ID: 1125508802

View in Genome Browser
Species Human (GRCh38)
Location 15:40282073-40282095
Sequence CGGCCACGGGACCTGTGTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125508802_1125508814 25 Left 1125508802 15:40282073-40282095 CCTGCACACAGGTCCCGTGGCCG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1125508814 15:40282121-40282143 TGAGCCCCGCACGGTTGGTGCGG 0: 1
1: 0
2: 0
3: 0
4: 49
1125508802_1125508812 16 Left 1125508802 15:40282073-40282095 CCTGCACACAGGTCCCGTGGCCG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1125508812 15:40282112-40282134 GCAGCGCGGTGAGCCCCGCACGG 0: 1
1: 0
2: 3
3: 12
4: 119
1125508802_1125508810 2 Left 1125508802 15:40282073-40282095 CCTGCACACAGGTCCCGTGGCCG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1125508810 15:40282098-40282120 GGCGGCGGCCAGTTGCAGCGCGG 0: 1
1: 0
2: 0
3: 14
4: 106
1125508802_1125508813 20 Left 1125508802 15:40282073-40282095 CCTGCACACAGGTCCCGTGGCCG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1125508813 15:40282116-40282138 CGCGGTGAGCCCCGCACGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125508802 Original CRISPR CGGCCACGGGACCTGTGTGC AGG (reversed) Exonic
901034605 1:6328857-6328879 GGCCCTCGGGGCCTGTGTGCTGG + Intronic
901544145 1:9943150-9943172 CCGCCGCGGGACCTACGTGCCGG - Intronic
902747855 1:18485065-18485087 CCTCCAAGGGACCTGTGGGCTGG + Exonic
903854916 1:26331405-26331427 TGGACACAGAACCTGTGTGCTGG - Intronic
908511180 1:64850987-64851009 GGGCCGTGGGACCGGTGTGCGGG + Intronic
914204796 1:145517681-145517703 TGACCACGGGACCTGTGGGGTGG - Intergenic
914483918 1:148090866-148090888 TGACCACGGGACCTGTGGGGTGG - Intergenic
914900794 1:151710083-151710105 AGGCCCCGGGTCCTATGTGCAGG - Intronic
915909949 1:159908727-159908749 CAGCCACTGGACCTGGGTGCTGG + Intergenic
916588136 1:166166044-166166066 CCGCCACGAGACCTGGGTGGTGG - Exonic
920390987 1:205601243-205601265 CGTCCATGGTACCTGTGTGGTGG + Exonic
921821401 1:219621188-219621210 CATCCCCAGGACCTGTGTGCTGG - Intergenic
921936969 1:220804485-220804507 CAGCCAGGGGAGCTGTGGGCTGG - Intronic
922573367 1:226646566-226646588 CAGTCACTGGGCCTGTGTGCAGG - Intronic
923149524 1:231220815-231220837 AGGCCTAGGGACCTGTGGGCCGG + Intronic
1062902441 10:1156359-1156381 GGGACACGGGACCTGGGTGGGGG - Intergenic
1065749577 10:28873673-28873695 AGGCCACAGGACCTTTGTCCTGG - Intronic
1066180627 10:32958035-32958057 CCGCGCCGGGACCTTTGTGCCGG - Intronic
1066653483 10:37680341-37680363 CGGGGGCGGGACCTGTGGGCGGG + Intergenic
1067052868 10:43033982-43034004 AGGGCACAGGACATGTGTGCAGG - Intergenic
1070595811 10:77832406-77832428 CGGCCCTGGGGCCTGTCTGCTGG - Intronic
1075747878 10:124740785-124740807 TGGCCAGGGGACTTGGGTGCTGG - Intronic
1076737124 10:132463901-132463923 CTGCCCTGGGACCTGGGTGCTGG - Intergenic
1081713679 11:45233917-45233939 GGGCCACGGGGCCTCTGTGAGGG - Intronic
1084546576 11:69817924-69817946 GGGCCGCGGGTCCTGCGTGCGGG + Intronic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1090660055 11:128875726-128875748 AGGCCACAGGGCCTGTGTGGAGG - Intergenic
1091453428 12:587668-587690 CTGCCCCGGGGCCTCTGTGCAGG + Intronic
1103445790 12:120994348-120994370 AGGCCAGGGGAGCTGTGAGCGGG - Exonic
1105213373 13:18270974-18270996 CGGCCCCCAGACCTTTGTGCAGG + Intergenic
1105605646 13:21924501-21924523 GGGCCAGGGGACCTGTCTCCAGG - Intergenic
1118262517 14:64260632-64260654 CGGCCACGCGCCCCGAGTGCGGG - Exonic
1118339061 14:64879748-64879770 CGGCCAAGGGAGCTGGGTGCGGG - Intronic
1119263640 14:73252166-73252188 AGGGCATGGGCCCTGTGTGCTGG + Intronic
1119793549 14:77376401-77376423 AGGCCAGGGGGCCTATGTGCAGG + Intronic
1122541373 14:102499510-102499532 CGGTCACGGGACCTGCGGGCTGG + Exonic
1123044610 14:105505238-105505260 CGTCCACGGGCCCAGGGTGCTGG - Intergenic
1125508802 15:40282073-40282095 CGGCCACGGGACCTGTGTGCAGG - Exonic
1131242827 15:90762451-90762473 AGACAACGGGAGCTGTGTGCAGG + Intronic
1132715598 16:1288602-1288624 CGGGCAGGTGTCCTGTGTGCCGG - Intergenic
1137369186 16:47888851-47888873 CTGCCTCAGGACCTTTGTGCTGG + Intergenic
1137701551 16:50501488-50501510 CTGCCATGAGCCCTGTGTGCAGG + Intergenic
1138503168 16:57461347-57461369 CAGCCAGGAGACCTGTGTTCTGG + Intergenic
1142148723 16:88503384-88503406 GGGCCACGGTTCCTGAGTGCAGG + Intronic
1142788574 17:2244951-2244973 CGGCAGTGGCACCTGTGTGCAGG + Intronic
1144756327 17:17682351-17682373 CGGCCCCGGGGCCTGTGCGCAGG + Intronic
1146581206 17:34040137-34040159 CGGCCACGGGACCGGCCTCCTGG + Intronic
1152882851 17:82830322-82830344 CGGCCCCGGAACCTGCCTGCCGG - Exonic
1156260925 18:35444496-35444518 CAGACACAGGAGCTGTGTGCTGG + Intronic
1160575060 18:79848588-79848610 CAGCCCCGGGACCTGTGAGACGG - Intergenic
1164098025 19:22029329-22029351 GAGCCACAGCACCTGTGTGCTGG + Intergenic
1164117950 19:22240221-22240243 GAGCCACAGCACCTGTGTGCTGG + Intergenic
1164200981 19:23018369-23018391 GAGCCACAGCACCTGTGTGCTGG + Intergenic
1165064251 19:33219833-33219855 CGGCCACGGTACCTGGATGATGG + Intronic
1165937022 19:39395557-39395579 GGGCCACAGGACCGGTGTGCTGG + Intronic
1168122044 19:54256964-54256986 GGGCCCCAGGACCTGCGTGCAGG - Exonic
1168173678 19:54607880-54607902 GGGCCTCAGGACCTGCGTGCAGG + Intronic
928676216 2:33654386-33654408 TGGCCACGGGAGCTGTGGGCTGG + Intergenic
929174335 2:38961036-38961058 CTGGCCCGGGACCTGCGTGCGGG - Intronic
929936442 2:46297422-46297444 CGGGCACCGGACCCGTGTGGCGG - Exonic
934300950 2:91775770-91775792 CGGCCCCCAGACCTTTGTGCAGG - Intergenic
934618387 2:95789517-95789539 TGGCCACGGGACCCGTGCTCTGG - Intergenic
934642506 2:96035042-96035064 TGGCCACGGGACCCGTGCTCTGG + Exonic
937988663 2:127650196-127650218 CGGCCACTGCACCTGTGGGCAGG + Intronic
942279071 2:174342729-174342751 CGGCCAAGGCGCCTGGGTGCCGG + Intergenic
948997852 2:241592857-241592879 GGGCCACGGGACGTCTGTACGGG + Intronic
949019671 2:241734285-241734307 CGGCCGAGGGACCTGGGGGCCGG - Intergenic
1176249639 20:64114364-64114386 TGTCCACGGGACGTGTGAGCAGG - Intergenic
1179975206 21:44861535-44861557 AGGCCACGGGGCCTCTGTGTTGG + Intronic
1183484522 22:38082021-38082043 TGGACACGGGGCCTGTGGGCAGG + Exonic
951717403 3:25664309-25664331 CGGCCTCAGGGCCTGTGAGCTGG - Exonic
953867057 3:46593292-46593314 CATCCTCGGTACCTGTGTGCTGG + Intronic
962310912 3:134326256-134326278 TGAGCAGGGGACCTGTGTGCTGG + Intergenic
962865151 3:139442395-139442417 AGGGCCCGGGATCTGTGTGCAGG - Intergenic
969659356 4:8517566-8517588 GAGCCACGTGGCCTGTGTGCAGG - Intergenic
969708883 4:8831492-8831514 AGGCCACTGGGCCTGTGTGGAGG - Intergenic
969867561 4:10085590-10085612 AGGCCAAGAGACTTGTGTGCAGG + Intronic
983099548 4:163608198-163608220 CTGCCAGGGGACCTGAGTGTTGG + Intronic
985589594 5:757689-757711 TGGCCCCGGGCCCTGGGTGCCGG + Intronic
985628665 5:1003823-1003845 CGGCCTCGGGGGCGGTGTGCAGG + Intergenic
986546950 5:8908044-8908066 TAGTCACGGGACCTGTGTCCAGG - Intergenic
988949169 5:36241071-36241093 CGGCCAGGGGAGCTGTTCGCAGG + Intronic
991551465 5:67841504-67841526 CTCCCAGTGGACCTGTGTGCAGG + Intergenic
992138664 5:73773219-73773241 CGACCAAGGGCCCTCTGTGCAGG + Intronic
992286099 5:75236963-75236985 CGGCCACGGGAGCTGGGGGCGGG - Intergenic
995655680 5:114423537-114423559 CTGCCCCTGGACCTGTTTGCAGG - Intronic
997200522 5:132007351-132007373 AGGCCAAGGGACCTGTGTGAGGG - Intronic
997353896 5:133249926-133249948 AGGCCAGGGGAGCTGTGAGCAGG - Intronic
1006614715 6:35318492-35318514 CGGGGACGGGACCGGTGGGCTGG + Intronic
1013974715 6:116064118-116064140 ATGTCACAGGACCTGTGTGCAGG - Intergenic
1014371730 6:120617832-120617854 CTGCCTCGGGGCCTGTGTCCTGG + Intergenic
1017485748 6:154900641-154900663 CTGCCACCGGACCTGTGAGAAGG + Intronic
1019416880 7:931948-931970 TGGCCAAGGGGCCTGAGTGCAGG + Intronic
1024085521 7:45888949-45888971 CGGCCAAGGCGCCTGCGTGCAGG + Exonic
1034514300 7:151562287-151562309 GGGCCACGGCAGCTCTGTGCCGG + Intronic
1035263630 7:157676641-157676663 CTGCCACTGGCCCTGTGGGCTGG + Intronic
1035751522 8:2000483-2000505 AGGACACTGGTCCTGTGTGCTGG - Exonic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1038612837 8:29070657-29070679 GGGCCACGGGCCCTGTGCGGCGG - Exonic
1051833937 9:21312965-21312987 GAGTCACAGGACCTGTGTGCAGG + Intergenic
1054764987 9:69035850-69035872 CGGCCGCGGGACCCGGGTGAGGG - Exonic
1055703311 9:78970532-78970554 GGGCCACGGGAGCAGTGTGGAGG - Intergenic
1061631039 9:131872323-131872345 TGGCCTCGGGGGCTGTGTGCTGG - Intronic
1062051494 9:134449594-134449616 AGGCCATGGGAGCTGTATGCAGG + Intergenic
1186378380 X:9033020-9033042 CAGCCACGGATCCTGTGGGCAGG - Exonic
1187319467 X:18226897-18226919 AGGCCACTGGAGCTGTGTCCGGG - Intergenic
1189546739 X:42049734-42049756 GGGGCACAGGTCCTGTGTGCAGG - Intergenic
1192545616 X:72010272-72010294 CGGGCAGGGGACCTGTGAACTGG + Intergenic
1198975595 X:142332657-142332679 CTGCCATGGGAGCTGTTTGCCGG - Intergenic
1200309015 X:155057943-155057965 CTGACACGGGAGCTGGGTGCGGG + Exonic