ID: 1125513245

View in Genome Browser
Species Human (GRCh38)
Location 15:40303916-40303938
Sequence GCCTCCACCTTGGTGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 208}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125513240_1125513245 -10 Left 1125513240 15:40303903-40303925 CCCCAGCATCCATGCCTCCACCT 0: 1
1: 1
2: 4
3: 33
4: 510
Right 1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 208
1125513238_1125513245 7 Left 1125513238 15:40303886-40303908 CCAGGCCATTCTGTACTCCCCAG 0: 1
1: 0
2: 1
3: 16
4: 229
Right 1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 208
1125513239_1125513245 2 Left 1125513239 15:40303891-40303913 CCATTCTGTACTCCCCAGCATCC 0: 1
1: 0
2: 4
3: 29
4: 335
Right 1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 208
1125513234_1125513245 24 Left 1125513234 15:40303869-40303891 CCTCTGGAGCCACCCTTCCAGGC 0: 1
1: 0
2: 2
3: 28
4: 310
Right 1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 208
1125513237_1125513245 11 Left 1125513237 15:40303882-40303904 CCTTCCAGGCCATTCTGTACTCC 0: 1
1: 0
2: 0
3: 16
4: 219
Right 1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 208
1125513235_1125513245 15 Left 1125513235 15:40303878-40303900 CCACCCTTCCAGGCCATTCTGTA 0: 1
1: 0
2: 2
3: 26
4: 273
Right 1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 208
1125513236_1125513245 12 Left 1125513236 15:40303881-40303903 CCCTTCCAGGCCATTCTGTACTC 0: 1
1: 0
2: 0
3: 29
4: 312
Right 1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125513245 Original CRISPR GCCTCCACCTTGGTGCAGCC AGG Intronic
900158073 1:1211532-1211554 GCGTCCACCTTGGTGGGCCCAGG + Exonic
901167980 1:7233381-7233403 TCCTGCTGCTTGGTGCAGCCAGG - Intronic
901402614 1:9025139-9025161 GCCTCCACCTCCCTCCAGCCTGG + Intronic
901429427 1:9203901-9203923 ACCTCAGCCTGGGTGCAGCCAGG - Intergenic
902199824 1:14825036-14825058 GCATCCCCCTTGCTGAAGCCGGG + Intronic
904310129 1:29623778-29623800 GTCTCCTCCTGGGTGCTGCCTGG + Intergenic
905740145 1:40362883-40362905 TCCTCCAGCTTGGAGCAGCAGGG + Intronic
906496075 1:46304801-46304823 GCTACCAAATTGGTGCAGCCAGG + Intronic
906663371 1:47598427-47598449 GACTTCAGCTTTGTGCAGCCAGG + Intergenic
907706453 1:56836670-56836692 GCCTCCAGCTGAGTGCGGCCAGG + Intergenic
912879148 1:113391005-113391027 GTCTCCCCCATGGTGCAGCGGGG + Exonic
913258159 1:116973902-116973924 CCCTCCACCCTGGAACAGCCTGG - Intronic
917512498 1:175679996-175680018 GCCTCCACCTAACTACAGCCTGG + Intronic
917910134 1:179635322-179635344 GAATCCACCTTGGTTCAGCCTGG + Intronic
919760892 1:201097439-201097461 GCCTCCACCTTTGCTCATCCCGG + Intronic
922096841 1:222450095-222450117 GCCTCCCCCAGGCTGCAGCCTGG + Intergenic
922534818 1:226372036-226372058 GCCTCCTCCTGGCTGCAGCTGGG - Intronic
922605731 1:226888808-226888830 GGCTCCACCTTGGTCCTGCAGGG + Exonic
923826121 1:237502693-237502715 ACCTCCTCCCTTGTGCAGCCTGG + Intronic
924807926 1:247376101-247376123 GGCTTCACCTTGCTGCTGCCTGG - Intergenic
1063435704 10:6028141-6028163 GGTTCCACCTGGGTGCTGCCGGG - Intronic
1064807079 10:19147615-19147637 GCATCCATCTTTGTGCATCCAGG - Intronic
1069490496 10:68856672-68856694 CCCTCCTCCTTGCTGCAGCGTGG + Intronic
1069529835 10:69208874-69208896 GCTTCCAGATTGGTGCAGCAAGG + Exonic
1070777924 10:79120848-79120870 CCCACCACCTTGGTGGAGGCAGG - Intronic
1071596812 10:86933861-86933883 GCCTCCACCCAGGTGGAGACAGG + Intergenic
1072626688 10:97116705-97116727 GCCTCCTCTCTGGTGCAGGCTGG + Intronic
1075554827 10:123422817-123422839 GTCACCACCTTGCTGCAGTCTGG + Intergenic
1076308633 10:129485356-129485378 TCCTCCTCCTTGGCACAGCCTGG + Intronic
1076763019 10:132615080-132615102 CCCTCCATCTGAGTGCAGCCTGG - Intronic
1076808064 10:132869214-132869236 GTCTCGCCCTTGGTGCGGCCAGG - Intronic
1077067074 11:646376-646398 GCCTCCACTCTGGGGCAACCAGG + Intronic
1077162408 11:1119770-1119792 GACTGCACCGTGGGGCAGCCAGG + Intergenic
1077182119 11:1221430-1221452 GCTTCCCCCATGGAGCAGCCTGG + Intergenic
1078582191 11:12547252-12547274 GGTTCCTCCTTGGAGCAGCCTGG + Intergenic
1078836548 11:15035485-15035507 GCCTGCACCATGGAGCAGGCAGG - Intronic
1078836549 11:15035488-15035510 GCCTGCTCCATGGTGCAGGCTGG + Intronic
1079807653 11:24954625-24954647 GCCTCCACCATGCTGCTGCATGG + Intronic
1080882327 11:36334040-36334062 CCTTCCTCCATGGTGCAGCCTGG - Intronic
1081871415 11:46384289-46384311 GCCTCCACCCTGCAGAAGCCAGG + Intergenic
1081973029 11:47213162-47213184 GTGTCCACCTAGGAGCAGCCTGG - Intergenic
1082909521 11:58354366-58354388 GCCAGCACCTTGGTGCAGGGAGG - Intergenic
1083158858 11:60842333-60842355 GCCTGCACCCTGCTGCAGACGGG - Exonic
1083603214 11:63961622-63961644 GGCTCCAGCTTGGTGAAGACTGG - Intergenic
1083859256 11:65411316-65411338 AGCTACACCGTGGTGCAGCCCGG + Exonic
1084009617 11:66340281-66340303 GCCTCCACCATGGGCCGGCCTGG + Intronic
1086541187 11:87914861-87914883 GCTTCCACTTTGGAGCAGTCAGG + Intergenic
1088979113 11:114845758-114845780 GCCTCCACCTTGGTTTTGCTGGG - Intergenic
1096596412 12:52698710-52698732 GCCTCCACCTTTCCTCAGCCAGG + Intronic
1096980270 12:55724602-55724624 GCCCCCACCCTGGTACTGCCTGG + Exonic
1097275212 12:57808502-57808524 GTCTCCACATTGGTGCTGCTGGG + Exonic
1100015744 12:90008843-90008865 GTCCCCACCTGGGTCCAGCCTGG - Intergenic
1100617831 12:96245010-96245032 GCGGCCACCTTGCTGCATCCTGG - Intronic
1102148017 12:110669316-110669338 CCCTCCACCTGCCTGCAGCCAGG + Intronic
1102504017 12:113372557-113372579 GCCTCCGCTCTGGGGCAGCCTGG + Intronic
1102974608 12:117197479-117197501 GCCTCTCCCTTGCTGCAGCAAGG + Intergenic
1107031092 13:35854442-35854464 GTCTCAGCCTTGGTGCAGACAGG - Intronic
1108029200 13:46211576-46211598 GGCTGCACTTTTGTGCAGCCGGG - Intronic
1114534166 14:23412523-23412545 GCCTTCTCCCTGGTCCAGCCAGG - Intergenic
1118892014 14:69918341-69918363 GCCTCCACCTCTGAGCAGCTGGG + Intronic
1119379269 14:74218356-74218378 ACCCCCACCTTGGGGCAGGCTGG - Intergenic
1119620031 14:76125098-76125120 TCCTGCACCTTGGTGGAGACAGG + Intergenic
1122037505 14:98959574-98959596 GCATACAGCTTGGTGAAGCCAGG + Intergenic
1122797107 14:104211502-104211524 GCCTCCTCCCTGGTGAGGCCTGG - Intergenic
1122818683 14:104328779-104328801 GCCTTCACCTGGCTGCAGGCAGG + Intergenic
1122864185 14:104596127-104596149 GCCTCCACCCTGGGGTAGCTGGG - Intronic
1122918336 14:104869000-104869022 GCCTTCACCAGGGTGCAGCTGGG - Intronic
1124093146 15:26624809-26624831 CCCTCCACTCTCGTGCAGCCGGG + Intronic
1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG + Intronic
1127497162 15:59524180-59524202 GCCTCCACATTGATACAGCCAGG - Intergenic
1128759790 15:70208634-70208656 GCTTCCAGCTGGGTTCAGCCAGG - Intergenic
1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG + Intergenic
1132378433 15:101348231-101348253 GCCTCCCCCACGGTGAAGCCTGG - Intronic
1132530478 16:445837-445859 GCCTCCCCCAGGGAGCAGCCAGG - Intronic
1132552543 16:559530-559552 GCTTGGAACTTGGTGCAGCCCGG + Intergenic
1135869486 16:26136357-26136379 TCCTCCTCCTTCATGCAGCCAGG + Exonic
1136996695 16:35195596-35195618 GCCTCCAGCCTGGGGCAGCTGGG - Intergenic
1137009467 16:35308878-35308900 GCCTCCAGCCTGGGGCAGCTGGG - Intergenic
1137023366 16:35451730-35451752 GCCTCCAGCCTGGGGCAGCTGGG - Intergenic
1138514037 16:57526127-57526149 GCCTCCACCTTGGTCCCCGCAGG - Exonic
1138781847 16:59797926-59797948 GCTTCAAGCTTGGTGCAGGCTGG - Intergenic
1139390099 16:66601881-66601903 GCCTCCTCCATGGGGCAGACAGG - Intergenic
1141791888 16:86242704-86242726 ACCTCCACGCTGGTGCGGCCAGG - Intergenic
1141839969 16:86568002-86568024 GTCTCCACCTTGGTGATGACCGG - Exonic
1141997508 16:87644860-87644882 CCCTCCTCCTTGGTGCCGTCCGG - Exonic
1142156051 16:88533333-88533355 GCCTCCACCTTGATGCTCCTGGG - Exonic
1143517113 17:7425458-7425480 GGCTCCTACTTGGTGGAGCCTGG - Intergenic
1144847327 17:18226671-18226693 CACTCCACCTTGGTGCAGAAAGG - Intronic
1145239825 17:21234123-21234145 GCCTCCACCCTTGTACAGGCAGG - Intergenic
1147165917 17:38593273-38593295 GCCCCCACCTGGCTGCAGCACGG + Intronic
1147315406 17:39617919-39617941 GCCTCCCGCTTGGGGGAGCCGGG + Intergenic
1147376696 17:40026898-40026920 GACTCCACTTTGGTGGAGTCGGG + Exonic
1148131382 17:45264483-45264505 GCCCCCACCTTGCTGCTGCGAGG + Exonic
1148547590 17:48529614-48529636 GCTGCCTCCTTGGGGCAGCCTGG + Exonic
1148563015 17:48616948-48616970 GCCACCACCATCGTGAAGCCGGG - Intronic
1149472920 17:56933704-56933726 GGCACCACCGTGGTCCAGCCTGG - Intergenic
1150127731 17:62649151-62649173 CCCTCCACCATGGTGCCTCCTGG + Intronic
1151348973 17:73520341-73520363 GCCTTGACCTTGGTCCAGCAAGG - Intronic
1151758560 17:76088249-76088271 CTCTCCCCCTTGGTCCAGCCTGG - Intronic
1152158114 17:78648243-78648265 GCCTCGGCCTTGCTGCAGTCCGG - Intergenic
1152231878 17:79117909-79117931 GCCACCTCCCTGGTGCAGCCAGG - Intronic
1152420695 17:80191482-80191504 GCCTCCAGCTCGGGTCAGCCGGG - Intronic
1153980229 18:10302598-10302620 CCCTCCACCTTGGCTCTGCCTGG - Intergenic
1158972221 18:62679264-62679286 GCTTCCACTTGGCTGCAGCCAGG - Intergenic
1160833639 19:1114451-1114473 TCCTCCACCTTGCTGCGGTCTGG - Intronic
1161684380 19:5695767-5695789 GGCCCCACCATGGGGCAGCCTGG + Intronic
1161746982 19:6066602-6066624 GCCTCTGCGTTTGTGCAGCCTGG + Intronic
1161816266 19:6501850-6501872 GCCTCCCCCGGGCTGCAGCCTGG - Intronic
1161973336 19:7595991-7596013 GCCTCCACCATGGCGGCGCCGGG - Exonic
1162095286 19:8306504-8306526 GCTTCCTCCTGGGTGCGGCCAGG + Intronic
1165059366 19:33197581-33197603 GGCTCCACCGTGCTCCAGCCTGG + Intronic
1165616616 19:37207306-37207328 ACCTGCACCTTGGTGTATCCAGG - Intronic
1167252077 19:48404740-48404762 GGCTCCACCTTCCTGCAGCTGGG + Exonic
1168176896 19:54633033-54633055 GTCTCCCTCTCGGTGCAGCCGGG + Exonic
1168182615 19:54672365-54672387 GCCTCCCTCTTGGTGCAACCAGG + Intronic
1168187689 19:54710124-54710146 CCCTCCCTCTCGGTGCAGCCGGG + Intergenic
925743764 2:7028106-7028128 GACTCCTCCTTGGGGCCGCCAGG - Intronic
926152384 2:10432393-10432415 GACTCCGGCTTGGGGCAGCCTGG + Intergenic
926795863 2:16618345-16618367 CACTCCCCCTGGGTGCAGCCAGG + Intronic
927267204 2:21163480-21163502 GCCCCCACCCTAGTGCAGCCAGG - Intergenic
927683328 2:25154466-25154488 GTCTCCACCTTGGCTTAGCCTGG - Exonic
927972180 2:27312705-27312727 GCATCCACTTTGGTGGTGCCAGG + Exonic
928800360 2:35082355-35082377 CACTCCACCTTGTTGCTGCCAGG - Intergenic
931176381 2:59858935-59858957 GCCTCTGCCTTGGTGGTGCCAGG - Intergenic
932419228 2:71591838-71591860 TCCTCCAGCTCTGTGCAGCCAGG + Intronic
934518878 2:95007005-95007027 CCCTCCAGCCTGCTGCAGCCAGG + Intergenic
935271083 2:101435061-101435083 GCCGCCAGCGCGGTGCAGCCTGG + Intronic
937049297 2:118875459-118875481 GCGTCCTCCTTGGTCCTGCCTGG - Intergenic
940445858 2:153776764-153776786 GCTTCAACCTTAGTGCAGCCGGG + Intergenic
946232144 2:218298192-218298214 GCATCCACCATGCTGCAGGCAGG + Intronic
947156036 2:227164122-227164144 GCCTCCAACTTGCGGCCGCCGGG - Intergenic
947714032 2:232330945-232330967 GCCCCCTCCTAGGTGCTGCCTGG - Intronic
947733240 2:232442325-232442347 GCCCCCTCCTAGGTGCTGCCTGG - Intergenic
948477099 2:238227259-238227281 GACTCAGCCTTGGTGCAGACTGG + Intronic
1169022375 20:2339782-2339804 GCCTGCACCTTGGTGAGGGCTGG - Intronic
1170635287 20:18099119-18099141 GCCTCACCCTTGGTGTTGCCTGG + Intergenic
1171181703 20:23095689-23095711 GCTTCCTCCTTAGTGCCGCCAGG + Intergenic
1171495926 20:25555179-25555201 GCGTCTAGCTTGGTGGAGCCTGG + Intronic
1171524123 20:25796443-25796465 GCCTCCAGTTTGGGGCAGCGTGG + Intronic
1171552704 20:26059440-26059462 GCCTCCAGTTTGGGGCAGCGTGG - Intergenic
1172163813 20:32886583-32886605 GACTCCCCCTTGGTGCACCAAGG - Intronic
1172704562 20:36873285-36873307 GCCTCCACCTGGGTGCCTCTGGG - Intergenic
1173499087 20:43539405-43539427 GCCTCCCCCTTGGTGGGGCCTGG - Intronic
1173575806 20:44112449-44112471 GGCTCCAACTGGGTACAGCCTGG - Exonic
1174105079 20:48156205-48156227 GCCTCCATCTTCATGAAGCCAGG - Intergenic
1176976257 21:15326199-15326221 GCCCCCACCTTCGTGTGGCCAGG + Intergenic
1177107266 21:16975278-16975300 GGCTCCAGCTTGGGGCAGTCTGG + Intergenic
1179359245 21:40690006-40690028 GCCTCCACCCCGGCACAGCCTGG + Intronic
1179417405 21:41209332-41209354 GCCTCCCCCTGGGAACAGCCTGG - Intronic
1179941530 21:44641784-44641806 CCCTCCACCTTGGTAGAGGCTGG - Intronic
1180007509 21:45029669-45029691 GCCTTCTCCAGGGTGCAGCCTGG + Intergenic
1180880648 22:19201390-19201412 GCTTCCACCTTGGTTCACCTCGG - Exonic
1181051705 22:20241085-20241107 GCCTCCTCCTGGGGGCTGCCCGG + Intergenic
1181120420 22:20664269-20664291 GTGTCCACCGTGGTGGAGCCTGG + Intergenic
1182665224 22:31953734-31953756 GCCTCCACTCTGGTCAAGCCAGG - Intronic
1183352590 22:37342497-37342519 CCCTCCCCCGAGGTGCAGCCCGG + Intergenic
1184024930 22:41848513-41848535 GCCCCACCCTTGCTGCAGCCAGG - Intronic
1184090733 22:42291731-42291753 GACTCCACCTTTGCCCAGCCTGG - Intronic
1184646110 22:45896346-45896368 GCCTCCACCTTGGTCAACCATGG - Intergenic
1184889362 22:47369995-47370017 CCCGCCACCTTCATGCAGCCAGG + Intergenic
1185020261 22:48370429-48370451 GCCTCCACCTCCGCACAGCCTGG + Intergenic
949849759 3:8411104-8411126 TTCTCCTACTTGGTGCAGCCCGG + Intergenic
953564737 3:44021861-44021883 GCCCCCAACTTGCTGCAGCGGGG - Intergenic
955356388 3:58236486-58236508 GCCTCCACGCTGGTGGAGCCTGG - Intergenic
958798812 3:98733160-98733182 GCCACCTCCTTGGTGCTGGCAGG - Intronic
960997026 3:123347027-123347049 GCGGCCACTTGGGTGCAGCCTGG + Intronic
963091449 3:141487072-141487094 GCCGCCGCCATGGTGCCGCCCGG - Exonic
964542760 3:157798060-157798082 GGCTCCACCTTGGAAAAGCCTGG + Intergenic
969513208 4:7631537-7631559 TCCTCCACTTTGGCCCAGCCTGG + Intronic
969645828 4:8428299-8428321 GCCTCCACCTTCGGGCTCCCCGG + Intronic
969694249 4:8725772-8725794 GCCTCCTCCACGGTGAAGCCTGG + Intergenic
970429618 4:15976836-15976858 GCCTCCAGCTGGGGGCAGCATGG + Intronic
970909942 4:21263209-21263231 GTCTCTACCTTAGTGCTGCCTGG - Intronic
972480080 4:39488466-39488488 GCCTCCTGCTTGGGGCAGCTCGG - Intergenic
973224593 4:47768240-47768262 TCCTTCACCTGGGTGCAGGCGGG - Intronic
973531919 4:51843577-51843599 GCCTCCACCTCCATGCACCCCGG - Intronic
975387238 4:73771388-73771410 ATCTCCACCTTAGTGAAGCCAGG + Intergenic
983394334 4:167174499-167174521 GCCTCCTCCTTGTTTCAACCCGG - Intronic
985484453 5:140695-140717 CCTTCCTCTTTGGTGCAGCCGGG - Exonic
985971318 5:3380876-3380898 GCCTCCACCTTGGGGCCACCTGG + Intergenic
986068516 5:4259465-4259487 ACCTCCACCATGCTGCAGCTTGG - Intergenic
992173165 5:74124025-74124047 TCCTCAGCCTTGGTGCAGTCAGG - Intergenic
996710916 5:126542821-126542843 GCCTCCTCACTGCTGCAGCCAGG + Exonic
999378495 5:151103684-151103706 GCCAGCACCCTGGTGGAGCCAGG + Exonic
1002057343 5:176606063-176606085 TCCTCTCCCTGGGTGCAGCCCGG + Intronic
1006514722 6:34539487-34539509 GCCTCCACCCTGCCGCTGCCTGG + Intronic
1020036030 7:4963577-4963599 GGCTCCAGCTTGGCCCAGCCTGG + Intergenic
1021703838 7:23347217-23347239 GGCCCCACCTTGGAGCAGCAGGG - Intronic
1022666473 7:32415999-32416021 CCCTCCACCCTGGTGGAGCCTGG - Intergenic
1023758758 7:43444607-43444629 GGCTCCTCCTTGGTGCTGGCTGG - Exonic
1024508634 7:50184949-50184971 GCCTTGCCCCTGGTGCAGCCGGG + Intergenic
1027853111 7:83473975-83473997 GCCTCACCCTTGGAGCAGCTGGG - Intronic
1029494834 7:100891043-100891065 GCCTCCCCATGGGTGAAGCCTGG + Exonic
1031836240 7:126685078-126685100 GCCCCCACCTTCACGCAGCCGGG + Intronic
1034526252 7:151664811-151664833 GCCTTCACCTGGGTGAGGCCAGG - Intronic
1037539341 8:19856278-19856300 GCCTCCACCTTGGAGCTCCCTGG - Intergenic
1037728098 8:21500752-21500774 GCAGAGACCTTGGTGCAGCCTGG + Intergenic
1037809298 8:22077119-22077141 AGCTCCTCCATGGTGCAGCCTGG - Intronic
1038426487 8:27467432-27467454 GCAGCCCCCTTGGAGCAGCCAGG + Intronic
1039583210 8:38683593-38683615 GCCTCCGCCGTGGTGCTGGCTGG + Intergenic
1040439986 8:47431096-47431118 GACTCCACCATGCTGCACCCTGG - Intronic
1044409237 8:91866968-91866990 ACCCCCACCCTTGTGCAGCCAGG + Intergenic
1048440595 8:134456689-134456711 GCCTCCACCCAGAGGCAGCCAGG + Intergenic
1049346312 8:142140964-142140986 GGCTCCTCCTTGGTGTACCCAGG + Intergenic
1049594741 8:143478123-143478145 CTCTCCACCTGGGTCCAGCCAGG + Intronic
1050717028 9:8541478-8541500 GCCTCCACTCTGGAGCAGCTAGG + Intronic
1053792184 9:41694667-41694689 CCCTCCACCCTCGTGCAGCAAGG + Intergenic
1054180594 9:61906687-61906709 CCCTCCACCCTCGTGCAGCAAGG + Intergenic
1054472762 9:65551299-65551321 CCCTCCACCCTCGTGCAGCAAGG - Intergenic
1054656997 9:67674455-67674477 CCCTCCACCCTCGTGCAGCAAGG - Intergenic
1056075713 9:83036925-83036947 TCCTCCACCATGGTGCACCATGG + Intronic
1056717951 9:89048777-89048799 TCCTCCAGCAGGGTGCAGCCTGG - Intronic
1056731894 9:89173097-89173119 GCCTTCAACTTGCTGCAGCCAGG + Intronic
1057087610 9:92226107-92226129 TCCACCACCTTGGTGGAACCTGG + Intronic
1058713136 9:107698368-107698390 GACTGCACATTGGTGCAGGCTGG + Intergenic
1059804123 9:117780013-117780035 GCCTACAGCTTGGTGAAGACAGG + Intergenic
1060521238 9:124295176-124295198 CCCTGCACCTTAGAGCAGCCAGG + Intronic
1061083551 9:128386261-128386283 GCCTCCATCTTGGTACTGTCTGG - Intronic
1062534099 9:137014029-137014051 GCCTCCACCTCTGTGCAGAGAGG + Exonic
1193708982 X:84856884-84856906 GGCCCCGCCTTGGAGCAGCCAGG - Intergenic
1199988432 X:152969291-152969313 CCTTCCAATTTGGTGCAGCCAGG - Intronic