ID: 1125510630

View in Genome Browser
Species Human (GRCh38)
Location 15:40290760-40290782
Sequence CTTCTCCGACGTCTCCTTCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125510623_1125510630 20 Left 1125510623 15:40290717-40290739 CCTTGCTGGGAGGCGAAGCAGGT 0: 1
1: 0
2: 0
3: 21
4: 136
Right 1125510630 15:40290760-40290782 CTTCTCCGACGTCTCCTTCAGGG 0: 1
1: 0
2: 1
3: 6
4: 111
1125510621_1125510630 21 Left 1125510621 15:40290716-40290738 CCCTTGCTGGGAGGCGAAGCAGG 0: 1
1: 0
2: 2
3: 16
4: 161
Right 1125510630 15:40290760-40290782 CTTCTCCGACGTCTCCTTCAGGG 0: 1
1: 0
2: 1
3: 6
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125510630 Original CRISPR CTTCTCCGACGTCTCCTTCA GGG Exonic
900096308 1:941521-941543 CTTCTCTGGCTTCTCCTCCAGGG - Intronic
907246974 1:53114808-53114830 CTGCTCCGTGGTCTCCTTCTGGG + Exonic
912467860 1:109886385-109886407 CTTTACTGACATCTCCTTCAGGG - Intergenic
912859152 1:113197741-113197763 CTTCTCCAGCATCTTCTTCATGG - Intergenic
914685500 1:149975172-149975194 CTGCTCCTACTTGTCCTTCAGGG + Intronic
919300546 1:195757845-195757867 CTTCTGCTACTTGTCCTTCAAGG - Intergenic
1064691877 10:17926950-17926972 CTTCTCCCAGGTTTCCTTGAAGG - Intergenic
1066161152 10:32730360-32730382 CTTCTCCTATTTCTCCTACATGG + Intronic
1071015764 10:80996066-80996088 TTTCTCTGATGTCTCCTTGATGG + Intergenic
1071824671 10:89312922-89312944 CTCCTCCCATGTCTCCTTCTTGG - Intronic
1072275068 10:93814849-93814871 CTTCTCCCAATTCTGCTTCATGG - Intergenic
1076033263 10:127176999-127177021 CCTCGACGACTTCTCCTTCACGG - Exonic
1076834851 10:133015902-133015924 CTTCCCCGACGCCTCCTTCCAGG - Intergenic
1078072916 11:8130168-8130190 CATCCCCTACCTCTCCTTCAAGG + Intronic
1082028832 11:47590673-47590695 CATCTCCGACGTGCCCTCCAGGG + Exonic
1084432515 11:69119315-69119337 CTTCTAGGAAGTCTCCTTCCAGG + Intergenic
1096108759 12:49016042-49016064 CTTCTCCGACTTCTGCCTCCCGG + Intronic
1096860370 12:54522788-54522810 CTAGTCAGACATCTCCTTCAGGG - Intronic
1097359909 12:58647230-58647252 CTTCTGTGCCGTGTCCTTCAGGG - Intronic
1106285096 13:28311639-28311661 CTTCTCTGAGGACTTCTTCAAGG - Exonic
1108394820 13:49981905-49981927 CTGCTCAGATGTCACCTTCACGG - Intergenic
1116548608 14:46205234-46205256 CTTCTCCTATGTTTCCTTCTAGG - Intergenic
1120868358 14:89315518-89315540 CTTCCCCGAACTCTCCTCCATGG + Intronic
1121887641 14:97559272-97559294 CTTCTTCCCTGTCTCCTTCATGG - Intergenic
1122950874 14:105043910-105043932 CCTCTCCAACGTCTCTTTCTTGG - Intergenic
1125143057 15:36432513-36432535 CTGCTCTGACCTCTCCTTGAGGG - Intergenic
1125510630 15:40290760-40290782 CTTCTCCGACGTCTCCTTCAGGG + Exonic
1128334550 15:66777712-66777734 CCTCTCTGACCTCTCCTTCCTGG - Intronic
1131154626 15:90067361-90067383 CTCCTCCGCCGGCTCCTCCAAGG - Exonic
1131663921 15:94549299-94549321 CTTTTCTGACATCTACTTCATGG + Intergenic
1132878050 16:2148957-2148979 CTTCTACGACGTCGCCTTCAAGG + Exonic
1137915005 16:52420513-52420535 CTTCTCAGATCTCACCTTCAAGG - Intergenic
1143503332 17:7351317-7351339 CTTCCGCGACTTCTCCCTCATGG + Exonic
1144268988 17:13600366-13600388 CCTCTCCGCCTTCTCCTTCCTGG - Intronic
1144385591 17:14746468-14746490 TTTCCCCGACATCTTCTTCAGGG + Intergenic
1148203507 17:45765551-45765573 CTTCTCCCAAGTCTTCCTCATGG + Intergenic
1148802631 17:50241099-50241121 CTTCTCCTCCTTCTCCTTCTTGG + Intergenic
1149024866 17:52016032-52016054 CTTCTCCAATGTCTACTCCAAGG - Intronic
1149355615 17:55836136-55836158 ATTCTCCTACTTCTCCTTCAGGG - Intronic
1153631301 18:7072889-7072911 CTTCTCCCATGTCTACTTCCGGG + Intronic
1155239057 18:23847957-23847979 CTTCTCCCACTTCTGCCTCATGG - Intronic
1156638813 18:39064748-39064770 CCTCTCCTAGGTATCCTTCAAGG - Intergenic
1159034947 18:63267768-63267790 CTTCTCCAAAGTCTCCTTTGTGG - Intronic
1160512864 18:79462146-79462168 CTGCTCCCACATCTCCTGCACGG + Intronic
1161310279 19:3590045-3590067 CTTCTTGGACGTCTCCACCATGG - Exonic
1162302955 19:9854572-9854594 CTTCTCCGACATGGACTTCATGG - Exonic
1166997670 19:46727532-46727554 CTCCTCAGACGTCTTCATCATGG - Exonic
929956960 2:46465392-46465414 TTTCTCCGAGGTCACCTTAAGGG + Intronic
930427123 2:51226442-51226464 CTTCTAAGACATCTACTTCATGG - Intergenic
932651109 2:73558057-73558079 CTTCTCAGAAGTATCCTTAAAGG - Intronic
933780473 2:85797204-85797226 CTTCTCCGGCTGCTCCTTCCAGG + Intergenic
939786223 2:146516599-146516621 CTTCATTGACGTCACCTTCATGG - Intergenic
939866800 2:147482009-147482031 CTTCTCTGACTGCTCCTTCATGG - Intergenic
942849884 2:180472011-180472033 CTTCTCTGACTTCTCCCTCTTGG + Intergenic
944484916 2:200195328-200195350 CTTCACAGATGTCTCCTCCATGG - Intergenic
947726348 2:232403269-232403291 CTTCTCCAGGGCCTCCTTCAAGG + Intergenic
1174423021 20:50412618-50412640 CTTCACAAACGTCTCCTTGAAGG - Intergenic
1177139871 21:17346168-17346190 CTTATCTGACGTTTCTTTCATGG + Intergenic
1178032922 21:28548377-28548399 TTTCTCAGACTTCTCCTTGATGG - Intergenic
1181308960 22:21933438-21933460 CTTCTCTGAGGGCTCCCTCAGGG + Exonic
1183674879 22:39293607-39293629 CTTCTCCCTCGCTTCCTTCAGGG + Intergenic
1185043024 22:48515425-48515447 CTTCTCCTGGGTCACCTTCACGG + Intronic
950069625 3:10141919-10141941 CCTCCCCGCCGTCTTCTTCAGGG - Exonic
950425545 3:12923083-12923105 CTGCTCCGAAGTCACCTCCAAGG - Intronic
952716357 3:36484462-36484484 TTTTTCTGACCTCTCCTTCATGG - Intronic
953814424 3:46142798-46142820 CTTCTCTGAGGACTTCTTCAAGG - Intergenic
955516343 3:59730056-59730078 CTTCTCCTACGTCGTTTTCAAGG + Intergenic
959291561 3:104481109-104481131 CTCCTCAGACATCTCCATCAAGG - Intergenic
959329627 3:104987043-104987065 CTTCTCTGTCCACTCCTTCAGGG - Intergenic
962315674 3:134358138-134358160 CTTCTCAGATTTCTCCTTCCCGG + Intronic
963457389 3:145562212-145562234 CTTCTCCAATGTTTCCTTCTTGG + Intergenic
969427348 4:7133014-7133036 CTTCTCATACTTATCCTTCAAGG + Intergenic
970551373 4:17185206-17185228 CTTCTCTGACATCTACTCCAGGG + Intergenic
975683651 4:76898641-76898663 CTTCTCCGGCGCCCCCTCCAAGG + Intergenic
976326363 4:83776226-83776248 CATCTCCAGCGTCTCCTTCACGG - Intergenic
977644076 4:99391648-99391670 TTTCTCCTACGTTTCCTTCTAGG - Intergenic
982463258 4:155697819-155697841 CTTCCCAGAAGTTTCCTTCAAGG - Intronic
989476947 5:41884688-41884710 CTTCTGGGACGTCCCCTTCTGGG + Intergenic
992551673 5:77865754-77865776 CTTTTCCTTCGTCTCCTTCTAGG + Intronic
997064787 5:130547810-130547832 CTTTTCCCTTGTCTCCTTCAAGG + Intergenic
997470451 5:134114522-134114544 CTTGTCCGACGTCTCTCTCAGGG + Intergenic
999720391 5:154395022-154395044 CTTCTCCCACCACTCCTCCAAGG + Intronic
999865534 5:155696602-155696624 CTTCTCCCAAGTCTTCTGCAAGG + Intergenic
1002894362 6:1367686-1367708 CCTCACCGAGGTCTCCTTAAAGG + Intergenic
1004146397 6:13071061-13071083 CTTCACCCAACTCTCCTTCAGGG - Intronic
1005804511 6:29461949-29461971 CCTCTCTGACCTCTCCTTCTTGG + Exonic
1005818109 6:29574081-29574103 CCTCTCCAACCTCTCCTTCTTGG + Intronic
1005819167 6:29582878-29582900 CTTCTCCTTCCTCTTCTTCAGGG - Intronic
1005819744 6:29588124-29588146 CCTCTCCAACCTCTCCTTCTTGG + Exonic
1007728396 6:43930850-43930872 CCCCTCCCATGTCTCCTTCAGGG - Intergenic
1008511468 6:52279510-52279532 CTTCTCCGGCATCTCCTGGATGG + Exonic
1011011657 6:82710339-82710361 CTTGTCAGACCTCTCCTTGATGG + Intergenic
1011974214 6:93273652-93273674 CTTCAGCTACATCTCCTTCAAGG - Intronic
1018172695 6:161154338-161154360 TGGCTCTGACGTCTCCTTCATGG - Intronic
1019055774 6:169222271-169222293 CTACTCCGGCGTGTCCCTCAAGG - Exonic
1019175789 6:170158857-170158879 CTGCACCGACGTCTGCTTCTAGG - Intergenic
1023758835 7:43444941-43444963 CTTCTCCGAGGAGTCCTTGAGGG - Exonic
1023987987 7:45109058-45109080 CTTCTCCACCGGCTCCATCAAGG + Exonic
1026739332 7:72969083-72969105 CCACTCCGAGGGCTCCTTCAAGG + Intronic
1026787591 7:73311680-73311702 CCTCTCCTCAGTCTCCTTCAAGG - Intergenic
1026790357 7:73327698-73327720 CCACTCCGAGGGCTCCTTCAAGG + Intronic
1027104399 7:75395990-75396012 CCACTCCGAGGGCTCCTTCAAGG - Intronic
1027821300 7:83048637-83048659 CTACTCAGCCGTCTTCTTCAGGG - Intronic
1031751930 7:125585905-125585927 CTGCTCTTACTTCTCCTTCAGGG + Intergenic
1033423221 7:141220782-141220804 GTTCTCCCAGTTCTCCTTCATGG - Intronic
1038437076 8:27543762-27543784 CTTCTCCGCCGTGACCATCAGGG - Exonic
1042524459 8:69749878-69749900 AATCTCTGACCTCTCCTTCAAGG - Intronic
1046139919 8:110078104-110078126 CTTTGCTGACTTCTCCTTCAGGG + Intergenic
1049664573 8:143837277-143837299 GTACTCGGAAGTCTCCTTCATGG - Exonic
1050411658 9:5372701-5372723 CACCTCCCAAGTCTCCTTCAGGG + Intronic
1054969786 9:71071912-71071934 CTTCTGTGATGTCTCCTTGAAGG - Intronic
1056912833 9:90718894-90718916 CTTCGCCCATGTCTCCTACAGGG - Intergenic
1057854441 9:98591717-98591739 CATCTCAGTAGTCTCCTTCATGG + Intronic
1060421987 9:123475861-123475883 CTTCTTATACGCCTCCTTCAGGG + Intronic
1062377766 9:136271105-136271127 TTTCTCTCACCTCTCCTTCAGGG - Intergenic
1186666245 X:11720433-11720455 CTCCTCTGACATCTCCCTCATGG + Intergenic
1189363904 X:40373609-40373631 CTCCCCCCACGTCTCCTTCAAGG - Intergenic
1198111541 X:133506634-133506656 CTTCTTCTTAGTCTCCTTCATGG - Intergenic
1200800420 Y:7381830-7381852 CTTCAGCGATGACTCCTTCAGGG + Intergenic