ID: 1125513245

View in Genome Browser
Species Human (GRCh38)
Location 15:40303916-40303938
Sequence GCCTCCACCTTGGTGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 208}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125513234_1125513245 24 Left 1125513234 15:40303869-40303891 CCTCTGGAGCCACCCTTCCAGGC 0: 1
1: 0
2: 2
3: 28
4: 310
Right 1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 208
1125513237_1125513245 11 Left 1125513237 15:40303882-40303904 CCTTCCAGGCCATTCTGTACTCC 0: 1
1: 0
2: 0
3: 16
4: 219
Right 1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 208
1125513238_1125513245 7 Left 1125513238 15:40303886-40303908 CCAGGCCATTCTGTACTCCCCAG 0: 1
1: 0
2: 1
3: 16
4: 229
Right 1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 208
1125513236_1125513245 12 Left 1125513236 15:40303881-40303903 CCCTTCCAGGCCATTCTGTACTC 0: 1
1: 0
2: 0
3: 29
4: 312
Right 1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 208
1125513235_1125513245 15 Left 1125513235 15:40303878-40303900 CCACCCTTCCAGGCCATTCTGTA 0: 1
1: 0
2: 2
3: 26
4: 273
Right 1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 208
1125513239_1125513245 2 Left 1125513239 15:40303891-40303913 CCATTCTGTACTCCCCAGCATCC 0: 1
1: 0
2: 4
3: 29
4: 335
Right 1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 208
1125513240_1125513245 -10 Left 1125513240 15:40303903-40303925 CCCCAGCATCCATGCCTCCACCT 0: 1
1: 1
2: 4
3: 33
4: 510
Right 1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125513245 Original CRISPR GCCTCCACCTTGGTGCAGCC AGG Intronic