ID: 1125508845

View in Genome Browser
Species Human (GRCh38)
Location 15:40282237-40282259
Sequence CCCGCAGAGTCGGCCGCCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125508832_1125508845 17 Left 1125508832 15:40282197-40282219 CCCGTGGCCGCAGGCCGCCGCCC 0: 1
1: 0
2: 2
3: 19
4: 218
Right 1125508845 15:40282237-40282259 CCCGCAGAGTCGGCCGCCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 65
1125508830_1125508845 21 Left 1125508830 15:40282193-40282215 CCGCCCCGTGGCCGCAGGCCGCC 0: 1
1: 0
2: 1
3: 15
4: 267
Right 1125508845 15:40282237-40282259 CCCGCAGAGTCGGCCGCCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 65
1125508838_1125508845 0 Left 1125508838 15:40282214-40282236 CCGCCCACATCACCGGGCTGTTG 0: 1
1: 0
2: 2
3: 11
4: 163
Right 1125508845 15:40282237-40282259 CCCGCAGAGTCGGCCGCCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 65
1125508831_1125508845 18 Left 1125508831 15:40282196-40282218 CCCCGTGGCCGCAGGCCGCCGCC 0: 1
1: 0
2: 1
3: 15
4: 176
Right 1125508845 15:40282237-40282259 CCCGCAGAGTCGGCCGCCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 65
1125508834_1125508845 10 Left 1125508834 15:40282204-40282226 CCGCAGGCCGCCGCCCACATCAC 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1125508845 15:40282237-40282259 CCCGCAGAGTCGGCCGCCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 65
1125508839_1125508845 -3 Left 1125508839 15:40282217-40282239 CCCACATCACCGGGCTGTTGCCC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1125508845 15:40282237-40282259 CCCGCAGAGTCGGCCGCCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 65
1125508833_1125508845 16 Left 1125508833 15:40282198-40282220 CCGTGGCCGCAGGCCGCCGCCCA 0: 1
1: 1
2: 1
3: 18
4: 186
Right 1125508845 15:40282237-40282259 CCCGCAGAGTCGGCCGCCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 65
1125508840_1125508845 -4 Left 1125508840 15:40282218-40282240 CCACATCACCGGGCTGTTGCCCG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1125508845 15:40282237-40282259 CCCGCAGAGTCGGCCGCCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 65
1125508837_1125508845 3 Left 1125508837 15:40282211-40282233 CCGCCGCCCACATCACCGGGCTG 0: 1
1: 0
2: 2
3: 19
4: 174
Right 1125508845 15:40282237-40282259 CCCGCAGAGTCGGCCGCCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125508845 Original CRISPR CCCGCAGAGTCGGCCGCCTC GGG Exonic
900634003 1:3652878-3652900 CCCTCAGCGCCGGCCGCCTTTGG + Intronic
903544148 1:24113082-24113104 CCTGCCCAGTCGGCCGCCACTGG + Intergenic
907490420 1:54805746-54805768 CCCACAGAGAGGGCCGCCTTGGG - Intergenic
910646986 1:89524900-89524922 CCCGCTGAGCCCGCAGCCTCCGG + Exonic
910676544 1:89821545-89821567 CCCGCAGGGCCGGCCGCCCGGGG - Intronic
923055950 1:230426067-230426089 CCCGCCGTCTTGGCCGCCTCGGG + Intergenic
1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG + Intronic
1067344093 10:45425644-45425666 CCTGCAGACTCAGCTGCCTCCGG + Intronic
1070556495 10:77531893-77531915 CCTGCAGAGTCAGCAGCCCCAGG + Intronic
1073446582 10:103584585-103584607 GCCGCAGCGACGGCCGCCGCAGG - Exonic
1076642629 10:131929181-131929203 CCCGCAGAGTGGCCCTGCTCAGG + Intronic
1076771271 10:132666557-132666579 ACTGCAAAGTCGGCAGCCTCGGG - Intronic
1077495688 11:2885590-2885612 CACGCAGAGTCGGGCGGCGCGGG - Exonic
1082004884 11:47413985-47414007 GCTGCAGAGTAGGCTGCCTCTGG - Intronic
1083941896 11:65900341-65900363 CCCGCAGAGCCGCCAGCCCCGGG - Exonic
1090190539 11:124763496-124763518 CCCGCAGAGCGGGCAGCGTCAGG - Intergenic
1090660840 11:128880590-128880612 CCCCCAGAGTGGCCCACCTCTGG + Intergenic
1090699079 11:129278942-129278964 CCCGCAGCGCCGTCCGCCCCGGG + Intronic
1105440879 13:20414929-20414951 CCCGCGGAATCCGCCGCCCCAGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1125508845 15:40282237-40282259 CCCGCAGAGTCGGCCGCCTCGGG + Exonic
1129696173 15:77741711-77741733 CCCACAGAGCCTGCAGCCTCAGG - Intronic
1130162322 15:81414003-81414025 CCAGCAGAGGCAGCCGGCTCCGG - Intergenic
1132214518 15:100052941-100052963 CCGGCAGAGCCAGCCTCCTCAGG + Intronic
1132314444 15:100879865-100879887 GCCGCAGACTAGGGCGCCTCGGG + Exonic
1136315981 16:29454970-29454992 CCCGCGGGGTCCGCCTCCTCTGG - Intronic
1136430558 16:30194312-30194334 CCCGCGGGGTCCGCCTCCTCTGG - Intronic
1143544705 17:7589230-7589252 CCCCCAGAGCGGGCCGCCGCTGG + Exonic
1147486428 17:40819137-40819159 GCCGCCGCGTCCGCCGCCTCCGG + Exonic
1148151076 17:45396695-45396717 ACTGCAGTGTGGGCCGCCTCTGG + Exonic
1151678101 17:75610238-75610260 CCTGCAGTCTCTGCCGCCTCTGG - Intergenic
1152614522 17:81331632-81331654 CCAGCTGGGTCGGCCGCCCCCGG + Intergenic
1161397871 19:4054349-4054371 CCCGGAGAGTCGCCCGGCTCGGG + Exonic
1165061445 19:33207064-33207086 GCCGCCGCCTCGGCCGCCTCTGG + Exonic
1165886751 19:39084269-39084291 CCGGAAGAGCCGGTCGCCTCGGG - Intronic
1167112574 19:47470941-47470963 CCCGCAGAGTGGGCTCCCCCAGG - Intronic
928155161 2:28869995-28870017 CCCGCAGCGTCGGCAGTCTGAGG + Exonic
932728378 2:74199082-74199104 CCGACAGCGCCGGCCGCCTCTGG + Intronic
948570114 2:238912562-238912584 CCCGGAGAGGCGGCCGCCGCAGG - Intergenic
1171846678 20:30281609-30281631 GCCGCGGAGTCGGCTGCATCCGG - Intergenic
1172628356 20:36361612-36361634 CCCCCAGAGTCGCCCCCGTCCGG - Intronic
1175869869 20:62203800-62203822 ACTGCGGTGTCGGCCGCCTCAGG - Intergenic
1176547494 21:8208128-8208150 CCCGCAGAGGCGGCGGCTCCGGG - Intergenic
1176566445 21:8391175-8391197 CCCGCAGAGGCGGCGGCTCCGGG - Intergenic
1177736183 21:25092805-25092827 GCAGCAGAGTCGGCTGCCTCAGG + Intergenic
1178361072 21:31948894-31948916 CCAGAAGAGTCGGCCCCTTCTGG - Intronic
1179209231 21:39312554-39312576 CCCGCAGAGGCGGCCGCACCTGG + Intronic
1183218319 22:36495668-36495690 CCACCACAGTCAGCCGCCTCTGG + Intronic
1184756151 22:46517037-46517059 CCCCCAGAGTCACCAGCCTCAGG - Intronic
1185333519 22:50261807-50261829 CCCCCGGCGGCGGCCGCCTCGGG - Exonic
961458180 3:127034456-127034478 CCCTCAGACTCTGCCGCCTGGGG - Exonic
961666639 3:128497027-128497049 CCCGCCTCATCGGCCGCCTCCGG - Intergenic
962859825 3:139389427-139389449 CCCGCTGCGGCCGCCGCCTCAGG - Intronic
968428086 4:536146-536168 CCCGCAGACTCGGCGGGCCCGGG + Intronic
970609122 4:17709251-17709273 CCCGCAGGGCCGGCTGCCCCAGG - Exonic
984952151 4:185016045-185016067 GCCCCAGAGTGGGGCGCCTCAGG - Intergenic
985733898 5:1566258-1566280 CCCACAGTGTGGGCCGCCCCTGG - Intergenic
993905796 5:93621498-93621520 CCCGGAGAGGCGGAGGCCTCGGG - Intronic
1002940486 6:1711248-1711270 GCCTCAGAGCCGGCTGCCTCAGG + Intronic
1006116075 6:31776840-31776862 CCCGCAGAGCCGGCCTGCCCTGG - Intronic
1011643057 6:89433159-89433181 CCCGCCGCGTCCGCCGCCGCAGG - Intronic
1019146688 6:169980040-169980062 CCTGCAGAGCCTGCCACCTCCGG - Intergenic
1023064816 7:36366954-36366976 CCCGCGGAGCCCGCCGCCCCGGG - Intronic
1024209983 7:47194785-47194807 CCCTCTGAGTCTGCAGCCTCTGG - Intergenic
1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG + Intergenic
1058835466 9:108855659-108855681 TCGCCAGCGTCGGCCGCCTCGGG + Exonic
1061298381 9:129689700-129689722 CCCGGAGAGTCGGACTCCACAGG - Intronic
1061765240 9:132877691-132877713 TCCTCAGAGAGGGCCGCCTCTGG - Intronic
1189622314 X:42855198-42855220 CCCTCAGGGTTGGCCTCCTCTGG - Intergenic
1195803302 X:108735941-108735963 GCAGCAGCGGCGGCCGCCTCTGG - Exonic