGGCGGCAGCCGGG - Intronic
1049936319 9:504606-504628 CCGCCCCGGCGGCGGCCGTGCGG + Intronic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1050437927 9:5629190-5629212 CGGCGGCGGCGGCGGCAGCTCGG - Exonic
1050455831 9:5833075-5833097 CGGCGGCGTCGGCGGCGGCCGGG - Exonic
1050874042 9:10613177-10613199 CGGCGGCGGCGGCGGCGCTGCGG + Intergenic
1051079693 9:13279662-13279684 CTGCCGCGGAGGCGGTGGCGGGG + Intergenic
1051287426 9:15510935-15510957 CGGCGGCGGCAGCGGCGGCGCGG - Exonic
1051289113 9:15527703-15527725 CGGCGGCGGCGGCTGCTGCGCGG + Intergenic
1052192789 9:25678177-25678199 CAGCGGCGGCGGCGGCGGCGTGG - Exonic
1052300458 9:26947302-26947324 CCGCATCGGCGTCGGCGGTTGGG - Exonic
1052804598 9:33001610-33001632 CCGCAGCGCCGGAAGCGGTGAGG - Intronic
1052888939 9:33677382-33677404 CGGCGGCGGCGGCGGCGGCCCGG - Intergenic
1053239942 9:36487405-36487427 CGGCCGGGGCGGCGGCGGTGGGG + Intronic
1053240025 9:36487690-36487712 AAGCGGCGGCGGCGGCGGAGGGG + Intergenic
1053240029 9:36487696-36487718 CGGCGGCGGCGGAGGGGGCGGGG + Intergenic
1053306212 9:36986351-36986373 CCGCCGGCGCGGCCGCGGCGGGG - Intronic
1053306217 9:36986353-36986375 CCGCCGCGGCCGCGCCGGCGGGG + Intronic
1053690426 9:40584158-40584180 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1053697505 9:40651092-40651114 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1053697605 9:40651439-40651461 CCGTGGCGGCGGCGGGGGGGGGG + Intergenic
1054274363 9:63053249-63053271 GCACAGCGGCGGCGCAGGCGCGG + Intergenic
1054301678 9:63385119-63385141 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1054308797 9:63450501-63450523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054400461 9:64711680-64711702 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1054407655 9:64774848-64774870 CGGCGGCTGCGGCGGCGGCGGGG + Intergenic
1054407724 9:64775083-64775105 CCGCTGCGGCGGGGGGGGGGTGG + Intergenic
1054434051 9:65195936-65195958 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1054440856 9:65258893-65258915 AAGCCGCGGCGGCGGCGGGGGGG + Intergenic
1054489417 9:65762591-65762613 CCGCGGCGGCGGCGGGGGGGGGG - Intergenic
1054489421 9:65762594-65762616 AAGCCGCGGCGGCGGCGGGGGGG - Intergenic
1054496336 9:65825732-65825754 GCACAGCGGCGGCGCAGGCGCGG + Intergenic
1054738477 9:68780233-68780255 CGGTGGCAGCGGCGGCGGCGGGG + Exonic
1054798672 9:69325537-69325559 CGGCAGCGGCGGCGACTGCCCGG - Intronic
1054842666 9:69760048-69760070 CGGCCGCGGCGGCGGGGACGCGG - Intergenic
1054842667 9:69760054-69760076 CGGCGGCGGCCGCGGCGGCGGGG - Intergenic
1055091119 9:72365284-72365306 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1055514158 9:77020142-77020164 GGGCGGCGGCGGCGGCGGCTGGG - Exonic
1055611713 9:78031380-78031402 CCGCCGCGGGGGCGGCGGCCAGG + Exonic
1055611779 9:78031585-78031607 CGGCGGCGGCGGCGGCGGCTCGG - Intergenic
1056143546 9:83707583-83707605 CCGCGGAGGCAGCGGCCGCGGGG + Exonic
1056154051 9:83817560-83817582 CCGCGGGAGAGGCGGCGGCGGGG - Exonic
1056356446 9:85805533-85805555 CCGCGGGAGAGGCGGCGGCGGGG + Intergenic
1056475070 9:86945807-86945829 CAGCGGCGGCGGCGGCCGCTTGG - Exonic
1056475179 9:86946314-86946336 CCGGACGAGCGGCGGCGGCGCGG - Exonic
1056475395 9:86947231-86947253 CGGCGGCGGTGGCGGCGGCGAGG - Intergenic
1056659697 9:88534944-88534966 GCGCAGTGGGGGCGGGGGCGGGG + Intergenic
1056773943 9:89498044-89498066 CGGCGGCGGCAGCGGCGGCTGGG + Intronic
1057245612 9:93451897-93451919 CCATGGCGGCGGCGGGGGCGCGG - Exonic
1057259665 9:93576672-93576694 CGGGGGCGGCGGGGGCGGCGGGG - Exonic
1057313428 9:93955178-93955200 CGGCGGCGGCGGCGACGGCTTGG + Exonic
1057314166 9:93958361-93958383 CAAAAACGGCGGCGGCGGCGGGG + Intergenic
1057463753 9:95292348-95292370 CGGAGGCGGTGGCGGCGGCGGGG + Intronic
1057488632 9:95506092-95506114 CGGCAGCGGCGGCGGGCCCGGGG + Intronic
1057600128 9:96450455-96450477 ACGAGGCGGCGGCGGCGGCCGGG + Exonic
1057869710 9:98708687-98708709 TGGCGGCGGCGGCGGCGGCCCGG + Exonic
1057869885 9:98709256-98709278 GCGCTGCGGCGGCCGCGGGGAGG + Intergenic
1057881523 9:98796294-98796316 CCGCAGCGGCGGGGGCAGTCGGG - Exonic
1057995477 9:99819509-99819531 CCGAGGCGGCGGTGGCGGCCCGG - Intergenic
1058504757 9:105656219-105656241 AGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1058885836 9:109320694-109320716 CGGCGGCGGCGGCGGCGGGACGG - Exonic
1059021313 9:110579568-110579590 CCGGAGCGCAGGCGGCGGCTCGG + Exonic
1059375226 9:113876156-113876178 CGGCAGCGGCTGCCGCGGCGCGG + Intergenic
1059483716 9:114611539-114611561 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1059633936 9:116154342-116154364 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
1060176322 9:121499758-121499780 CCGCTCGGGCGGAGGCGGCGCGG - Intergenic
1060468703 9:123930051-123930073 TGGAGGCGGCGGCGGCGGCGAGG - Exonic
1060468739 9:123930174-123930196 GGGCAGCGGCGGCGGCAGCGCGG - Intergenic
1060554952 9:124503464-124503486 CGGCTGGGGCGGCGGCCGCGGGG - Intronic
1060555278 9:124504741-124504763 CCTCGCCGGCGGCGGCGGCGCGG - Intronic
1060566773 9:124599585-124599607 GCGCGGCGGCGGCGGCCGCTCGG + Intronic
1060700751 9:125747379-125747401 CGGCGGCGGCGGCGGCGACGAGG - Intronic
1060770174 9:126326813-126326835 CGGCGGCGGCGGCGGAGGGGCGG - Intergenic
1060770175 9:126326816-126326838 CGGCGGCGGCGGCGGCGGAGGGG - Intergenic
1060916929 9:127397400-127397422 GGGCAGCGGCGAAGGCGGCGAGG - Exonic
1061089852 9:128420601-128420623 CCGGAGGGGCGACGGCGGAGGGG - Exonic
1061108702 9:128552208-128552230 CCGCAGGGCGGGCGGTGGCGGGG + Intergenic
1061144058 9:128787046-128787068 CCGCAGGGTCGGCGGCGCTGGGG + Intergenic
1061196659 9:129110566-129110588 CAGCCGCGGCGGCGGCGGCGCGG - Exonic
1061366041 9:130172819-130172841 ACGGAGCGGAGGCGGCAGCGCGG - Intronic
1061438152 9:130579652-130579674 CGGCGGCGGCGACGGCGGCGGGG + Exonic
1061541084 9:131278045-131278067 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1061666188 9:132162083-132162105 CCACAGCGGCGGGAGCGGCGCGG + Exonic
1061726955 9:132587276-132587298 GGGCACCGGCGGCGGCTGCGAGG + Intronic
1061802766 9:133121191-133121213 GCGCGGCGGGGGCGGCGGCGCGG + Intronic
1061961851 9:133992636-133992658 CAGGAGCCGCGGCGGCCGCGGGG - Intergenic
1061975825 9:134067709-134067731 CGGTGGCGGCGGCGGTGGCGCGG - Intronic
1062022522 9:134326236-134326258 GCGGGGCGGCGGCGGCGGAGGGG + Intronic
1062022557 9:134326353-134326375 GCGCTGCGGCGCCGGCGGGGGGG - Intronic
1062084618 9:134642237-134642259 CAGCAGCGGGGGCAGCAGCGGGG - Exonic
1062314794 9:135961335-135961357 CTGCTGCGGCGGCGGGAGCGAGG - Exonic
1062346727 9:136118497-136118519 CCGCGGCGGCGCCGGCGTCCCGG + Exonic
1062499672 9:136846984-136847006 CCGCGCCGGGGGCGGCCGCGCGG - Exonic
1062507673 9:136886472-136886494 CGGCGGCGGCGGCGGCGTTGGGG + Intronic
1062558713 9:137129598-137129620 AAGCAGCGGCGGCGGATGCGTGG + Intergenic
1062560406 9:137139191-137139213 CGGCGGCGGCGGCGGCTCCGCGG - Intronic
1062574565 9:137200220-137200242 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1062592656 9:137281119-137281141 CTGCAGCGGGGCCGGCGGCGGGG - Exonic
1062659100 9:137619089-137619111 GGGCAGCGGCGGAGGCGGCGCGG + Intronic
1062659130 9:137619172-137619194 CAGCGGCGGCGGCGGCGGCGGGG - Intronic
1062696271 9:137877790-137877812 CGGCGGCGGCTGCGGCGGTGGGG + Exonic
1062696346 9:137877996-137878018 CCGGGGCGGCGGGGCCGGCGGGG + Exonic
1202779853 9_KI270717v1_random:24389-24411 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203774027 EBV:62906-62928 CAGCAGCGGCGGTAGCGGAGGGG - Intergenic
1203469641 Un_GL000220v1:110968-110990 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203469879 Un_GL000220v1:111682-111704 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203471023 Un_GL000220v1:115501-115523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203471025 Un_GL000220v1:115507-115529 CGGCGGCGGCGGCGGGGGTGTGG + Intergenic
1203477462 Un_GL000220v1:154940-154962 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203477700 Un_GL000220v1:155654-155676 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203478844 Un_GL000220v1:159473-159495 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203478846 Un_GL000220v1:159479-159501 CGGCGGCGGCGGCGGGGGTGTGG + Intergenic
1203612927 Un_KI270749v1:26799-26821 CCGCAAAAGCCGCGGCGGCGGGG - Intergenic
1185641539 X:1591724-1591746 GGCCAGCGGCGGCGGCGGCCTGG + Exonic
1185736647 X:2500937-2500959 GCGCGGAAGCGGCGGCGGCGCGG - Exonic
1185892790 X:3835581-3835603 CCGCGGCGGATGCGGCGGCCAGG - Intronic
1185892798 X:3835595-3835617 CCGCCGCGGCGGCTGAAGCGGGG + Intronic
1185897898 X:3874001-3874023 CCGCGGCGGATGCGGCGGCCAGG - Intergenic
1185897906 X:3874015-3874037 CCGCCGCGGCGGCTGAAGCGGGG + Intergenic
1185903017 X:3912432-3912454 CCGCGGCGGATGCGGCGGCCAGG - Intergenic
1185903025 X:3912446-3912468 CCGCCGCGGCGGCTGAAGCGGGG + Intergenic
1186426091 X:9465202-9465224 GCGCTGCGGCGGCGGCGGGGCGG - Exonic
1186496504 X:10015720-10015742 CCGGGCCCGCGGCGGCGGCGCGG - Exonic
1187067465 X:15854726-15854748 CGGCGGCGGCGGCGGCGAAGGGG + Exonic
1187181445 X:16946896-16946918 CGGCAGCGGCAGCGGCGGGCGGG + Exonic
1187181451 X:16946929-16946951 CAGCAGCAGCGGCGGCGGCCCGG - Exonic
1187518142 X:19990921-19990943 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1188003525 X:25002645-25002667 GGCCGGCGGCGGCGGCGGCGTGG + Intergenic
1188003527 X:25002648-25002670 CGGCGGCGGCGGCGGCGTGGCGG + Intergenic
1189035652 X:37491907-37491929 GGGCAGTGGCGGCAGCGGCGGGG - Intronic
1189054621 X:37685907-37685929 ACGCAGTGGCGGCGGCTGTGTGG - Exonic
1189310435 X:40014123-40014145 CAGGAGAGGCGGCGACGGCGGGG - Intergenic
1189323261 X:40098419-40098441 CTTGGGCGGCGGCGGCGGCGAGG + Intronic
1189324595 X:40105100-40105122 CAGCAGCGGCGGCGGCGGCGAGG + Intronic
1189324596 X:40105103-40105125 CAGCGGCGGCGGCGGCGAGGAGG + Intronic
1189324663 X:40105330-40105352 CTGCGGCGGCGGCGGCGGGGCGG - Intronic
1189324664 X:40105333-40105355 TGACTGCGGCGGCGGCGGCGGGG - Intronic
1189396063 X:40623877-40623899 CTACGGCGGCGGCGGCGCCGAGG + Intergenic
1189534511 X:41923171-41923193 CCGCCCCGGCGCGGGCGGCGGGG + Intronic
1189821479 X:44873366-44873388 AGGCGGCGGCGGCGGCGGCAGGG - Intronic
1190008062 X:46758964-46758986 CAGCCGCGGCGGCGGCGCCCCGG + Exonic
1190024627 X:46912446-46912468 CGGCGGCGGCTGAGGCGGCGCGG - Exonic
1190114894 X:47619939-47619961 CGGCTGGGCCGGCGGCGGCGCGG + Intergenic
1190712929 X:53082575-53082597 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1191786170 X:64919119-64919141 CGGCAGCGGCTGCAGCGGCCAGG + Exonic
1192034375 X:67546547-67546569 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1192034376 X:67546550-67546572 CGGCGGCGGCGGCGGCGAGGCGG + Exonic
1192211134 X:69128757-69128779 CGGTGGTGGCGGCGGCGGCGGGG + Intergenic
1192361761 X:70445135-70445157 TGGCGGCGGTGGCGGCGGCGTGG + Exonic
1192363282 X:70452473-70452495 CGGCGGCGGCAGCGGCTGCGCGG + Intronic
1192657116 X:73003461-73003483 CCGCCGCAGCGGAGGCTGCGGGG + Intergenic
1192665004 X:73079540-73079562 CCGCCGCAGCGGAGGCTGCGGGG - Intergenic
1195923184 X:110002676-110002698 GCGCCGCGGCGGCGGCCGCCAGG + Intronic
1195954792 X:110317828-110317850 GGGCTGCGGCGGCGGCGGCGGGG - Exonic
1196707339 X:118727683-118727705 CTGCGCCGGCGGCGGGGGCGGGG + Exonic
1196707344 X:118727689-118727711 CGGCGGCGGGGGCGGGGGCGGGG + Exonic
1196791592 X:119469129-119469151 CGGCAGCGGCCGCGGCTGCGCGG - Intronic
1196808028 X:119605916-119605938 CGGCAGCGGCGGCGGCGGGAGGG + Intergenic
1197415263 X:126165963-126165985 CGGCGGCGGCGGCGGCGGCCCGG + Intergenic
1198388137 X:136147716-136147738 CCCGAGCGGCGGCGGCGGCGGGG - Intronic
1198533581 X:137566823-137566845 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
1198683328 X:139204245-139204267 CGGCGGCGGCGGCAGCGGTGGGG - Intronic
1198767096 X:140091345-140091367 CGGCGGCGGCGGCGGCGGCTGGG + Intergenic
1198767097 X:140091348-140091370 CGGCGGCGGCGGCGGCTGGGAGG + Intergenic
1198767126 X:140091427-140091449 CGGCGGCGCCGGCGGCTGCGGGG + Intergenic
1199445121 X:147912093-147912115 CGGCGGCGGCGGCGGCGGCTGGG + Exonic
1199500383 X:148500722-148500744 CAGCGGCGGCGGGGGCGGCCGGG - Exonic
1199500387 X:148500731-148500753 CGGCGGCGGCAGCGGCGGCGGGG - Exonic
1199772493 X:150983724-150983746 CAGCTGCGGCTGCGGCGGCTGGG + Intronic
1199772833 X:150984712-150984734 CCGCAGCGGCGGCCCGGGCGGGG - Intronic
1200000273 X:153056551-153056573 CGGCGGCGGCGGCGGCGGACGGG - Intronic
1200003192 X:153072525-153072547 GCGCCGCTGCGGCGGCGGCGGGG - Exonic
1200004531 X:153077484-153077506 GCGCCGCTGCGGCGGCGGCGGGG + Intergenic
1200100661 X:153688028-153688050 TGGCGGCGGCGGCGGCGGCTCGG - Intronic
1200126814 X:153819104-153819126 GCGCCGCGACGGCGGCGGGGTGG + Intronic
1200128465 X:153829205-153829227 CCGGGGCGGGGGCGGGGGCGGGG - Intronic
1200128762 X:153830207-153830229 CCGGCGCTGCGGCGGGGGCGCGG - Intronic
1200138502 X:153886158-153886180 CGGCAGCAGCGGCTGTGGCGGGG + Intronic
1200138503 X:153886161-153886183 CAGCAGCGGCTGTGGCGGGGCGG + Intronic
1200155289 X:153971842-153971864 CGGCAGCGGCGCCGGCGGTCGGG + Intergenic
1200173802 X:154097803-154097825 TCGCAGCGGCGCCGAGGGCGGGG - Intergenic
1200238097 X:154478834-154478856 CCACAGCTGCCGCGGGGGCGTGG - Exonic
1201232642 Y:11879764-11879786 CAGCAGCTGCGGAGGCTGCGTGG - Intergenic