ID: 1125512673

View in Genome Browser
Species Human (GRCh38)
Location 15:40301255-40301277
Sequence TACTCCATGGGGTATAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125512666_1125512673 -1 Left 1125512666 15:40301233-40301255 CCAAATTCTTACCAGGAGAAAAT 0: 1
1: 0
2: 1
3: 31
4: 314
Right 1125512673 15:40301255-40301277 TACTCCATGGGGTATAGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125512673 Original CRISPR TACTCCATGGGGTATAGGCT GGG Intronic
905226260 1:36481186-36481208 TACTGCACGGGGCATAGGCTGGG - Intronic
907282338 1:53359378-53359400 TATTAGCTGGGGTATAGGCTGGG + Intergenic
907368658 1:53982925-53982947 TTATCCATGGGGTATTGGATAGG + Intergenic
907800430 1:57759705-57759727 TACTCTTTGGGGAATAGACTAGG + Intronic
909122880 1:71626559-71626581 TATTCCATGCTGTATAGGCATGG + Intronic
911368963 1:96973763-96973785 TGCACCATGGGGAATTGGCTTGG + Intergenic
911935316 1:103961773-103961795 TACTCCATGGGGTTTCCGCAAGG - Intergenic
923639379 1:235738513-235738535 TACCCAATGGGGGAAAGGCTGGG + Intronic
1065263568 10:23951895-23951917 TTTTCTATGTGGTATAGGCTGGG + Intronic
1066236493 10:33490069-33490091 TTTTCCAGGGGGTATAGCCTTGG - Intergenic
1072378405 10:94840421-94840443 GACTCCCTGGGTTATAGCCTAGG + Intronic
1073687206 10:105768364-105768386 TCATCCATGGAATATAGGCTGGG - Intergenic
1078710862 11:13789621-13789643 CACTCCATGGGGTATGGGGGAGG + Intergenic
1089300347 11:117495106-117495128 AGCTCCATGGGGCAGAGGCTTGG - Intronic
1090468837 11:126960103-126960125 AAGTCCATGGGGTATAGGGAAGG + Intronic
1092021057 12:5202557-5202579 TGCTCCATGTGGCATTGGCTGGG + Intergenic
1093971562 12:25381010-25381032 TAATCCATGGGGTATATTGTAGG + Intergenic
1096514791 12:52149812-52149834 TCCTCCATGAGGTGGAGGCTTGG - Intergenic
1102082856 12:110112456-110112478 TGCTCCATGTGGTATCTGCTGGG - Intergenic
1109931459 13:69222989-69223011 GACTCCCTGGGTTATAGCCTAGG - Intergenic
1110551497 13:76815595-76815617 TACTCCTTGTGGTACATGCTAGG + Intergenic
1110670766 13:78174453-78174475 TATTCCATGTGGTATTGGCTAGG - Intergenic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1125512673 15:40301255-40301277 TACTCCATGGGGTATAGGCTGGG + Intronic
1127124114 15:55795514-55795536 TACTCCAAGGGATATAGACAAGG - Intergenic
1128645928 15:69379052-69379074 TACACCATGGGGCAGAGGCTGGG - Intronic
1131476416 15:92744018-92744040 TGCTCCATGTGGCATTGGCTGGG + Intronic
1133504984 16:6403028-6403050 TAATTCATGGGTTAGAGGCTTGG + Intronic
1141952509 16:87348069-87348091 TACCCCATGGGGTGAAGGCCTGG - Intronic
1146210421 17:30938196-30938218 TACTCCATGTGGCATCAGCTGGG + Intronic
1151421903 17:74004206-74004228 TAATCCATGAGGGAGAGGCTGGG + Intergenic
1153066391 18:1050405-1050427 CCATCCATGGGGTATAGGCCAGG - Intergenic
1155759458 18:29548020-29548042 TTCTCCCGGGGGTATAGACTGGG - Intergenic
1161943427 19:7419651-7419673 TCCTCCGTGAGGTTTAGGCTAGG - Intronic
925704420 2:6670232-6670254 TGCTCCATGTGCTATAGGCAGGG + Intergenic
926624979 2:15083449-15083471 TATTCCATGTGGAATAGACTAGG - Intergenic
926864144 2:17340266-17340288 GACTCCTTGGGTTATAGCCTAGG - Intergenic
927225815 2:20765604-20765626 TGCTCCATGTGGTGTGGGCTGGG + Intronic
927334016 2:21899531-21899553 GCCTCCAGGAGGTATAGGCTAGG + Intergenic
932917341 2:75873030-75873052 AACTCCCTGGGTTATAGCCTAGG - Intergenic
933398145 2:81757546-81757568 TAGACCATAGGGTATAGGGTAGG + Intergenic
933855679 2:86411975-86411997 TACTCCACATGGTATAGACTGGG + Intergenic
935672429 2:105567247-105567269 CACCCCATGGGGTATTTGCTTGG + Intergenic
938159611 2:128973517-128973539 TTCTACATGGTGTATAGGGTGGG + Intergenic
939428131 2:142067370-142067392 TATTCCATGTTGTACAGGCTAGG + Intronic
939711724 2:145529568-145529590 TGATCCATGGGGTATAGAGTAGG + Intergenic
943516087 2:188888958-188888980 TATTCCATAGGGTCTTGGCTAGG - Intergenic
946161037 2:217836198-217836220 TCCTCCCAGGGGTACAGGCTCGG - Exonic
947196531 2:227573577-227573599 GGCTCCATGGAATATAGGCTGGG + Intergenic
1172320173 20:33990348-33990370 TGCTCCATGTGGTGTTGGCTGGG - Intergenic
1175151693 20:56940118-56940140 CACTCCATAGAGAATAGGCTGGG - Intergenic
1177902603 21:26934889-26934911 GACTCCATGGGGACAAGGCTGGG + Intronic
1179259443 21:39745310-39745332 GACTCCCTGGGCTATAGCCTAGG + Intergenic
1183241062 22:36658778-36658800 TGCTCCAGGGGGAATAGGCGGGG + Intronic
1183317562 22:37145303-37145325 TCCTCCCTGGGGTATAATCTGGG - Intronic
1183744500 22:39685230-39685252 TACTCCATGGTGGACAGGCAGGG + Intronic
951201018 3:19875532-19875554 GACTCCCTGGGTTATAGCCTAGG + Intergenic
951650701 3:24948586-24948608 TTCTCCATGGGGAATAGGTAGGG - Intergenic
951791583 3:26491497-26491519 TGCTCCATGTGATATATGCTGGG + Intergenic
952743012 3:36752228-36752250 CCCACCATGGGGTAAAGGCTGGG - Intergenic
955537882 3:59943457-59943479 TACTCCATGCAGGAAAGGCTGGG - Intronic
962355686 3:134692466-134692488 TATTCCATGGTGTATAGGGAAGG + Intronic
963631858 3:147742864-147742886 TTCTCCAAGGGGTATCTGCTAGG - Intergenic
968480908 4:832669-832691 TCCTCCATGGGGTCCTGGCTGGG - Intergenic
976416955 4:84787674-84787696 TACTCCAGGGGGTTCAGGTTCGG - Exonic
978901460 4:113955048-113955070 TCATCCATCTGGTATAGGCTTGG - Intronic
980276354 4:130656003-130656025 TAATCCTTTGGGTATATGCTGGG - Intergenic
982793948 4:159623581-159623603 TATTCGATGGGGGATAGGCTGGG + Intergenic
988866299 5:35338846-35338868 TCCTCCATGGGGTGCAGACTTGG + Intergenic
989688162 5:44112441-44112463 GACTCCCTGGGTTATAGCCTAGG - Intergenic
991208118 5:64073385-64073407 TATTACATGGGGTAAAGTCTGGG + Intergenic
995465328 5:112445028-112445050 AACTCCCTGGGTTATAGCCTGGG - Intergenic
997456985 5:134024986-134025008 TGCTCCATGTGGTGTTGGCTGGG - Intergenic
998712912 5:144847553-144847575 TATTCCATGGTGTATATGTTGGG + Intergenic
1006051855 6:31351512-31351534 TCCACCATGGGGTAGAGGCCAGG - Intronic
1006887200 6:37391944-37391966 AAATACATGGGGTATAGGCTGGG - Exonic
1007488575 6:42199771-42199793 TGCTCCATGTGGTATTAGCTGGG - Intergenic
1009544482 6:65006060-65006082 GACTCCCTGGGTTATAGCCTAGG - Intronic
1009795930 6:68467467-68467489 AACTCCATGGGGTTGAAGCTTGG + Intergenic
1010893188 6:81338325-81338347 GACTCCCTGGGTTATAGCCTAGG - Intergenic
1014229645 6:118888910-118888932 TACTGCTTGGGGGATATGCTGGG + Intronic
1014403895 6:121024644-121024666 TATTCCATGGTGTATATGTTCGG - Intergenic
1016656965 6:146529975-146529997 TACTACATGGAGGATGGGCTAGG + Intergenic
1017853071 6:158322774-158322796 GATTCCATGAGGTATAAGCTGGG - Intronic
1021317689 7:19170304-19170326 CACTCCATGGGGCATCAGCTGGG - Intergenic
1023136746 7:37060294-37060316 TATTCCATGGTGTATATGTTTGG - Intronic
1028588923 7:92476825-92476847 GACTCCCTGGGTTATAGCCTAGG + Intronic
1030843830 7:114385185-114385207 GACTCCCTGGGTTATAGCCTAGG + Intronic
1032436846 7:131907732-131907754 TTCTCCATTGGGTACAGCCTGGG - Intergenic
1032471419 7:132181898-132181920 TACTTCTTGGGGTATAGACATGG - Intronic
1037100797 8:15043028-15043050 TGCTCCATGGGTTAAAGGTTAGG - Intronic
1037686864 8:21147693-21147715 TATTCTATAGGGTATAAGCTAGG - Intergenic
1044544386 8:93443633-93443655 TATTGCCTGGGGTAGAGGCTGGG + Intergenic
1048183559 8:132218122-132218144 TTCTCCGTGGGGTACAGGCAAGG - Intronic
1049744141 8:144256038-144256060 GAGTCTTTGGGGTATAGGCTGGG + Intronic
1056217243 9:84416663-84416685 CACTCTGTGGGGTGTAGGCTGGG + Intergenic
1198021882 X:132666892-132666914 TACACCATGGGGAAAAGCCTTGG + Intronic
1201304033 Y:12535477-12535499 AATTCCATGAGGTATAGTCTGGG + Intergenic