ID: 1125513555

View in Genome Browser
Species Human (GRCh38)
Location 15:40305763-40305785
Sequence AAACAGGTGCTGTCATAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125513555_1125513556 -10 Left 1125513555 15:40305763-40305785 CCAATTTATGACAGCACCTGTTT 0: 1
1: 0
2: 1
3: 7
4: 167
Right 1125513556 15:40305776-40305798 GCACCTGTTTAAATAGAACTTGG 0: 1
1: 0
2: 1
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125513555 Original CRISPR AAACAGGTGCTGTCATAAAT TGG (reversed) Intronic
901792404 1:11661311-11661333 AAACAACTGCTGTCAGAAAAGGG + Exonic
902186886 1:14732154-14732176 AAACAAATGCTGTCATCAAAGGG - Intronic
903339691 1:22645863-22645885 ATAGAGGATCTGTCATAAATGGG + Intronic
909046669 1:70719009-70719031 AAACAGGAGCTGGCTTAATTAGG + Intergenic
909863369 1:80635891-80635913 AAACAGGTGCTCTCAAATACAGG + Intergenic
912893769 1:113563254-113563276 TGACAGATTCTGTCATAAATGGG - Intronic
915741660 1:158123311-158123333 AAACAGGTGATGCCACAAATTGG - Intergenic
921665249 1:217862196-217862218 AAACAGGTGAAGTCATTAAAAGG - Intronic
922568012 1:226614026-226614048 TAACAGGTGCTCTCATATACAGG - Intergenic
922625653 1:227038924-227038946 AAACAGGTGCTATCATCGTTTGG - Intronic
922777963 1:228225995-228226017 AATCAGGTGAGGCCATAAATGGG - Intronic
923772364 1:236948694-236948716 GAGCAGGTGCTGGCAGAAATTGG - Intergenic
924856121 1:247876577-247876599 AATCAAGTGCTGACCTAAATGGG - Exonic
1062765073 10:55725-55747 AGACAGTTTCTGTAATAAATAGG - Intergenic
1065661113 10:28004972-28004994 AAACAGGTGGAGACATAAACTGG - Intergenic
1068205804 10:53851207-53851229 AGAGAGGTGCTGTTTTAAATAGG - Intronic
1069526579 10:69177357-69177379 ATCCAGGTTCTGTCCTAAATTGG - Intergenic
1070902747 10:80044907-80044929 AAAGAGGTCCTGGCTTAAATAGG + Intergenic
1072875631 10:99170034-99170056 AAACAGGTGGTGGCAGAATTTGG + Intronic
1072971624 10:100022318-100022340 TAACAGATGGTGTCAGAAATGGG + Intergenic
1075214854 10:120523422-120523444 AAACAGGTGCTCACTTAAAATGG - Intronic
1076247312 10:128957502-128957524 AAACAGGTGCTGATTGAAATGGG - Intergenic
1077468226 11:2743885-2743907 AAACAGGTGTTGTCACAGAACGG + Intronic
1078848125 11:15140146-15140168 AACCAGGTGCTGGCACACATGGG + Intronic
1085061221 11:73448910-73448932 AAACAGGAGCTTAAATAAATAGG - Intronic
1085585418 11:77699630-77699652 AAACAGGCACTGTCATACACTGG + Intronic
1085940837 11:81204737-81204759 AATCAGGTCCTGTGATAAACAGG - Intergenic
1087580580 11:100046803-100046825 GAACAGTTGTTGTCATATATTGG + Intronic
1092087190 12:5772882-5772904 AAACACGTGCTGTCAAGAAGGGG + Intronic
1092197411 12:6557657-6557679 AAACAGATGGTGTCAGAAAATGG + Intronic
1093092190 12:14934674-14934696 AAACAGGTACTGTAATGAAATGG - Intronic
1094114481 12:26895711-26895733 CAACAGTTGCTGTTATCAATTGG - Intergenic
1094815276 12:34177219-34177241 AGACAGTTTCTGTAATAAATAGG - Intergenic
1096038694 12:48495090-48495112 AAGCAGGTGCAGTCATACAAGGG + Intronic
1096239725 12:49953394-49953416 AAAGAGGTGATTTCATAACTGGG - Intronic
1099798715 12:87430382-87430404 CAACAGGTGGTGTCAGAAGTGGG + Intergenic
1102349239 12:112179872-112179894 AAACAGGTGATCTCATTCATAGG + Intronic
1102628251 12:114253797-114253819 AAAAAAATGCTGTCACAAATTGG - Intergenic
1105722703 13:23132820-23132842 AAAATGGAGCTGTCATGAATGGG + Intergenic
1106002112 13:25733873-25733895 AAAAAGGTGCTGACATCAAAGGG - Intronic
1106042874 13:26110584-26110606 AAACAGGTCCTTTCATTAGTAGG + Intergenic
1108738817 13:53313697-53313719 AAACTGGGCCTTTCATAAATGGG + Intergenic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1115051100 14:29064596-29064618 AGAGTGGAGCTGTCATAAATGGG - Intergenic
1115644400 14:35358038-35358060 AAACATAAGCTGTCACAAATAGG + Intergenic
1116235582 14:42275104-42275126 TAACAGATGGTGTCATAAATGGG - Intergenic
1117111682 14:52463387-52463409 TAACAGATGGTGTCAGAAATAGG - Intronic
1118147281 14:63153313-63153335 AATCAGGTGATGTCAGAAAGTGG + Intergenic
1118622707 14:67628529-67628551 AAATCTTTGCTGTCATAAATGGG - Intronic
1119991306 14:79200657-79200679 AAACAGGTGGTGAAACAAATTGG + Intronic
1121110679 14:91310769-91310791 AAAGAGGTGCTGACGTAAACTGG - Intronic
1123974441 15:25539566-25539588 AAAAATGTACTGTCCTAAATGGG - Intergenic
1125513555 15:40305763-40305785 AAACAGGTGCTGTCATAAATTGG - Intronic
1126817540 15:52468764-52468786 AAACAGGTATTTTCATATATTGG + Intronic
1127160045 15:56172944-56172966 AAACAAGTGTTTTCAGAAATTGG + Intronic
1129618994 15:77125965-77125987 AAACAGGTGCTGTTTATAATTGG + Intronic
1129803392 15:78434225-78434247 AAACAGCTGCGGTTATAAAACGG + Intergenic
1132650458 16:1019206-1019228 TTACAGGAGCTGTCTTAAATTGG + Intergenic
1133891113 16:9880019-9880041 AAACAGGTGTTGTTTCAAATGGG - Intronic
1134677469 16:16100605-16100627 AAACAGATGCTGACATTAAAGGG + Intronic
1137998388 16:53246036-53246058 AAACTGCTGCTGTCATAACCTGG - Intronic
1138063433 16:53915281-53915303 TAACAGGTGCTGTGATAAACAGG - Intronic
1138298447 16:55907031-55907053 AAACAGTTCCTGGCATAGATAGG + Intronic
1138933562 16:61691644-61691666 AAAGAGGTACTGTGACAAATAGG - Intronic
1142439575 16:90087590-90087612 AGACAGTTTCTGTAATAAATAGG + Intronic
1146760688 17:35475179-35475201 AAACAGAAGCTGGCAAAAATTGG - Exonic
1147463548 17:40591839-40591861 TAACAGATGCTGTCAGAAGTAGG + Intergenic
1149350237 17:55779309-55779331 TAAAAGGTGCTGTCAAAAAAAGG + Intronic
1149482381 17:57014198-57014220 AAACAGCAGCTGGCATAACTAGG - Intergenic
1151522373 17:74639590-74639612 AAACTGGAGCCCTCATAAATGGG - Intergenic
1152957993 18:56071-56093 AGACAGTTTCTGTAATAAATAGG - Intronic
1155668628 18:28342396-28342418 AATCAGAGACTGTCATAAATTGG + Intergenic
1155881264 18:31151693-31151715 AAACAGCTACTGACAGAAATAGG + Intronic
1161410438 19:4113984-4114006 AATTAGGTGTTGTCAAAAATTGG + Intronic
1165976879 19:39683783-39683805 AAACAGGTTCTGTGATACACAGG + Intergenic
925485634 2:4326487-4326509 AAACAAGTGCGGTCAGATATGGG + Intergenic
925951476 2:8916596-8916618 AAACAGGTGATGTCACCAAAAGG + Intronic
926645265 2:15283865-15283887 AAACCCATGCTGTCATCAATAGG + Intronic
929467431 2:42157887-42157909 AAACAGGTACTCTCATATACAGG - Intergenic
933797456 2:85931006-85931028 AAACAGGTACTGTCATGCACTGG + Intergenic
937401939 2:121591818-121591840 AAATAGGTGTGGTTATAAATGGG - Intronic
940606525 2:155930595-155930617 AAACAGGAGCTGTCTGACATAGG - Intergenic
942758541 2:179370548-179370570 TATCAGGTGCTGTCAGAAAGTGG - Intergenic
943135317 2:183903278-183903300 ACCCAGGAGCTGTCATGAATAGG - Intergenic
943797373 2:192013405-192013427 AAATAGGTGCTGTGTTAGATAGG - Intronic
943859506 2:192842854-192842876 AAACAGATGCAGTCAGACATTGG + Intergenic
945334970 2:208581551-208581573 AATCAGGTGCTGTCTAAAACAGG - Intronic
945798912 2:214400098-214400120 AACCAGGTGCTTTCCTACATGGG - Intronic
1169736820 20:8846647-8846669 AAACAGCTTCTGTCATGATTTGG - Intronic
1170659867 20:18327049-18327071 AAACACTTGATATCATAAATGGG - Intergenic
1171777093 20:29378963-29378985 AGACAGGTTTTGTAATAAATAGG - Intergenic
1171800089 20:29604227-29604249 TAACAGATGCTGTCAGAAGTGGG - Intergenic
1172741285 20:37169644-37169666 AAAAAGGTTCTATGATAAATAGG - Intronic
1172744004 20:37192738-37192760 AGATATGTGCTGTTATAAATAGG + Intronic
1175504436 20:59471479-59471501 GAACAAGTGTTGTCATTAATTGG - Intergenic
1177959569 21:27645863-27645885 AAAGAGGAGCCCTCATAAATGGG + Intergenic
1183887314 22:40895251-40895273 AAAGAAGTTCTGTCATAAAATGG - Intronic
1184777360 22:46629972-46629994 AAACAGGTTCAGCCATAAAAAGG - Intronic
950624532 3:14235167-14235189 AACAAGGTGCTGTGATAAAAGGG + Intergenic
950986895 3:17381946-17381968 AAACAGGTTCAGTTATATATGGG - Intronic
954866120 3:53731557-53731579 CAACCAGGGCTGTCATAAATGGG - Intronic
956342110 3:68236907-68236929 AAACATGTGCTGGAATTAATGGG + Intronic
956646171 3:71459082-71459104 GATAAAGTGCTGTCATAAATGGG + Intronic
956903424 3:73740873-73740895 AAACAGTTGCTGTCTTAGCTTGG + Intergenic
957798524 3:85043912-85043934 AAAAAGCTCCTATCATAAATAGG + Intronic
958495977 3:94845043-94845065 AAACAGAGACTATCATAAATTGG + Intergenic
959000927 3:100963637-100963659 AAACAGGGGCTAACATACATTGG - Intronic
959512284 3:107227174-107227196 AAACAGGTGTGGTAATGAATTGG - Intergenic
959858591 3:111190659-111190681 AGAGTGGAGCTGTCATAAATGGG - Intronic
962249124 3:133824196-133824218 TAAGTGGTGCAGTCATAAATGGG - Intronic
963403294 3:144829790-144829812 AAAGAGGTGCTGTAAAAACTTGG - Intergenic
963918822 3:150886469-150886491 AAACAGATGCTTTTATATATAGG + Intronic
964716389 3:159727008-159727030 AATCAGGTGGTGTCCTCAATGGG - Intronic
964882455 3:161439172-161439194 AAACAGGTGCTGGCAAGGATGGG + Intergenic
965969769 3:174540386-174540408 GAACAGGTGCTGTCAGAATGAGG - Intronic
967721888 3:192824724-192824746 AAACAGGTGACGTTATAAAAAGG - Intronic
969890686 4:10257087-10257109 AACCAAGTCCTTTCATAAATAGG - Intergenic
970756398 4:19431589-19431611 TAAAAGGTACTGTCATAAATAGG - Intergenic
971188575 4:24404852-24404874 AAAAAGCTGCAGTCACAAATTGG - Intergenic
972234560 4:37115881-37115903 AAAAAGGTGGTGACATAATTAGG + Intergenic
973258793 4:48140131-48140153 AAACTGTTACTGTCAGAAATGGG - Intronic
974732566 4:65887606-65887628 AAATAAATGCTGTCAAAAATGGG + Intergenic
979219404 4:118204266-118204288 AAACAGATGGTGTCAGAAGTGGG - Intronic
979551263 4:121993762-121993784 AAAAAGGTGCAGTTAGAAATTGG - Intergenic
980505969 4:133721763-133721785 AAACAAGTGCTATCATACAGTGG - Intergenic
981286188 4:143021531-143021553 AAACACATGCTTTCATAAAAAGG + Intergenic
981928450 4:150164978-150165000 AAACAAGTGTTGTCATAAATTGG - Intronic
984063100 4:175016714-175016736 ACACAGGTGGTGTTATGAATAGG - Intergenic
984349693 4:178574887-178574909 GAACAGATGCTGTTATCAATTGG - Intergenic
984597669 4:181689292-181689314 AAACAAGCACTGTCAGAAATTGG - Intergenic
985616522 5:926249-926271 AGAGAGGTGCTGTCATAAAGCGG - Intergenic
985718817 5:1478043-1478065 AAACTGATGCTGTCAGAAATGGG - Intronic
986589323 5:9352755-9352777 AAACAGGTGATGGGATAGATTGG - Intronic
986835285 5:11630435-11630457 TACCAGGTGCTGTCAAGAATTGG - Intronic
989606566 5:43249584-43249606 AAACAGGTGATGCCTTTAATAGG + Intronic
990763556 5:59157410-59157432 AAACAGGTGCTGTGGTTACTGGG + Intronic
993505965 5:88708764-88708786 AAATAAGTGATGTCAGAAATAGG - Intergenic
994172722 5:96675914-96675936 AAACAGTTGCTGTAGTAAAAAGG + Intronic
999015375 5:148098053-148098075 AAACAGCTTCTTTCATAGATGGG + Intronic
999030220 5:148282154-148282176 AAACAGGTGCTGTCACATTGGGG - Exonic
999801409 5:155041319-155041341 AAAATGTTGCTGTGATAAATGGG + Intergenic
1008043960 6:46832926-46832948 AAATAGGTACTGTTATAAACTGG - Intronic
1008896314 6:56560293-56560315 AAACAGATGTTGACAGAAATAGG - Exonic
1010067720 6:71704680-71704702 AAACAGGAACTGACATATATTGG - Intergenic
1012153413 6:95784841-95784863 AATCAGGTGCTGGAATAGATGGG - Intergenic
1012939412 6:105401839-105401861 AAACACTTTCTGGCATAAATTGG + Intronic
1018156336 6:160988774-160988796 AAATAAGTGATGTGATAAATAGG - Intergenic
1022052051 7:26685518-26685540 AAACCGGGGCTGACAAAAATCGG - Intronic
1022544268 7:31170939-31170961 AAAGAGGACCTGTCCTAAATTGG + Intergenic
1029295311 7:99535653-99535675 TAAAAGGTGCTGTCTTTAATAGG + Intergenic
1029453141 7:100653906-100653928 AAACAGTTGCTTTTATAAAGAGG + Intronic
1031947975 7:127861075-127861097 AAACAGCTAGAGTCATAAATGGG - Intronic
1034736683 7:153435296-153435318 ACTCAGCTGCTGTCATAATTAGG + Intergenic
1036389213 8:8310127-8310149 TCACAGGTGCTCTCATAAAACGG - Intergenic
1041032477 8:53752018-53752040 CAACAGTTGCTGTCTTGAATAGG + Intronic
1041463232 8:58134028-58134050 AAATATGTGCTGCAATAAATAGG + Intronic
1042108030 8:65349260-65349282 TTACAGGTGATCTCATAAATTGG + Intergenic
1042775890 8:72430855-72430877 GATCAGGTGCTATCATAAAGAGG - Intergenic
1044164747 8:88967855-88967877 ACACAGTAGCTGTCATAGATTGG - Intergenic
1045896614 8:107226245-107226267 AACCAGGTACTGTCGTAAACTGG - Intergenic
1062740174 9:138168531-138168553 AGACAGTTTCTGTAATAAATAGG + Intergenic
1186174439 X:6910280-6910302 AAAAAGATGCTATCATACATGGG - Intergenic
1187423228 X:19154805-19154827 AGACAGCTGCTGTCATAACCAGG + Intergenic
1187625736 X:21111379-21111401 AGTCAGGAGCTATCATAAATAGG + Intergenic
1188019864 X:25145234-25145256 ACACAGGTGCTTTTATAAACTGG + Intergenic
1189966777 X:46381803-46381825 CAACTGGTGCTCTCATAATTTGG + Intergenic
1190637382 X:52449543-52449565 AAACAGTGGCTGTCATCCATTGG + Intergenic
1190638319 X:52458082-52458104 AAACAGTGGCTGTCATTTATTGG - Intergenic
1190648648 X:52546716-52546738 AAACAGTGGCTGTCATTTATTGG - Intergenic
1190678339 X:52802362-52802384 AAACAGTGGCTGTCATTTATTGG + Intergenic
1191612383 X:63131509-63131531 AAACAGGTGATGACAAAGATGGG + Intergenic
1191623914 X:63247417-63247439 AAACAGGTGATGACAAAGATGGG - Intergenic
1193408635 X:81135940-81135962 AAACAGGTTGTGTTATAAAACGG + Intronic
1194134820 X:90128686-90128708 ATACACGTGCTGACATATATTGG - Intergenic
1196170708 X:112585509-112585531 AAACATCTGTTGTCATAAATTGG - Intergenic
1200480604 Y:3698789-3698811 ATACACGTGCTGACATATATTGG - Intergenic