ID: 1125512830

View in Genome Browser
Species Human (GRCh38)
Location 15:40302099-40302121
Sequence AGCCCCTGGAAGCCTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 547
Summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 490}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125512819_1125512830 22 Left 1125512819 15:40302054-40302076 CCAGGTACAGAGAGGAGTCAGGC 0: 1
1: 0
2: 0
3: 29
4: 263
Right 1125512830 15:40302099-40302121 AGCCCCTGGAAGCCTGGGGAGGG 0: 1
1: 0
2: 2
3: 54
4: 490
1125512823_1125512830 0 Left 1125512823 15:40302076-40302098 CCTGAGAAAGAAAGGCTTTGGGG 0: 1
1: 0
2: 3
3: 28
4: 375
Right 1125512830 15:40302099-40302121 AGCCCCTGGAAGCCTGGGGAGGG 0: 1
1: 0
2: 2
3: 54
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125512830 Original CRISPR AGCCCCTGGAAGCCTGGGGA GGG Intronic
900272178 1:1796653-1796675 ACCCTCTGGAAGCCTGCAGAGGG + Intronic
900288568 1:1914180-1914202 AGACGCTGGAAGCCTGGGAACGG + Intergenic
900478990 1:2889308-2889330 GGGCCCTGGGAGCCTGGGGGTGG - Intergenic
900505560 1:3028457-3028479 AGTCCCAGAAAGCCTGGGAATGG - Intergenic
900536425 1:3179912-3179934 ATCCGGTGGCAGCCTGGGGAAGG - Intronic
900625219 1:3604882-3604904 AGCCCCAGGGAGGCTGAGGAGGG - Intronic
900851171 1:5144270-5144292 AGCCCCTGTCAGCCTGGTGTTGG - Intergenic
901168170 1:7234604-7234626 AGGCCCTGGGAGCCCTGGGAAGG + Intronic
901168705 1:7238521-7238543 AGCCCCTGGGAGCCCTGGGAAGG - Intronic
901434032 1:9235170-9235192 AGCCCCACGGAGCCTGGGGCTGG + Intronic
901609252 1:10484138-10484160 AGCTACTGGAAGGCTGGGGCAGG - Intronic
901813112 1:11778916-11778938 GGGCCCTGGGAACCTGGGGAAGG - Exonic
902534100 1:17109082-17109104 AGGCTCTGGAAAGCTGGGGATGG + Intronic
902681304 1:18045813-18045835 GGCTCCTGGAGGCCTGGGGCTGG - Intergenic
902769452 1:18637170-18637192 AGCGCCCGGAAGCCCGGGAAAGG + Intronic
903123608 1:21233065-21233087 AGCCCACAGAGGCCTGGGGAAGG - Intronic
903362019 1:22782893-22782915 AGGGGCTGGCAGCCTGGGGAGGG - Intronic
903479957 1:23645764-23645786 AGCCTCTGGAGGCCTGGGGTGGG + Intergenic
903968297 1:27103029-27103051 AGCAGCTGGGAGCCTGAGGAGGG - Intronic
904672282 1:32174767-32174789 CTTCCCTGGCAGCCTGGGGAAGG + Exonic
904873533 1:33636339-33636361 AGGTGGTGGAAGCCTGGGGATGG - Exonic
904953077 1:34260087-34260109 TGGCCCTAGAAGCCTGGGGCAGG - Intergenic
904965496 1:34369463-34369485 AGTCACTGACAGCCTGGGGAGGG + Intergenic
905028236 1:34865624-34865646 AGCCCCTGGGAGGGTGGGGCGGG + Exonic
905223282 1:36463745-36463767 ACCTCCTGGAAGGCTGGGGTGGG - Intronic
905920428 1:41715418-41715440 ACCCACGGCAAGCCTGGGGAGGG + Intronic
906146585 1:43564186-43564208 ACTGCCTGGAAGCCTGGGGGTGG + Intronic
906534452 1:46543947-46543969 AGCCCCTAGAAGTCAGCGGACGG - Intergenic
906638880 1:47429210-47429232 AGCCCCTGGAAGACTTTGGCAGG + Intergenic
907391035 1:54158365-54158387 AGCCCCTGGAAGTTTGAGGCTGG - Intronic
907589731 1:55654830-55654852 AGCCCATGGAAGCCCACGGAAGG + Intergenic
908117306 1:60952767-60952789 AACACCTGGAAGCCTTGGCAAGG - Intronic
908191480 1:61708158-61708180 AGCCACTGGGAGGCTGGGGTGGG - Intronic
909341825 1:74540929-74540951 GGCCTCTGGAAGCCAGAGGATGG + Intronic
909438739 1:75673689-75673711 AGCTCCTAGGAGCTTGGGGAAGG - Intergenic
911615544 1:100006616-100006638 AGTCCCTGGAGGCCTGTGCAAGG + Intronic
911994022 1:104739740-104739762 AGCCCATACAAGGCTGGGGAAGG - Intergenic
912532471 1:110336196-110336218 ATCTGCTGGAAGCCAGGGGAGGG + Intergenic
912793270 1:112674398-112674420 CGTCCCTGGAAGGCTGGGGGAGG + Intronic
913319573 1:117578847-117578869 AGCCCTAGGGAGCGTGGGGAAGG + Intergenic
915131549 1:153698516-153698538 CGCCCCTGGAAGAGTGGGGCGGG + Intergenic
915517935 1:156423960-156423982 AGCACCTGGGAGGCTGGGGCCGG + Intronic
915529130 1:156493419-156493441 AGCCCCTGGCAGCGGAGGGAGGG + Intronic
915731652 1:158058419-158058441 GGGCCTTGGAAGCCTGGGGCAGG - Intronic
915835219 1:159171276-159171298 AGCCACTGCAGGCCTGGGCAAGG - Intergenic
916065224 1:161131490-161131512 AGGCTCTGGAAGTCTGAGGAGGG - Intronic
916206757 1:162322394-162322416 ACCCCTGGGAAGCTTGGGGAAGG + Intronic
916211500 1:162363622-162363644 AACCCCTGGAAGCTTCGGGATGG - Intronic
917974130 1:180228839-180228861 AGGTTCTGGAAGGCTGGGGAGGG + Intergenic
918309569 1:183276054-183276076 ATCCCCTGGAAGCCAGGGACGGG - Intronic
919439612 1:197615018-197615040 AGTCCCTGGTAGCTTAGGGAAGG - Intronic
919724615 1:200873620-200873642 AGGCCCTGGAAGGCGTGGGAGGG - Exonic
921556205 1:216601283-216601305 AGTCCCTGGGAGTCTGCGGAGGG - Intronic
922582007 1:226705576-226705598 TGACCCAGGAAGCTTGGGGAAGG - Intronic
922783219 1:228269672-228269694 GGCCCTGGGAAGCGTGGGGAAGG + Intronic
923033395 1:230267469-230267491 AGGCCCTGGGAGCCTGGGAATGG - Intronic
923461949 1:234215496-234215518 AGCTCCTGGGACCCAGGGGATGG - Intronic
923517515 1:234709944-234709966 AGGCCCTGGAGGCCTGAGGCTGG - Intergenic
1063027297 10:2193078-2193100 AGCCACTGGATACCTGGAGATGG + Intergenic
1063383028 10:5597945-5597967 AGCCCCTGGGAGAAAGGGGAAGG + Intergenic
1066566453 10:36726797-36726819 AATCGCTGGAACCCTGGGGATGG - Intergenic
1067173242 10:43924480-43924502 GGGGCCTGGAAGCCTGGGGATGG + Intergenic
1067462306 10:46466701-46466723 AGCCCCTGGAGACCAGGGGAGGG + Intergenic
1067624891 10:47917936-47917958 AGCCCCTGGAGACCAGGGGAGGG - Intergenic
1070388307 10:75946965-75946987 AGCCACTGGAAGCCTGTAGCTGG + Intronic
1071538075 10:86452925-86452947 AGCACCTGGAAGGCTGAGGCAGG + Intronic
1072010391 10:91298352-91298374 AGCCCCTGGAAAGTGGGGGAGGG + Intergenic
1072283838 10:93894315-93894337 AGCCCCGGGCAGGGTGGGGACGG - Intronic
1073065978 10:100759441-100759463 AGTCCCTGGCAGGCTGGAGAGGG + Intronic
1073301917 10:102476014-102476036 TGCTGCTGGCAGCCTGGGGAAGG + Exonic
1074160294 10:110831198-110831220 AGCCCCTGGCATGCTGGGCAAGG - Intronic
1075087672 10:119424287-119424309 AGGCACTTGGAGCCTGGGGAAGG - Intronic
1075144460 10:119872157-119872179 AGGTCCTCGAACCCTGGGGAGGG - Intronic
1076208854 10:128624874-128624896 AGCCCATGGAAGCTGGGGCATGG - Intergenic
1076216300 10:128696237-128696259 AGCTTCTGGATTCCTGGGGAAGG - Intergenic
1076433602 10:130424555-130424577 AGTCCCTGGAAGCTGGGGGAGGG + Intergenic
1077021190 11:417792-417814 AGCCCATGGAAAACTGGAGAAGG + Intergenic
1077061963 11:621443-621465 AGTCACTGGCACCCTGGGGAGGG + Exonic
1077464167 11:2725693-2725715 AGCCGAGGGCAGCCTGGGGAAGG + Intronic
1077501809 11:2912778-2912800 AGCCCCTCACAGACTGGGGAGGG + Intronic
1077538636 11:3136115-3136137 TGCCTCTGGACACCTGGGGAGGG + Intronic
1078003000 11:7513050-7513072 AGTCCTTGGAGGCCTGGGCAGGG + Intergenic
1078062512 11:8057075-8057097 AGGCTCTGGAGGGCTGGGGAGGG + Intronic
1079351323 11:19694421-19694443 AGCACAGGGAAGCCAGGGGAGGG + Intronic
1080111819 11:28576298-28576320 AGCCTCTGTAAGACTGGGGTAGG + Intergenic
1080756251 11:35202326-35202348 AGCCCATGGTAACTTGGGGAAGG + Intronic
1081085552 11:38795913-38795935 AGACCCTGGAAGCTGGGGAAAGG - Intergenic
1083035911 11:59637285-59637307 GGCCCCTGGCTGCCTGGGAACGG + Exonic
1083675700 11:64323571-64323593 AGCACCTGCAACCCTGGGCAGGG - Intergenic
1083968345 11:66056959-66056981 AGACCCTGGAACCGAGGGGAAGG + Intronic
1084008408 11:66334980-66335002 TGCCCCTGGCAGCACGGGGACGG + Exonic
1084667683 11:70585212-70585234 AGCCCCTGCCAGCCAGTGGATGG - Intronic
1084688669 11:70712114-70712136 AGCCTCTGGAAGCCGGGCGGGGG - Intronic
1084963863 11:72733260-72733282 AGCCCCAGGAAGGGTGAGGAAGG + Intronic
1086923024 11:92608907-92608929 AGCCTCCAGAAGCCTGGGCATGG - Intronic
1087470205 11:98564363-98564385 AGCCTCTGGAATCCTGCTGAAGG - Intergenic
1087500848 11:98951714-98951736 AGCCACTGGAAGCCACTGGAGGG - Intergenic
1087623415 11:100567997-100568019 TGCCCCTGAGAACCTGGGGAAGG - Intergenic
1088753208 11:112863476-112863498 AGCCACTGGAGGGATGGGGATGG - Intergenic
1089340002 11:117750845-117750867 AGCCCCTGGAGGGCAGGGGCTGG - Intronic
1089422851 11:118344493-118344515 GGGGTCTGGAAGCCTGGGGAAGG + Intronic
1089454541 11:118618319-118618341 AGCTCCTGGAGCCCAGGGGAGGG - Intronic
1089596687 11:119585120-119585142 AGCTCCAGGCAGTCTGGGGAAGG - Intergenic
1089615610 11:119693053-119693075 AGCCCCTGTAGTCCTGGGGGAGG - Intronic
1089684422 11:120137838-120137860 AGCGCCCTGAAGCCAGGGGAAGG - Exonic
1090802268 11:130180289-130180311 GCCCCTTGGAATCCTGGGGAGGG - Intronic
1091302748 11:134518023-134518045 AGCCTCTGGGAGCTTGGGGTGGG - Intergenic
1091352261 11:134906898-134906920 ACCACGAGGAAGCCTGGGGATGG - Intergenic
1091740647 12:2958953-2958975 AGTCCCTGGGAGGCCGGGGAAGG - Intergenic
1092265488 12:6977513-6977535 TGAGCCTGGCAGCCTGGGGAGGG + Exonic
1092284516 12:7121128-7121150 AGCCGCTGGAGGGGTGGGGAGGG + Intergenic
1092479519 12:8847539-8847561 AGCCAAGGGAAACCTGGGGAAGG - Exonic
1093175566 12:15909980-15910002 AGGCCCTGAAAGCCTGGAGCTGG - Intergenic
1095825947 12:46530890-46530912 AGCCCCTAACAGCCTGGGGTGGG - Intergenic
1096098362 12:48952906-48952928 AGCCACTGGATGGCTGGGCAGGG + Intronic
1096624365 12:52884917-52884939 ACCACCTGGAAGCCAGGAGACGG + Intergenic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1097320692 12:58222704-58222726 AGCCCCAGAAAGTCTTGGGATGG - Intergenic
1098465828 12:70784351-70784373 GCCCCCTGGCAGCCTGGGGTGGG + Intronic
1100142230 12:91633232-91633254 AGACTCAGGAAGCCTGAGGAGGG + Intergenic
1100443659 12:94641227-94641249 AACCACTGGATGCCTGGGTAGGG + Intronic
1101758269 12:107638504-107638526 AGCCCCTGAACCCCTGGGGAAGG + Intronic
1101862992 12:108498140-108498162 AGCCCATGGTATGCTGGGGAGGG + Intergenic
1102465777 12:113130153-113130175 AGCCCCTGGAGGCCTGATGGGGG - Intronic
1104004855 12:124884795-124884817 AGCCCTCTGAAGCCTGGGGTGGG - Intergenic
1104336339 12:127899291-127899313 AGCCCCTTTATGCCTTGGGATGG + Intergenic
1105510674 13:21049362-21049384 AGCCCCGGGGAGCAAGGGGAAGG + Intronic
1106271207 13:28155475-28155497 AGCCACTGGGAGGCTGAGGAAGG + Intronic
1106409085 13:29498678-29498700 AGCTCCTGGATTCCTGGGAAAGG - Intronic
1107853271 13:44591426-44591448 GCCCCCTCGAAGCCTGGGGCAGG - Intergenic
1110030251 13:70602648-70602670 AAACCCTGGAAGGCTGGGCACGG + Intergenic
1112412137 13:99173609-99173631 AGCTCCTGGCAGCCTGTGGCTGG - Intergenic
1113713614 13:112488430-112488452 AGACCCCGGAAGGCTGGGGACGG - Intronic
1118166774 14:63344545-63344567 AGTCCCTGGAGGCCAGGGTAGGG - Intergenic
1118709616 14:68508792-68508814 AGCCCCTGAAAGCCTTGGAAGGG + Intronic
1119183563 14:72620492-72620514 AGCTTCTGGAAGCCGAGGGATGG - Intronic
1119623564 14:76151772-76151794 AGCCACAGGAAGCCAGGAGATGG - Intergenic
1119658834 14:76436423-76436445 AGCCCTCTGCAGCCTGGGGAAGG + Intronic
1119777817 14:77259274-77259296 GGCCACTGGAGGCCTGAGGAGGG - Exonic
1121113697 14:91329438-91329460 AGGCCGTGGAGGCCTGAGGAAGG - Intronic
1121215976 14:92248172-92248194 AGCCCATGGAAGCCAGCGGCCGG - Intergenic
1121693692 14:95895628-95895650 AGACCCTGGAAGCCCTTGGAAGG - Intergenic
1121951529 14:98175123-98175145 GGCCCCTGGGAGCTTGGGGCTGG + Intergenic
1122125335 14:99575710-99575732 GGCCAGTGGAAGCCTGGAGAGGG - Intronic
1122365475 14:101192582-101192604 AGGCCCTGGGGGCCTGGAGAAGG + Intergenic
1122879226 14:104682539-104682561 CACCCCTGGAGGCGTGGGGAAGG + Intergenic
1123110840 14:105866259-105866281 AGCCAGTGCAGGCCTGGGGAGGG - Intergenic
1202865572 14_GL000225v1_random:114946-114968 TCCCCGTGGAAGCCTGGGGCAGG - Intergenic
1123427208 15:20182644-20182666 AGCAACTTGAAGCCTGGTGAGGG - Intergenic
1123536440 15:21189169-21189191 AGCAACTTGAAGCCTGGTGAGGG - Intergenic
1125390818 15:39190981-39191003 ACTCACTGGCAGCCTGGGGAAGG - Intergenic
1125510120 15:40288280-40288302 GGGGCCTGGAAGCCTGGGGCAGG + Exonic
1125512830 15:40302099-40302121 AGCCCCTGGAAGCCTGGGGAGGG + Intronic
1126778260 15:52118002-52118024 GACGCCTGGAAGCCTGGGGAAGG - Exonic
1127811222 15:62567440-62567462 GGCACCTGGAGGCCTGGTGAGGG + Intronic
1128347035 15:66860859-66860881 TGGCACTGGCAGCCTGGGGAAGG + Intergenic
1128755813 15:70182980-70183002 AGAAGCTGGGAGCCTGGGGATGG - Intergenic
1128764655 15:70243811-70243833 AGGCCCAGGAATCCTGGAGAGGG - Intergenic
1129198117 15:73983039-73983061 AGCCCCTGGAAGCAAGGGTGGGG - Exonic
1129226330 15:74172594-74172616 AGGCCAAGGAAGCTTGGGGAGGG + Intergenic
1129599350 15:76989232-76989254 AGCCCCTGCCAGTCTGGTGAGGG - Intergenic
1129826417 15:78637820-78637842 AGCCCAGGGCAGCCTGGGGGAGG - Intronic
1129846009 15:78768010-78768032 AGACCCAGGATGCCTGGGGGTGG + Intronic
1129927908 15:79382577-79382599 AGCTTCTGGTAGCCTGGGGAAGG - Intronic
1130255865 15:82325853-82325875 AGACCCAGGATGCCTGGGGGTGG - Intergenic
1130540456 15:84817668-84817690 GGCCCCTGGAGGCCTGGGCTGGG + Intronic
1130599096 15:85264133-85264155 AGACCCAGGATGCCTGGGGGTGG + Intergenic
1130898818 15:88191920-88191942 AGCCCCAGGCAGCCAGGGGTTGG + Intronic
1131154331 15:90065460-90065482 AGTCCTTGGAAGCCTGGAGAGGG + Intronic
1131182440 15:90249750-90249772 CGCCCCTAGCCGCCTGGGGATGG - Exonic
1131248273 15:90814559-90814581 AGCCCCAGGAAGCCCCAGGAAGG - Intronic
1131456049 15:92583479-92583501 AGCCCCTGGAAGACTGAGAGGGG - Intergenic
1132056026 15:98650346-98650368 AGCCCCGGGACGCCGGGGGCAGG - Intronic
1132110087 15:99096490-99096512 AGCCCTGGGAAGCCTGGGAAAGG + Intergenic
1132594522 16:742348-742370 AGGGCCTAGAACCCTGGGGAGGG - Intronic
1132611895 16:821242-821264 AGGCCCTGGGAGGCAGGGGAGGG + Intergenic
1132738467 16:1398982-1399004 AGCCCCTGGCAGCTTGGGTGAGG + Intronic
1132774487 16:1584977-1584999 AGCCACTGGAAACGTGGTGAAGG + Intronic
1132781629 16:1629681-1629703 AGGCCCAGGGAGCGTGGGGAGGG + Intronic
1132939935 16:2501530-2501552 TGGCCCAGGAGGCCTGGGGAGGG - Exonic
1133036407 16:3036425-3036447 AGCCCCCGGAGGGCTGGGGCTGG - Intronic
1133047891 16:3099257-3099279 AGCCTCCGCCAGCCTGGGGAAGG + Intronic
1133231118 16:4367062-4367084 GGCTCCTGGAAGTGTGGGGAGGG - Intronic
1133981174 16:10634320-10634342 TGCCCAAGGAAGCCTGAGGATGG + Intronic
1134596551 16:15500401-15500423 AGCCCCTGGCAGCCTATGGGTGG - Intronic
1135057285 16:19241527-19241549 ACCTCCTGGCAGCCTGGGGCGGG + Intronic
1135328987 16:21545672-21545694 AGCCAGAGGAAACCTGGGGAGGG - Intergenic
1136062934 16:27739126-27739148 AGACCCTGGTGGCCTGGGCAAGG + Intronic
1136254543 16:29029400-29029422 AGCTCCCGGCAGCCGGGGGAGGG + Intergenic
1136339332 16:29631649-29631671 AGCCAGAGGAAACCTGGGGAGGG - Intergenic
1136475403 16:30510168-30510190 AGTCACTGGAAGGCTGGGTAAGG - Intronic
1136857088 16:33667193-33667215 AGCAACTTGAAGCCTGGTGAGGG + Intergenic
1137676970 16:50308589-50308611 GGTCGCTGGCAGCCTGGGGAGGG - Intronic
1137930338 16:52581237-52581259 AGCATCTGGAAGAGTGGGGATGG - Intergenic
1138657407 16:58499357-58499379 AGCCCCTGGCAGCAGGGTGAGGG + Intronic
1139371261 16:66470881-66470903 GGCCCCTGAAGGCCTGTGGATGG - Intronic
1139671826 16:68497431-68497453 AGCCCAGGGCAGCCTGGGGCAGG + Intergenic
1140121378 16:72085756-72085778 AGCACCTGGGAGGCTGAGGAGGG + Exonic
1140222443 16:73053749-73053771 AGCCTGTGGCTGCCTGGGGAAGG - Intronic
1140647550 16:77049573-77049595 TGTCCATGGAAGCCTGGGTAGGG + Intergenic
1141426928 16:83950110-83950132 AGAGCCTGGAGGGCTGGGGAGGG - Intronic
1141661587 16:85444502-85444524 AGCCTGAGGAACCCTGGGGAGGG + Intergenic
1141883012 16:86872365-86872387 AGCCCCTGAAAGCATGGGAGGGG + Intergenic
1142088504 16:88197621-88197643 GGCCCCAGGAACCATGGGGAGGG - Intergenic
1142247046 16:88974989-88975011 AGCCCCTAGAAGCCAGGGGCAGG + Intronic
1142260656 16:89041126-89041148 AGCCCAGGGAGGCCTGGGCAAGG + Intergenic
1143116754 17:4585470-4585492 GGCCCCTGGATGGGTGGGGAGGG + Intronic
1143583842 17:7841801-7841823 AGCCGGGGGAAGGCTGGGGAAGG + Intronic
1144999937 17:19297488-19297510 AGCCCCTGAAAGCTTAGGGCTGG - Intronic
1145254733 17:21316384-21316406 AGCCACAGGAAGACGGGGGAGGG - Intergenic
1145321867 17:21771581-21771603 AGCCACAGGAAGACGGGGGAGGG + Intergenic
1145993035 17:29090603-29090625 GGTCCCGGGAAGCCTGGGAAAGG + Exonic
1146903440 17:36602473-36602495 AGCCCTTGGGAGCCCTGGGAGGG + Intronic
1147452684 17:40515679-40515701 AGCACCAGGATGCCAGGGGAAGG + Intergenic
1147635401 17:41960875-41960897 AGCCCCTGTGAGCCTCTGGAGGG - Intronic
1147966592 17:44197482-44197504 AGCTCCTGTGAGCCGGGGGAGGG - Intronic
1148366184 17:47057532-47057554 AGCCCCTGACTGCCTGGGGCCGG + Intergenic
1148451843 17:47783644-47783666 TGCCCCTGGAAAGCTGGGGCAGG - Intergenic
1148467819 17:47875333-47875355 AGCCCCAGGAGGCCTTGGGGGGG - Intergenic
1148864726 17:50622580-50622602 AGCCCCAGCAGGCCTGAGGATGG - Intronic
1149321162 17:55482430-55482452 AGCCTGTGGAAGCCTGGAGAAGG - Intergenic
1149850720 17:60032069-60032091 AGCCCCTGGTGCCCTGGGGTGGG - Intergenic
1149859446 17:60114455-60114477 AGCCCCTGGTGCCCTGGGGTGGG + Intergenic
1151154417 17:72114835-72114857 GGACCCTGGAGGCGTGGGGATGG + Intergenic
1151275617 17:73031872-73031894 AGCTCCGGGAATTCTGGGGATGG - Intronic
1151451794 17:74202738-74202760 AGGCTTGGGAAGCCTGGGGAGGG - Intergenic
1151599884 17:75099790-75099812 ATGCCCTGGCAGCCTTGGGAGGG + Intronic
1151669990 17:75566739-75566761 AGCACCAGGAATCCTGGAGAAGG + Intronic
1151772976 17:76177168-76177190 ACCCCCTTGCAGCCTGGGGCAGG - Intronic
1151774418 17:76189730-76189752 AGATCCTGGAAGCCCGGAGAAGG + Intronic
1151804283 17:76396079-76396101 AGCCCCGAGAAGGCGGGGGAAGG + Intronic
1152288242 17:79424609-79424631 AGCCCTTGGAAGCCTGGTGGGGG - Intronic
1152559769 17:81072133-81072155 AGCCCTCAGAAGCTTGGGGAGGG + Intronic
1152638202 17:81438821-81438843 AGCCCCCAGCAGCCCGGGGATGG + Intronic
1152694800 17:81738745-81738767 AGCTCCTGGGAGCTTGGGGCAGG - Intergenic
1152937765 17:83150456-83150478 TGCTCCTGGGAGCCTGGGGTTGG - Intergenic
1153051253 18:905294-905316 AAGCTCTGGAAGCCGGGGGAGGG - Exonic
1153871342 18:9323130-9323152 AGACTCTGGAAGCCCTGGGAAGG - Intergenic
1154200913 18:12300002-12300024 AGCCCCTGGATACCTCTGGATGG - Intergenic
1155307750 18:24495731-24495753 AGCCCCAGCAGTCCTGGGGAGGG + Intergenic
1156373544 18:36492274-36492296 AGAACCTGTGAGCCTGGGGATGG - Intronic
1157244137 18:46038746-46038768 AGGACCTGGAGGCCTGAGGACGG - Intronic
1157823265 18:50789421-50789443 ACACACTGGAAGCCTGGGTATGG - Intergenic
1159028171 18:63205854-63205876 ATTCTCTGGAGGCCTGGGGATGG - Intronic
1159043111 18:63343928-63343950 AGCACCTGGGAGGCTGAGGAGGG + Intronic
1159497655 18:69226467-69226489 AGCCACTGGAAGATTGGTGATGG + Intergenic
1159636952 18:70816642-70816664 CTCCCCTGGAAGCCTGGCAAGGG - Intergenic
1160418238 18:78726760-78726782 GGCGCCTGGAGCCCTGGGGAAGG + Intergenic
1160456490 18:79005984-79006006 GTCCCCAGAAAGCCTGGGGAGGG - Intergenic
1160673090 19:375593-375615 AGCCCCTGGCAGTGGGGGGAGGG - Intronic
1160728041 19:626746-626768 AGCTACTGGGAGCCTGGGGCAGG + Intronic
1160928855 19:1560309-1560331 AGACCCAGCAAGGCTGGGGAAGG + Intronic
1160990380 19:1857941-1857963 AGGCCCTGCCAGCCTGGGGGTGG + Intronic
1161219203 19:3110337-3110359 AGCCCGCGGGCGCCTGGGGAGGG + Intronic
1161535896 19:4818259-4818281 TGCCCCTGGCAGCCTGGGCGTGG + Exonic
1161651384 19:5487645-5487667 AGGAACTGGAAGCATGGGGATGG - Intergenic
1161656580 19:5519522-5519544 AGCACCTGGAAGGCTGAGGTGGG - Intergenic
1162065632 19:8123740-8123762 GGCCCCTGGAAGGATGGGGAGGG - Intronic
1162490276 19:10987430-10987452 AGGCCTTGGGAGCCTGGGGCTGG + Intronic
1162558986 19:11405094-11405116 AGGCCCGGGAAGTCGGGGGAGGG - Intronic
1163063426 19:14776119-14776141 AGCCCCTGGTGACCTGAGGAGGG - Intronic
1163118027 19:15200059-15200081 GGCCCCTGGCCGGCTGGGGAGGG + Intronic
1163871054 19:19821600-19821622 ACCCCCTGGAAGCCTAGAAATGG - Exonic
1163948852 19:20565637-20565659 AGCCCCTGGAAGCCTAGAAATGG - Exonic
1163969234 19:20776429-20776451 ACCCCCTGGAAGCCTAGAAATGG + Exonic
1163983447 19:20923382-20923404 ACCCCCTGGAAGCCTAGAAATGG + Exonic
1163993386 19:21020782-21020804 AACCCCTGGAAGCCTAGAAATGG + Exonic
1164042447 19:21505753-21505775 ACCCCCTGGAAGCCTAGAAATGG + Exonic
1164049155 19:21569103-21569125 ACCCCCTGGAAGCCTAGAAATGG - Intergenic
1164096054 19:22010791-22010813 ACCCCCTGGAAGCCTAGAAATGG - Exonic
1164115549 19:22215631-22215653 ACCCCCTGGAAGCCTAGAAATGG - Intergenic
1164162175 19:22634453-22634475 ACCCCCTGGAAGCCTAGAAACGG + Exonic
1164241750 19:23395324-23395346 AACCCCTGGAAGCCTAGAAATGG - Exonic
1164254172 19:23512512-23512534 ACCCCCTGGAAGCCTAGAAATGG - Intergenic
1164272700 19:23687030-23687052 ACCCCCTGGAAGCCTAGAAATGG - Exonic
1164735742 19:30539770-30539792 GGTCCCTGAAAGCCTGGGGGAGG + Intronic
1165152912 19:33771487-33771509 AGCCCTTGGGAAACTGGGGAGGG + Intronic
1165156739 19:33793268-33793290 CACCCCAGGAAGCCTGGGGGTGG + Intergenic
1165378050 19:35457423-35457445 AGCTTCTGGAAGCCAGGTGAAGG - Intergenic
1165412898 19:35673310-35673332 AGCCCGGCGAGGCCTGGGGAGGG + Intronic
1165895559 19:39139052-39139074 AGCCCATGGCTGGCTGGGGAGGG + Intronic
1165916716 19:39265215-39265237 AGCCCCTGGCAGCCGCGGGGAGG + Intergenic
1165950765 19:39472941-39472963 GGCCTGTGGAGGCCTGGGGAGGG + Intronic
1165951561 19:39476383-39476405 AGCTCCTGGAAGCCTGAAGCAGG + Exonic
1166766460 19:45254258-45254280 AGCCCCTGGGGGCCGGGGGTGGG - Intronic
1166819694 19:45570065-45570087 CGCCCGTGTCAGCCTGGGGATGG - Intronic
1167008313 19:46789259-46789281 AGCTACTGGAAGCCTGAGGCAGG + Intergenic
1167026347 19:46921895-46921917 AGCCCCTGGCTGCCTCAGGATGG + Exonic
1167134780 19:47609789-47609811 GGGCCCTGGAAAGCTGGGGAGGG + Intronic
1167435058 19:49474463-49474485 AGACGCAGGAAGCCTGGGGGAGG + Intronic
1167589779 19:50398103-50398125 ACCACCGGGGAGCCTGGGGAAGG + Intronic
1167612773 19:50515282-50515304 AGGCCCTGGAGGGCTGGGGCTGG - Intergenic
1168078191 19:53991808-53991830 AGGCCCTGGGAGCCCGGGGGAGG + Intergenic
1168287358 19:55341303-55341325 AGCCCCAGGCAGCCTGGAGGCGG - Intronic
1168322647 19:55518999-55519021 AGCCCCTCAAATCCTGGAGAGGG - Exonic
926348154 2:11968370-11968392 ATCCCCAGGAGGCCTGGGGGTGG + Intergenic
926892487 2:17650187-17650209 AGCCCCCAGAGGCCAGGGGAGGG - Intronic
927595477 2:24393108-24393130 TGCCCCTTGAGGCCTAGGGATGG + Intergenic
927880257 2:26685372-26685394 AGATCCGGGAAGCCTGTGGAAGG + Intergenic
928177295 2:29043399-29043421 AGCCCCTGCATTCCTGGAGAGGG - Intronic
931867226 2:66426080-66426102 GGCCGCTGGAAGCCGGGAGAAGG + Intergenic
932570192 2:72934435-72934457 AGGGCCTGGGAGCCTGGGGTGGG + Exonic
933991234 2:87635171-87635193 AGGCGCTGGGAGCCTGGGGCTGG - Intergenic
934088425 2:88529617-88529639 AGCCCAGGGCAGCCCGGGGAGGG - Intergenic
934471586 2:94546763-94546785 AGCCCTTTGAGGCCTGTGGAGGG - Intergenic
934853589 2:97716020-97716042 GGACCCTGGAAGCCTAGGGGAGG + Intronic
936302608 2:111315651-111315673 AGGCACTGGGAGCCTGGGGCTGG + Intergenic
936479914 2:112876737-112876759 TGGCCCTGGAGGCCTGGGGTGGG - Intergenic
937297760 2:120820022-120820044 AGGCCATGGGAACCTGGGGAAGG + Intronic
937339586 2:121082612-121082634 ACCCACAGGAAGCTTGGGGAGGG + Intergenic
938067927 2:128292033-128292055 GGCCCCTGGATGCCAGGAGAGGG + Intronic
940807799 2:158207474-158207496 AGAGCCTGGAGTCCTGGGGATGG - Intronic
940995674 2:160146985-160147007 AGCCACTGGAAGGCTGAGGTGGG + Intronic
941096585 2:161244856-161244878 GGCCCTGGGAAGCGTGGGGAAGG + Intergenic
943069736 2:183126145-183126167 AGCCCCTGGGAGGCTGAGGTGGG - Intronic
943762301 2:191623136-191623158 AGCACCTGCAAGCAAGGGGATGG - Intergenic
944892404 2:204131040-204131062 AGACCCTGGATGCCTGAGGAAGG + Intergenic
946411463 2:219517272-219517294 AGTCCCCGGAATCCTGGGGATGG + Intronic
946521085 2:220465538-220465560 AGCCCCTGGAAACCTGAGGAGGG + Intergenic
946847419 2:223871604-223871626 AGCCTCTGGAAGACAGGGGCTGG - Intronic
946998268 2:225421155-225421177 AGCGTTTGGAAGCCTGGGGAGGG - Intronic
947749905 2:232526519-232526541 AGCCCCCAGCTGCCTGGGGAGGG - Exonic
948036730 2:234863803-234863825 AGCACCTGGGTGCCTGGGGAAGG + Intergenic
948727866 2:239945820-239945842 GGGCCCTTGAAGCCTGGGGACGG - Intronic
1168849774 20:968508-968530 AGCACCTGGGTGCCTGAGGAAGG + Intronic
1168998201 20:2147939-2147961 AGCCCCTTGAAGCCTAGGTAGGG - Exonic
1169217815 20:3803583-3803605 AGCACCTGTGAGCCTGGGCAGGG - Intronic
1169266062 20:4168014-4168036 ACTGCCTGGAAGTCTGGGGAGGG - Intronic
1169557450 20:6766537-6766559 GGCTCCTGGAATCCTGGGAAGGG + Intergenic
1170787782 20:19482331-19482353 AGCCCAGAGAAGCCTGGGGGAGG - Intronic
1172208232 20:33179803-33179825 AGCCCCCGGGTGCCTGTGGAGGG - Intronic
1172883271 20:38215325-38215347 ATAGGCTGGAAGCCTGGGGATGG - Intronic
1173575765 20:44112251-44112273 GGCCCCTCCAAGCCTGGGGAAGG - Exonic
1173705534 20:45107749-45107771 AGCCACTGTAAGCATGGGGTGGG + Intergenic
1175378603 20:58546855-58546877 AGCCGCTGGAGGCCTGGCTAGGG + Intergenic
1175416621 20:58805402-58805424 AGCCCCAGGGTGCCTGAGGAGGG - Intergenic
1175900993 20:62359884-62359906 TGCTCCTGGAAGGCTGAGGAGGG - Intronic
1175906324 20:62381330-62381352 AGCCTCTGCAAACCTGGGGCGGG + Intergenic
1175972345 20:62693090-62693112 AGTCCTGGGAAGCCTGGGGCGGG - Intergenic
1176214747 20:63942668-63942690 AGCCCCAGGAAGCCTTGGTCGGG - Intronic
1176284164 21:5010316-5010338 AGCTCCTGGAGGGCTGCGGACGG + Intergenic
1176285375 21:5016486-5016508 AGCCCCAGGAACCCAGGGGACGG + Intergenic
1176296709 21:5076883-5076905 AGGGGCTGGAAGCCTGGGCAGGG + Intergenic
1176299973 21:5094907-5094929 GGCCCCTGAAGCCCTGGGGAAGG + Intergenic
1176957875 21:15127099-15127121 GACCCCTGGTAGCCTGGGCATGG - Intergenic
1178417080 21:32412710-32412732 AGGCTCTGGCAGCCTGGGCAGGG + Exonic
1179325169 21:40335094-40335116 AGCTCATGGATACCTGGGGAAGG - Intronic
1179711736 21:43267513-43267535 AGCCCGTGGAAGCTCAGGGAAGG - Intergenic
1179857049 21:44167004-44167026 GGCCCCTGAAGCCCTGGGGAAGG - Intergenic
1179860340 21:44185238-44185260 AGGGGCTGGAAGCCTGGGCAGGG - Intergenic
1179871806 21:44246989-44247011 AGCCCCAGGAACCCAGGGGACGG - Intronic
1179873017 21:44253159-44253181 AGCTCCTGGAGGGCTGCGGACGG - Intronic
1179888901 21:44326095-44326117 TGCCCCAGGGAGCCAGGGGAGGG - Intronic
1180083893 21:45498830-45498852 AGCCACAGGAAGTCTGGAGATGG + Intronic
1180335601 22:11574416-11574438 AGCCGCTGGAATGCAGGGGAGGG - Intergenic
1181004218 22:20002334-20002356 AGCCCCTGCAGGCCTGCAGACGG - Intronic
1181019265 22:20090197-20090219 AGCCCCTGGGGCCCTGGGGCAGG + Exonic
1181269672 22:21651878-21651900 AGCGCTTGGAAGCCCGGTGAGGG - Intergenic
1181639150 22:24187761-24187783 AGCCACTGGGAGCCTGAGCACGG + Exonic
1182149215 22:28016897-28016919 AGTCCCTGGAGGTCTGGGCAGGG + Intronic
1182353648 22:29712499-29712521 AGCCACTGGAGGACTGGGAAGGG + Intergenic
1182521519 22:30887416-30887438 AGTCCCTGCAGGCCTGGGGAGGG - Exonic
1182695889 22:32199128-32199150 AGCCCACGGAAACCTGGAGAGGG - Intronic
1182878405 22:33712193-33712215 CAACCCTGGAACCCTGGGGATGG + Intronic
1183786078 22:40029943-40029965 AGCACCAGGAAGCCTGGGAAAGG - Exonic
1183941967 22:41301212-41301234 AGCACCTGGAAGCCGGAGAAGGG + Intergenic
1184039569 22:41934977-41934999 TGTCCCTGGAAGGCGGGGGATGG - Intergenic
1184090580 22:42291023-42291045 CGATCCTGGCAGCCTGGGGACGG - Intronic
1184310049 22:43635338-43635360 ACCCCCTGGCAGCCTGTGGGTGG - Intronic
1184427853 22:44423660-44423682 AGCTCCTGGAACCCTTGGGGAGG - Intergenic
1185037805 22:48489090-48489112 AGGGCCTGGAAGGCTGGGGAGGG - Intergenic
1185124684 22:49002148-49002170 AGACCATGGCAGCATGGGGATGG - Intergenic
1185158783 22:49210053-49210075 AGCCCCTGGAGGGGTGGGGGAGG + Intergenic
1185287373 22:50008571-50008593 CGGCCCTGGTAGCCTGGGGTGGG + Intronic
1185334339 22:50264912-50264934 AGCCCCTGAGAGCCTGTGGAGGG - Exonic
949464149 3:4326809-4326831 AGCCCCTTGGAGGCTGGGCATGG - Intronic
949529020 3:4935396-4935418 AGACTCTGTAAGCCTTGGGAAGG - Intergenic
949929010 3:9063932-9063954 AGCACCTGGAAAGCTGGTGAAGG - Intronic
950702085 3:14757696-14757718 AGGCCCTGGAGGCCAGGGGCAGG + Intronic
950766633 3:15277863-15277885 ACCCCCTGGATGCCTGGACATGG + Intronic
952382564 3:32816745-32816767 AGCCCCAGGAGGCCGGGGCACGG + Intergenic
953607272 3:44420088-44420110 AGCCTCTGGAGGCCTGGGTCCGG + Intergenic
953753438 3:45627103-45627125 GGCCCTTGGAACCCTGGGCATGG - Intronic
953982662 3:47420419-47420441 GGCCCCTGGAAGCCTGGCTCTGG - Intronic
954385391 3:50241327-50241349 AGCCCCGACAAGCCTGGGGGAGG - Intronic
954465957 3:50654918-50654940 TGCCCCTGGATGCCAGAGGAAGG + Intergenic
954686559 3:52373244-52373266 AGCCTCTGGAAGCCTGGAAAAGG + Intronic
954761784 3:52879929-52879951 AGCCTCTGGAATTCTGGAGACGG + Intronic
955158520 3:56441835-56441857 ATCCCAGGGAAGGCTGGGGATGG - Intronic
955385013 3:58472307-58472329 AGAGTCTGGAAGCCTGTGGAAGG - Intergenic
956108692 3:65849108-65849130 AGTCACTTGAACCCTGGGGATGG - Intronic
957409291 3:79817012-79817034 AGCCAAAGGAAGCCTGGGCATGG - Intergenic
961340570 3:126214244-126214266 AGGCATTGGAAGCCTGGGAAGGG - Intergenic
961453443 3:127012989-127013011 ATCCCCTGGAAGCCCTGGGGAGG + Intronic
961640790 3:128363652-128363674 AGCCCCTGCAGCCCTGGGGGTGG - Intronic
961678801 3:128584713-128584735 GGCACAAGGAAGCCTGGGGATGG + Intergenic
961832693 3:129632323-129632345 AGGCCCAGGCTGCCTGGGGAGGG + Intergenic
962485415 3:135837894-135837916 AGCCCATGGAAGCCAGGGAATGG - Intergenic
962717307 3:138137731-138137753 AGTCACTGGATGCCTGTGGAAGG + Intergenic
962873529 3:139518566-139518588 AGCTCCTGGAGGCTGGGGGAGGG + Intronic
964083222 3:152785496-152785518 ACCGCATGGAAGCCAGGGGAAGG - Intergenic
966735777 3:183185988-183186010 AGCTGCTGGAAGCTTGGGGGAGG + Intronic
966767919 3:183479100-183479122 ACCCCCTGGGAGGCTGGGGTTGG - Intergenic
967952728 3:194853336-194853358 AGCTCCGGGAGCCCTGGGGAGGG + Intergenic
968067258 3:195765437-195765459 AGCCCTTGGAGGCCTGAGGTCGG + Exonic
968618396 4:1592649-1592671 AGAGCCTGGAAGCCTGGGGATGG + Intergenic
968621530 4:1605434-1605456 AGCCCCTGGAAGCTGGGTGCAGG - Intergenic
968977519 4:3829826-3829848 TGCCCCTAGACGTCTGGGGATGG - Intergenic
969716402 4:8870324-8870346 CGACCCTGGAACCCTGGGGAGGG + Intronic
971837810 4:31791410-31791432 GGTCCCTGTAAGCCTGGGAATGG + Intergenic
975817985 4:78239547-78239569 AGCCACTGGAAGCCATTGGAGGG - Intronic
981615019 4:146637327-146637349 AGGCACTGGGCGCCTGGGGAAGG - Intergenic
981783978 4:148456974-148456996 AGCCCATGGAAGCTGGGGTAAGG - Intergenic
982832896 4:160086125-160086147 AGCCCGTGAAAGCATGGGGAGGG - Intergenic
983312872 4:166087753-166087775 AGCGTCTGGAAGCCTGGCCAGGG + Intronic
984478009 4:180261492-180261514 AGCTGCTGGAAGCCCAGGGAAGG - Intergenic
984985938 4:185329558-185329580 ACCGCTTGAAAGCCTGGGGAAGG + Intronic
986306102 5:6518203-6518225 AACCCCTGGAAGCCAGGGGCAGG + Intergenic
987654422 5:20787572-20787594 AGCCCCTGTTAGCCTGGAGCAGG - Intergenic
988264325 5:28928907-28928929 AGCCCCTGGAATCCTAGTGTGGG - Intergenic
988798474 5:34674283-34674305 AGACACTGGATGCCTGGGTAAGG + Intronic
989956839 5:50369550-50369572 AGCCCCTCAATGCCTGGGGCTGG - Intergenic
991414213 5:66375780-66375802 AACCCCTGGAGGCCTAGTGAGGG + Intergenic
992400815 5:76409535-76409557 AGCCCATGTAAGGCTGGGCATGG - Intronic
993865609 5:93191066-93191088 TGACCCTGGAAGGCTGGGGTAGG - Intergenic
995019930 5:107354709-107354731 ATCCCCTAGAAGGCTGGGCACGG - Intergenic
995561478 5:113386484-113386506 AGACCCTGGAAACTTGGGGAAGG - Intronic
997339245 5:133129869-133129891 AGGCCCTAGAAGCCTTGTGAGGG + Intergenic
998192777 5:140041944-140041966 AGACCCTGCCAGCCTGGGCACGG + Intronic
1001272752 5:170327912-170327934 GGGTCCTGGAAGCCAGGGGAGGG - Intergenic
1001424168 5:171612719-171612741 AGACCCTGGAAGCCAGAGGGTGG - Intergenic
1001440589 5:171739798-171739820 AGCCCTTGGCAGACTGGGAATGG - Intergenic
1002493924 5:179599226-179599248 GGGCCCTGGGAGCCAGGGGAAGG + Intronic
1002563444 5:180097555-180097577 ATGGCCTGGATGCCTGGGGATGG + Intergenic
1002707633 5:181173490-181173512 AGCACCTGGAAGGCTGAGGCGGG - Intergenic
1004321145 6:14632691-14632713 AGCAGCTGGAGGCCTGTGGAGGG - Intergenic
1004925485 6:20411754-20411776 AGCCCCTGGGAAACTGGGGGAGG - Intronic
1005134870 6:22556418-22556440 AGCCCTTGCAAGACAGGGGAAGG - Intergenic
1006131535 6:31871951-31871973 AGAGCCTGGAAGCCTGGCCAGGG - Intronic
1006136776 6:31900612-31900634 ACCCCCTGGAGGCCTGGGAGGGG - Exonic
1006364923 6:33609747-33609769 GGCCCTTGGGAGGCTGGGGAGGG + Intergenic
1006594974 6:35186174-35186196 AGCTCCTGGGAGCATGGGGCTGG - Intergenic
1006914557 6:37585905-37585927 GGACTCTGGGAGCCTGGGGATGG - Intergenic
1007086103 6:39146767-39146789 AGCCCTTGTAAGACAGGGGATGG + Intergenic
1007323367 6:41042751-41042773 AGTCCATGGAAGCCAGGAGATGG + Exonic
1008607697 6:53156437-53156459 AGCCCATGGAAGGCAGGAGATGG - Intergenic
1011211424 6:84959968-84959990 AGCCCCTAGAAGTCTGGGCTAGG - Intergenic
1013547167 6:111169583-111169605 AGCCCCAGGGAACCTGGGAAGGG - Intronic
1016324051 6:142879732-142879754 AGACTGTGGAAGCCTGGGGAGGG - Intronic
1017048570 6:150369875-150369897 AGCACCTGGAGGCCTGGGGCAGG + Intronic
1017410659 6:154164449-154164471 AGCCCCAGGATGCCTGGTGTAGG - Intronic
1017674057 6:156795694-156795716 AGGCCTGGGCAGCCTGGGGAGGG - Intronic
1018136563 6:160783796-160783818 AGCACCAGGAAGGCGGGGGATGG + Intergenic
1018748792 6:166783198-166783220 AGCTCCTGGAAGGCTGAGGCGGG - Intronic
1018998835 6:168730070-168730092 AGGCCGGGGAGGCCTGGGGAAGG - Intergenic
1019191956 6:170256685-170256707 AGCCCCTGGGACCCGGGGGATGG + Intergenic
1019320597 7:413834-413856 AGCCCCTGGCAACCTTGAGAAGG + Intergenic
1019335466 7:480623-480645 AGCCCCTGGGAGCCAAGGCAGGG + Intergenic
1019357488 7:588222-588244 AGGCTCTGGAAGGCAGGGGAGGG - Intronic
1019525285 7:1477924-1477946 AGCCCCTGGAGGACTGCGCAAGG + Exonic
1019659044 7:2213638-2213660 AGCCCCTGGAAGATGGGGGAGGG - Intronic
1022029956 7:26483572-26483594 GGCCCCTGGAATCCTGGTCATGG + Intergenic
1022419666 7:30208792-30208814 AGCCCCTAGAAGCCTGAGCCTGG + Intergenic
1023766919 7:43520424-43520446 AGCCTAAGGAAGCGTGGGGAGGG - Intronic
1025022582 7:55491422-55491444 TCCACCTGGGAGCCTGGGGATGG - Intronic
1025633802 7:63303949-63303971 ACCCCCTGGAAGCCGGGAAATGG - Intergenic
1025648894 7:63444219-63444241 ACCCCCTGGAAGCCGGGAAATGG + Intergenic
1025865100 7:65373979-65374001 ACCCCCTGGAAGCCTAGAAATGG + Exonic
1026535525 7:71235752-71235774 AGCACCGGGAAGCATGAGGAAGG + Intronic
1026943645 7:74302910-74302932 AGCCCCAGGAAGAATGGGGTGGG - Intronic
1027783498 7:82550177-82550199 AGCCATTGGAAGCCCGGGCATGG + Intergenic
1028005698 7:85564103-85564125 GGCCCCTAGAAGCCGGGGAAGGG + Intergenic
1028987977 7:97022742-97022764 ACCTCCTTGAAGCCTGGGGAGGG - Intronic
1029493442 7:100884578-100884600 TGTCCCTGGCAGCCTGGGGGAGG + Intronic
1031941949 7:127798435-127798457 AGCTACTGGAAGCCTGGGTGTGG - Intronic
1034155668 7:148954572-148954594 AGCCCCTGGAAGCCAGGCCCAGG + Intergenic
1034200044 7:149278606-149278628 AAGCCCTGGAAGCATGGGGCTGG + Intronic
1034425012 7:151009642-151009664 AGCTCCTGGAGGCCTGGGGCCGG - Intronic
1034481075 7:151320840-151320862 AGCTCCTTGAATCCTGGGGCTGG - Intergenic
1034540881 7:151757136-151757158 AGCCCCGGGAGCCCTTGGGATGG + Intronic
1034630400 7:152526087-152526109 CTCCCCTGGCAGCCAGGGGAGGG - Intergenic
1035188098 7:157141313-157141335 AGCCTCTGGAATGCTGGGGATGG - Intronic
1035346953 7:158206547-158206569 AGCTCCAGGAAGCTCGGGGAGGG + Intronic
1036042404 8:5100613-5100635 AGCTCCTGGGATGCTGGGGAAGG - Intergenic
1037820281 8:22131798-22131820 AGCACCAGGAACCCTGGGGATGG - Exonic
1038435634 8:27533952-27533974 AACCCATGGAAGCCTGGACAGGG - Intronic
1038530824 8:28316999-28317021 AGCCTCTGGAAGCACAGGGAAGG + Intronic
1038838125 8:31151324-31151346 AGCTCCTGGAAGCTTTGGGCAGG + Intronic
1039437913 8:37573372-37573394 ACCCCCTGGAAGTCAGGAGAAGG - Intergenic
1039786843 8:40841536-40841558 GGAGCCTGGGAGCCTGGGGAGGG - Intronic
1040365509 8:46711015-46711037 AGGCCAGGGAAGCCAGGGGAAGG + Intergenic
1041030125 8:53728258-53728280 GGCCCCTGTAAGGCTGAGGATGG - Intronic
1041814283 8:61950359-61950381 AGACCCTAGAAGTCTGGAGAAGG - Intergenic
1042021902 8:64377894-64377916 GTCCCCCTGAAGCCTGGGGACGG + Intergenic
1043369547 8:79575061-79575083 AGCCCCTGGGAGCGTTGAGATGG + Intergenic
1043796474 8:84547846-84547868 AACCACTGGAAACCTGGGTAAGG - Intronic
1044977663 8:97681737-97681759 AGCACCTGGAAGGCTGAGGTGGG - Intronic
1046098483 8:109587690-109587712 AGCTCCTGGAAACCAGGGAAAGG - Intronic
1047333961 8:123918920-123918942 AGCCCTTGGATGCCAGGGGCCGG - Intronic
1047618518 8:126582976-126582998 ACCCCCTGGAAGCCTAGAAATGG - Intergenic
1048205798 8:132414307-132414329 AGCCCAGGGAAGCCCAGGGAGGG + Intronic
1048498351 8:134954408-134954430 AGCACACTGAAGCCTGGGGAAGG + Intergenic
1049195159 8:141311694-141311716 TGCCCATGGAAGCCGGGGAATGG + Intergenic
1049387147 8:142348662-142348684 CGCCCTTGGCAGCCTGGGGCGGG - Intronic
1049476958 8:142801298-142801320 AGCCTCTGGGTCCCTGGGGATGG + Intergenic
1049498364 8:142947320-142947342 AGCCCATGGCAGGCTGGGGAGGG - Intergenic
1049945624 9:592327-592349 AGCAGCGGGAAGCCGGGGGAGGG + Intronic
1050755756 9:9001257-9001279 ATCCCCTTGGAGCCTGGGGAAGG + Intronic
1051358674 9:16262993-16263015 ACCCCCTGTCAGCCTGGGGCAGG + Intronic
1053008562 9:34620658-34620680 AGGCACTGGAAGCCAGGGGAGGG - Intergenic
1053077736 9:35149181-35149203 ACCCCCTGGAAGCCTAGAAATGG - Intergenic
1055454488 9:76459649-76459671 AGCCCCTGGCACCCATGGGATGG - Intronic
1055668241 9:78573592-78573614 AGTCACTGGAAGTTTGGGGATGG - Intergenic
1055710839 9:79060417-79060439 AGCCTCTGGAAACCAGAGGAGGG - Intergenic
1055985519 9:82054583-82054605 AGCCCCTGACTGCCTGGGGTTGG + Intergenic
1056455411 9:86754874-86754896 AGCCCCTGGAAACCAGGGGCAGG - Intergenic
1056557656 9:87703221-87703243 AGCCCCTGGGAGCCCAGGCAGGG + Intronic
1057279284 9:93698536-93698558 GGCCCATGGAAGCCAGGGGTGGG + Intergenic
1058853964 9:109041573-109041595 AGCCCCTGGGAGGCTGAGGTGGG - Intronic
1060990547 9:127846468-127846490 GGTTCCTGGAAGTCTGGGGAGGG - Intronic
1061079298 9:128360649-128360671 AGCCTCTGGAAGGGTTGGGAAGG - Exonic
1061159794 9:128886975-128886997 AGACCCTGGAATCCTGGGCCAGG + Intronic
1061226650 9:129284524-129284546 AGACCCCTGAAGCCTGGGGGAGG - Intergenic
1061439391 9:130589960-130589982 AGCACTTGGAAGGCTGGGGTAGG - Intronic
1061852513 9:133424329-133424351 TGCCTCTGGAAGCCAGGGGAAGG - Exonic
1062067645 9:134537356-134537378 AGCCCCAGGGTGCCTGGGGAGGG + Intergenic
1062103383 9:134739761-134739783 TACCCCTGGAAAGCTGGGGAGGG + Intronic
1062467066 9:136686224-136686246 TGCCCCTGGAACCACGGGGAAGG + Intronic
1062540787 9:137040836-137040858 CGCCCCTGGAGCCCCGGGGAGGG - Exonic
1062634898 9:137485671-137485693 AGCCCTGGGAAGCCTGGGCCAGG + Intronic
1062650657 9:137575193-137575215 TGGCCCTGGAGGCCTGGGGTGGG - Intronic
1186282087 X:8003524-8003546 AGCCCCTCGCTGCCTGGGGCTGG + Intergenic
1188855664 X:35192447-35192469 AGGTGCTGGAAGCTTGGGGAGGG - Intergenic
1189103953 X:38218782-38218804 AGGCTTTGGAAGGCTGGGGAGGG - Intronic
1190653665 X:52592165-52592187 AGGACCTGGGAGCCTGGTGAGGG + Intergenic
1190654231 X:52597146-52597168 AGGCACTGGGAGCCTGGTGAGGG - Intergenic
1191664572 X:63686855-63686877 AGTGCCTGGCAGCTTGGGGAAGG - Intronic
1192240393 X:69323677-69323699 AGGGCCAGGAAGCTTGGGGAGGG - Intergenic
1193951769 X:87808913-87808935 AGCCCCTCAATGCCTGGGGCCGG + Intergenic
1196055336 X:111349319-111349341 AGTCTCAGGAAGCCTGGGAAGGG - Intronic
1196465458 X:115968283-115968305 AGCCCCTGAAAATCTGGGGGGGG + Intergenic
1196733454 X:118963797-118963819 TGCTCCTGGAAGCCACGGGAGGG + Intergenic
1197763047 X:130040937-130040959 AGCCCCTGAGACCCTCGGGATGG - Intronic
1198298119 X:135306957-135306979 AGCCTCTGGAAGGCTGAGGTGGG - Intronic
1200216846 X:154371797-154371819 AGGCCCTGGGGGCCCGGGGAAGG - Intronic
1201179560 Y:11332362-11332384 TCCCCACGGAAGCCTGGGGACGG + Intergenic
1201838435 Y:18346416-18346438 AGCCCTTGGAAGCCGGCAGAAGG - Intergenic