ID: 1125511840

View in Genome Browser
Species Human (GRCh38)
Location 15:40296408-40296430
Sequence GAGGGCAAAGAAGAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2546
Summary {0: 1, 1: 0, 2: 29, 3: 266, 4: 2250}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125511828_1125511840 8 Left 1125511828 15:40296377-40296399 CCAGGCCCGCTGTGCCCTAAGGA 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG 0: 1
1: 0
2: 29
3: 266
4: 2250
1125511824_1125511840 26 Left 1125511824 15:40296359-40296381 CCTCATAAGCCGTCACTTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG 0: 1
1: 0
2: 29
3: 266
4: 2250
1125511836_1125511840 -6 Left 1125511836 15:40296391-40296413 CCCTAAGGAGAAGAGGGGAGGGC 0: 1
1: 0
2: 0
3: 29
4: 263
Right 1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG 0: 1
1: 0
2: 29
3: 266
4: 2250
1125511837_1125511840 -7 Left 1125511837 15:40296392-40296414 CCTAAGGAGAAGAGGGGAGGGCA 0: 1
1: 0
2: 2
3: 57
4: 420
Right 1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG 0: 1
1: 0
2: 29
3: 266
4: 2250
1125511829_1125511840 3 Left 1125511829 15:40296382-40296404 CCCGCTGTGCCCTAAGGAGAAGA 0: 1
1: 0
2: 3
3: 17
4: 179
Right 1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG 0: 1
1: 0
2: 29
3: 266
4: 2250
1125511830_1125511840 2 Left 1125511830 15:40296383-40296405 CCGCTGTGCCCTAAGGAGAAGAG 0: 1
1: 0
2: 0
3: 26
4: 221
Right 1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG 0: 1
1: 0
2: 29
3: 266
4: 2250
1125511826_1125511840 17 Left 1125511826 15:40296368-40296390 CCGTCACTTCCAGGCCCGCTGTG 0: 1
1: 0
2: 1
3: 13
4: 227
Right 1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG 0: 1
1: 0
2: 29
3: 266
4: 2250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125511840 Original CRISPR GAGGGCAAAGAAGAGGAGGA TGG Intronic
Too many off-targets to display for this crispr