ID: 1125515085

View in Genome Browser
Species Human (GRCh38)
Location 15:40314371-40314393
Sequence CACCTGTGTCTTCTATAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125515085_1125515090 1 Left 1125515085 15:40314371-40314393 CCACTTTATAGAAGACACAGGTG 0: 1
1: 0
2: 4
3: 16
4: 215
Right 1125515090 15:40314395-40314417 CCAGGAGGCCCAACTTCACATGG 0: 1
1: 0
2: 2
3: 28
4: 325
1125515085_1125515093 21 Left 1125515085 15:40314371-40314393 CCACTTTATAGAAGACACAGGTG 0: 1
1: 0
2: 4
3: 16
4: 215
Right 1125515093 15:40314415-40314437 TGGATGAGTCTTGTTCTCTGAGG 0: 1
1: 0
2: 2
3: 22
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125515085 Original CRISPR CACCTGTGTCTTCTATAAAG TGG (reversed) Intergenic
901761708 1:11476239-11476261 CAGTTGTCTCATCTATAAAGTGG - Intergenic
902250510 1:15152085-15152107 CAGCCTTCTCTTCTATAAAGTGG + Intergenic
902489089 1:16767656-16767678 CACCTGTTTCTTTTTAAAAGTGG + Intronic
904181649 1:28669991-28670013 CATCTGTGTCTACTAGGAAGTGG - Intronic
904944169 1:34187215-34187237 CACCTTTCTCATCTATAAAATGG - Intronic
905362214 1:37428973-37428995 CAGCTTTCTCTTCTATAAAATGG + Intergenic
905693090 1:39956677-39956699 CACCTTTCTTTTGTATAAAGTGG + Intronic
906278025 1:44532801-44532823 CACCTGTGTCTCCTGCAAATGGG + Intronic
907872543 1:58456024-58456046 CACTTGCGTCATCTATAAAACGG + Intronic
908404579 1:63801912-63801934 CAGCTTTGTTTTCTCTAAAGTGG + Intronic
910008173 1:82425846-82425868 CATATGTGTCCTCTGTAAAGAGG - Intergenic
910778208 1:90897627-90897649 CACCTGTGCTTTCTATCAAAGGG - Intergenic
910954845 1:92690949-92690971 CTCTTGTGTTTTCTATAAACTGG - Intronic
911048634 1:93650551-93650573 CAGTTGTGTCATCTATAAAATGG + Intronic
912478346 1:109957833-109957855 CACTATTGTCTTCTATAGAGTGG - Intergenic
914346888 1:146807579-146807601 CAGTGGTGTCTTCTATAATGAGG - Intergenic
915216673 1:154345053-154345075 CACCTGTGCCTTCTGCAAGGGGG - Exonic
915974103 1:160373668-160373690 CAACTATTTCTTCTATAAAGTGG - Intergenic
917005740 1:170415439-170415461 CACATGCTTCTTCTATAGAGAGG - Intergenic
917451652 1:175152251-175152273 CACTTCTCTCTTCTATAAAGGGG + Intergenic
917457255 1:175195676-175195698 AAGCTGTGTCTTTTATAATGTGG + Intergenic
918464258 1:184805877-184805899 CCCCTGTTTCTTTTGTAAAGTGG - Intronic
920151819 1:203915785-203915807 CAGCTGTTTCTTCTCTACAGTGG - Intergenic
920497809 1:206467936-206467958 CTCATGTGACTTCTACAAAGAGG - Intergenic
1063017766 10:2095643-2095665 AACCTGTGTCTTATATTAAGGGG + Intergenic
1063900621 10:10728709-10728731 CACCTGTCTCTGGTATACAGTGG + Intergenic
1067354253 10:45510814-45510836 CAGCTTTCTCCTCTATAAAGTGG + Intronic
1069796574 10:71056640-71056662 CAGTTGTTTCATCTATAAAGTGG - Intergenic
1070276824 10:75015307-75015329 CACCTGTATCTTTTAATAAGTGG + Intronic
1072731791 10:97851102-97851124 CACCTTTATCATGTATAAAGTGG - Intronic
1072750722 10:97976414-97976436 CACCTGTCTCACCTATAAAGTGG + Intronic
1074097149 10:110324015-110324037 CACCTATGTTATCTATTAAGTGG - Intergenic
1074549838 10:114432406-114432428 CACCTGTCTCTTCCATACACAGG + Intronic
1075651522 10:124130643-124130665 CGCCTGTGTCCTCTGCAAAGAGG - Intergenic
1076290158 10:129339883-129339905 CACCTGTTTTTTCAAGAAAGGGG - Intergenic
1079162011 11:18003989-18004011 CACCTGTTTCTTTTTTAAATAGG + Intronic
1080170307 11:29293904-29293926 CAGCTGTGTCATCTATGAATGGG - Intergenic
1080248492 11:30206441-30206463 CTCCTGTGTGTTCTTTAAAGGGG + Intergenic
1080565122 11:33501823-33501845 CAGCTGTCTCATCTATAAAATGG - Intergenic
1083774940 11:64889982-64890004 CACCTGTTTCTTATACAACGGGG - Intergenic
1085435534 11:76496816-76496838 CAACTATGTCATCTATAAATAGG + Intronic
1086194491 11:84121241-84121263 CAGTTGTCTCTTCTATAAAATGG + Intronic
1086333055 11:85773056-85773078 AACCTATGTCTTTTATACAGTGG - Intronic
1090086953 11:123658660-123658682 CACTTGTGTCCTCTGTGAAGAGG - Intergenic
1090334999 11:125956112-125956134 CACCTCTGTCTTCCACAAGGTGG - Exonic
1090812523 11:130258747-130258769 CAGCTTTGTATTCTAGAAAGGGG - Intronic
1090965563 11:131595060-131595082 CACCTGCGTCTTTAATTAAGGGG + Intronic
1091927534 12:4367876-4367898 CAGCCGTGTTTTCTTTAAAGAGG - Intergenic
1092063362 12:5568856-5568878 CAGCTTTCTCATCTATAAAGTGG + Intronic
1093776251 12:23077700-23077722 CAATTGTGTCTTCTGCAAAGAGG - Intergenic
1095668637 12:44833195-44833217 AACCTGGGTGTTCTACAAAGTGG + Intronic
1095938361 12:47709430-47709452 CTCCTGTGTATTTGATAAAGGGG + Intergenic
1097964838 12:65567880-65567902 GTCCTTTGTCTTCTATAGAGCGG - Intergenic
1098866109 12:75765664-75765686 CACCTCTGTCTTCTATGAATGGG - Intergenic
1100730533 12:97462594-97462616 ATCCTGTGTCTTTTACAAAGAGG - Intergenic
1102615647 12:114151856-114151878 CAGGTGTGTCTTTTATAAAGAGG - Intergenic
1104633396 12:130423430-130423452 CACCTGTGTTTTCAATGAAAAGG + Intronic
1107489852 13:40870658-40870680 CTGATGTGTCTTCTATAAAAGGG - Intergenic
1108403608 13:50077760-50077782 AATCTGTGTCTTCTAAAAAGGGG + Intergenic
1110517721 13:76436159-76436181 CACCTATGTCTTCTATTGTGAGG - Intergenic
1112396590 13:99038758-99038780 CACATGTGTATTCTTTAAAGGGG + Intronic
1119090815 14:71779515-71779537 CTCCAGTTTCTTCTAAAAAGGGG - Intergenic
1119243639 14:73084481-73084503 CCTCTGTGTTTTCTGTAAAGTGG + Intronic
1119974713 14:79012643-79012665 CACCTGTGTCTTCTGGAAAGTGG - Intronic
1122097039 14:99379893-99379915 CAACTTTGTCATCTATAAAATGG - Intergenic
1124177815 15:27442436-27442458 CATCTGTGTGTGCTATAAGGCGG - Intronic
1124192995 15:27596933-27596955 CACCTGTGTCATAGATAAAAAGG - Intergenic
1124900950 15:33821789-33821811 CAAATGTGTCTTTAATAAAGAGG + Intronic
1125515085 15:40314371-40314393 CACCTGTGTCTTCTATAAAGTGG - Intergenic
1125698904 15:41662166-41662188 AGCCTGTGTTTTCTGTAAAGTGG - Intronic
1125865989 15:43049885-43049907 CACCTGAGTGCTCTTTAAAGAGG + Intronic
1130723386 15:86412236-86412258 CACCAGTGTATTCTACAAAAGGG - Intronic
1133637777 16:7686009-7686031 CAACTGCCTCATCTATAAAGTGG + Intronic
1133672928 16:8041680-8041702 CAACTTTGTCCTCTATAAAATGG - Intergenic
1137666270 16:50251448-50251470 CAACTGTGTCATCTGTAAAGTGG - Intronic
1138253592 16:55530234-55530256 CCCCTATCTCATCTATAAAGTGG - Intronic
1138520185 16:57566613-57566635 GACCTGTGTCTTCTGGAAGGAGG + Exonic
1139987094 16:70907691-70907713 CAGTGGTGTCTTCTATAATGAGG + Intronic
1141616958 16:85215228-85215250 CACTTGTGTCATCTTTAAAATGG + Intergenic
1142078252 16:88132790-88132812 CACCTCTGACTTCACTAAAGAGG - Intergenic
1142847495 17:2689355-2689377 CACCTGTGTGTTCTGTAACCCGG - Intergenic
1143246410 17:5489695-5489717 CATCTGAGTCTTCTAATAAGTGG + Exonic
1143754187 17:9054473-9054495 CCCCTGTTTGTTCTATAATGGGG + Intronic
1144656362 17:17039746-17039768 CGTGTGTGTCTTCTATAAAATGG + Intergenic
1145823337 17:27857473-27857495 CCTCTGTTTGTTCTATAAAGTGG + Intronic
1146207702 17:30919321-30919343 CAGCTTTCTCTTCTGTAAAGTGG + Intronic
1146915523 17:36676069-36676091 CAGCTTTCTCATCTATAAAGTGG + Intergenic
1149744675 17:59084756-59084778 GACTGGTGTCCTCTATAAAGAGG + Intronic
1150812205 17:68365403-68365425 AACCTCTGTCATCTATAAAATGG - Intronic
1151335695 17:73438330-73438352 CACTTTCCTCTTCTATAAAGTGG + Intronic
1153571446 18:6477229-6477251 CATCTGTGTTTCCTATAAACTGG + Intergenic
1154269753 18:12909150-12909172 CACCAGTGTCATCTATAGTGGGG + Intronic
1156503032 18:37571605-37571627 CAGCTTTCTCTTCTATCAAGTGG + Intergenic
1156513665 18:37661961-37661983 CCCCTGTGTCATCTTTAAGGAGG - Intergenic
1161092005 19:2365496-2365518 CAGCTGTCTGTTCTATAAACGGG + Intergenic
1166256090 19:41605869-41605891 CACCTTTTTCCTCTTTAAAGTGG + Intronic
1166334039 19:42094859-42094881 CAGCTGTGTCTGATATCAAGTGG + Intronic
1168696512 19:58406889-58406911 CACCTGTGTATTCTCTCCAGTGG - Intronic
925732106 2:6926566-6926588 CACCTGTGTGTTCCATCAATAGG + Intronic
927079354 2:19612437-19612459 CAGCTGTGTTCTCTATAAAATGG + Intergenic
927207732 2:20620666-20620688 CCTCAGTCTCTTCTATAAAGTGG + Intronic
928741238 2:34355736-34355758 CACTTCTGTCATCTATAAAATGG - Intergenic
930336190 2:50049252-50049274 CACCTCTGTCTTCCATCATGTGG - Intronic
930515678 2:52404838-52404860 CACTTGTGTCATTTATAAAATGG - Intergenic
930828547 2:55718708-55718730 CACCTCCACCTTCTATAAAGTGG - Intergenic
933869582 2:86552784-86552806 CCCCTGTGTTTTCTATGAAATGG - Intronic
934683328 2:96302196-96302218 CACATCTCTCTTCTATAAAATGG + Intronic
935336105 2:102018400-102018422 AACCTGTTTCCTCTGTAAAGTGG + Intronic
937894837 2:126970982-126971004 CAGCTTTGTCATCTATAAAATGG + Intergenic
938169902 2:129066210-129066232 CACATGTGTATTTTATAAATAGG + Intergenic
940482242 2:154248865-154248887 CACCTGTGTCTTGAGGAAAGGGG + Intronic
941339390 2:164287441-164287463 TACCTGTTTCTTTTATAAGGTGG - Intergenic
942365860 2:175226836-175226858 CCCCTGTATTTTCTATAAATTGG - Intergenic
943901847 2:193449135-193449157 CAACTTTGTCTTCTATTAAAGGG + Intergenic
944896328 2:204169464-204169486 CCTCTGTTTCATCTATAAAGTGG - Intergenic
946136282 2:217650231-217650253 CACAGGTGTCTTCAAGAAAGAGG - Intronic
946602839 2:221370946-221370968 CGTCTGTGTCTTCTATCACGGGG - Intergenic
947807682 2:232979943-232979965 CAGCTGCCTCATCTATAAAGTGG - Intronic
1168934513 20:1651882-1651904 CACATGAGTCTTCTTTGAAGAGG - Intronic
1169693085 20:8355464-8355486 CTCCTGTGTCCTTTTTAAAGAGG - Intronic
1172948448 20:38706270-38706292 CACTTTTCTCTTCTATAAAATGG - Intergenic
1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG + Intronic
1179251691 21:39675920-39675942 CACTTGTGTCTGTTGTAAAGTGG - Intergenic
1182441792 22:30369046-30369068 CAGCTCTGTCATCTATCAAGTGG + Intronic
949321378 3:2814815-2814837 CAGCTGTGTCACCTATAAATTGG + Intronic
949984110 3:9525600-9525622 CATCTGTGTTTTTTATAAAAAGG + Intronic
950873475 3:16249409-16249431 CATCAGTTTCTTCTATAAAATGG - Intergenic
951008006 3:17641448-17641470 CAGCTATGTCATATATAAAGTGG + Intronic
952740244 3:36727688-36727710 CACTTGTCTCTTCCAGAAAGTGG + Intronic
953198102 3:40752936-40752958 AATCTGTGTCTACAATAAAGTGG + Intergenic
953670441 3:44957809-44957831 CACCTGTCTTTTCTAGACAGAGG + Intronic
953821259 3:46209274-46209296 CCCTTGTGTCTTCTATAAAGTGG + Intronic
957212341 3:77276097-77276119 CACCTGACTTTTCTATAAGGTGG - Intronic
958580419 3:96012386-96012408 TAACTGTGTCTTTTTTAAAGGGG - Intergenic
960268820 3:115651926-115651948 CTCCTCTGTCTTCTAGATAGAGG + Intronic
960360350 3:116703602-116703624 CACCTGTTTCCTCCTTAAAGAGG + Intronic
960485634 3:118249613-118249635 AACCTGTGTCTGTAATAAAGAGG + Intergenic
961543207 3:127614590-127614612 CACCTGTGTTTTCTGTAATTTGG + Intronic
962047310 3:131774355-131774377 CTCCTGTGTCTACAAGAAAGAGG - Intronic
962549761 3:136478144-136478166 GACCTGTGCCTTGAATAAAGTGG - Intronic
964413934 3:156427953-156427975 CACCTGTGTGTGCTTGAAAGGGG + Intronic
964667427 3:159189698-159189720 AACCTGAGTCTTCTTGAAAGAGG - Intronic
966017333 3:175157199-175157221 CGCCTGTGTATTCTATCATGAGG + Intronic
966677552 3:182605596-182605618 CACCTTTCTCATCTATAAAATGG - Intergenic
966952140 3:184830838-184830860 CACATAGGTCTTCTAAAAAGAGG - Intronic
968391630 4:197647-197669 CACCTTTTTCTGCTATAAAATGG + Intergenic
970505198 4:16722264-16722286 CACTTTTGTCCTCTGTAAAGTGG - Intronic
971045212 4:22798316-22798338 CATGTGTTTCTTCTATAAAATGG + Intergenic
971418040 4:26451523-26451545 CCTCTGTTTCTTCTGTAAAGGGG + Intergenic
971779965 4:31020662-31020684 ACACTTTGTCTTCTATAAAGTGG + Intronic
972226523 4:37019205-37019227 AACCTCTGGGTTCTATAAAGAGG - Intergenic
977027679 4:91840845-91840867 CAATTCTGTCTTCTACAAAGTGG - Intergenic
977295921 4:95209071-95209093 AACCTGAGTCTTTTATAATGAGG - Intronic
977438032 4:97025221-97025243 CAACAGTGTCTTCAATGAAGAGG - Intergenic
978084587 4:104635059-104635081 CACCTTTATCTTCTCTTAAGAGG - Intergenic
978914732 4:114110043-114110065 CAACTGTGTATTGAATAAAGAGG - Intergenic
979068398 4:116168457-116168479 TACCTGTGTTATCTATGAAGTGG - Intergenic
981716751 4:147759589-147759611 CACCTGTTTCCTTTTTAAAGGGG - Intronic
982197402 4:152930153-152930175 CACCTGTGCCTTCCACACAGTGG + Intergenic
982581418 4:157184443-157184465 CAACTGTTTCTTCAATAAATAGG - Intergenic
985875609 5:2591653-2591675 CACCTGTGTCTTACAAAGAGGGG + Intergenic
986020151 5:3794297-3794319 CACTTGTGCCTTCTGTAGAGAGG + Intergenic
986424647 5:7618618-7618640 CACATGTGTCACCTATTAAGTGG + Intronic
991996691 5:72394762-72394784 CACCTGATTCTGCTATAAAGAGG - Intergenic
992404254 5:76441799-76441821 CCCCTGTGCCATCCATAAAGAGG + Intronic
992780124 5:80120051-80120073 CAACTTCCTCTTCTATAAAGGGG + Intronic
992958579 5:81936182-81936204 CACCAGTGTCCTTTATAGAGTGG + Intergenic
994139598 5:96327150-96327172 CACATTTGTCATCTGTAAAGTGG + Intergenic
994703784 5:103173452-103173474 CACCTTAGTTTTCTCTAAAGTGG - Intronic
996689740 5:126327578-126327600 CAACTGTGTCTCCTAACAAGTGG - Intergenic
997676707 5:135718471-135718493 CATCTGTTTCTTCTGTAAAATGG + Intergenic
998648614 5:144092204-144092226 CACCTTTATCTCCTATAAAATGG + Intergenic
998952866 5:147409601-147409623 TACCTGCTTCTTCCATAAAGAGG - Intronic
1000128687 5:158273568-158273590 CACCTGTTACTTTTAAAAAGGGG - Intergenic
1001360555 5:171081033-171081055 CAATTTTGTCATCTATAAAGTGG - Intronic
1001739677 5:174042044-174042066 CAGTTGTCTCTTCTATAAAATGG + Intergenic
1004078416 6:12366705-12366727 CAGTTTTGTCTTCTGTAAAGTGG + Intergenic
1007925746 6:45648124-45648146 CCCCTGTGTCTTATATAACTTGG - Intronic
1008639630 6:53448567-53448589 CAGCTGTCTCATCTATAAAGTGG - Intergenic
1010036839 6:71335311-71335333 CAACTGTGACTTCTTTAAAATGG + Intergenic
1010798940 6:80151086-80151108 CAACTGTGTTTTCTATACAATGG + Intronic
1010810121 6:80290873-80290895 CCCCTATGTGTTCTAAAAAGGGG - Intronic
1011530719 6:88318061-88318083 AAACAATGTCTTCTATAAAGGGG + Intergenic
1012057228 6:94428424-94428446 CCCATGTCTCTTCTATAAAATGG + Intergenic
1012635208 6:101529647-101529669 CAACTGTGGAATCTATAAAGAGG + Intronic
1012699208 6:102432017-102432039 CACTGGTGGCTTCTAGAAAGTGG - Intergenic
1013905676 6:115215243-115215265 CACCTGTGTCTTCTTTAGAGAGG + Intergenic
1013979531 6:116113481-116113503 GAGCTGTCTCTTCTATACAGAGG + Intronic
1017346304 6:153386066-153386088 TACCTGTCTCATCTATAAAATGG - Intergenic
1018288723 6:162268635-162268657 CCCCTTTGTCTTCTATAAAGTGG - Intronic
1021939608 7:25666760-25666782 CCCTTGTATTTTCTATAAAGTGG + Intergenic
1027728806 7:81843208-81843230 GCTCTGTGCCTTCTATAAAGAGG + Intergenic
1029674056 7:102054254-102054276 CACCTGTGTTTTCTTTTAAGAGG + Intronic
1030006715 7:105127454-105127476 CAGCAGTGTCTGCTATACAGAGG - Intronic
1030113723 7:106047826-106047848 AAGCTGTGTCTTCTCCAAAGTGG - Intergenic
1032644859 7:133812351-133812373 TACTTGTGTCTTCTGTAAAATGG - Intronic
1033453705 7:141483551-141483573 AACCTGTGTCTTGTAAAAACAGG + Intergenic
1034293176 7:149948400-149948422 CACCTGCCTCTTCTGGAAAGTGG - Intergenic
1034812898 7:154148479-154148501 CACCTGCCTCTTCTGGAAAGTGG + Intronic
1037590738 8:20310048-20310070 CACCTTTGTCTTCAAGAAGGGGG + Intergenic
1041243699 8:55871274-55871296 GTCCTGTGTATTCCATAAAGTGG - Intergenic
1041578460 8:59428158-59428180 CAGATTTGTCTTCTGTAAAGTGG - Intergenic
1041714333 8:60920515-60920537 GAACTGTGTCTTCTCCAAAGAGG - Intergenic
1043114044 8:76225884-76225906 CACCTCTTTCTGCTAGAAAGAGG + Intergenic
1043936628 8:86149780-86149802 CAAGTGTCTCTTCTATAAAAAGG - Intronic
1044514045 8:93117854-93117876 CACCCATGTCTTCTGTAAACTGG - Intergenic
1045135869 8:99217670-99217692 CTCATGTGTCTTTTATAATGAGG - Intronic
1046482666 8:114843073-114843095 CAGCTTTGTCATCTATAAAGTGG + Intergenic
1049674015 8:143881818-143881840 CTCCTCTGTCTTCTATAAAATGG - Intergenic
1050622349 9:7467615-7467637 CACATATGGCTTCTTTAAAGGGG - Intergenic
1051552752 9:18348446-18348468 CACTAGTGTCATCTATAAAATGG + Intergenic
1051879577 9:21826445-21826467 CCCCTGTGTTTGCTATAAACTGG + Intronic
1052633460 9:31070983-31071005 CTCCTGTGTTTTCTTTTAAGTGG - Intergenic
1053124415 9:35568127-35568149 CCTCTGTCTCTTCTTTAAAGTGG - Intergenic
1054884019 9:70176025-70176047 CAATTGTGTCTTCTCCAAAGAGG - Intronic
1060346327 9:122819585-122819607 CACCAGGGTCTTGTTTAAAGGGG - Exonic
1061757435 9:132824779-132824801 CATCTCTGCCTTCTAAAAAGAGG - Intronic
1061857351 9:133449566-133449588 CACCTTTCTCTTCTGTAAAATGG + Intronic
1186466615 X:9788524-9788546 CAGCTGTTTCATCTATAAAATGG - Intronic
1186646168 X:11509374-11509396 CATCTCTGTCTTCTATATATAGG - Intronic
1187143039 X:16612846-16612868 CTCCGGTGTCCTCTGTAAAGTGG + Intronic
1188028599 X:25237967-25237989 CACCTGTTTCTTTTTTAATGTGG - Intergenic
1189148501 X:38680214-38680236 ATGCTGTGTCTTCTATTAAGTGG - Intronic
1193353796 X:80492762-80492784 TTTCTGTCTCTTCTATAAAGAGG - Intergenic
1193649289 X:84109975-84109997 CAACTGTGTGTGCTAAAAAGTGG + Intronic
1194866266 X:99072055-99072077 CACCTTTGTCTTACTTAAAGTGG - Intergenic
1197020160 X:121677288-121677310 CACCTCTGCCATCTATCAAGAGG + Intergenic
1197872688 X:131074207-131074229 CATCTGTGGCTTCTACAGAGTGG - Intronic
1199184621 X:144900637-144900659 CACCTGTATTTTCTAAAAAGTGG + Intergenic
1199414491 X:147565189-147565211 CAATTTTGTCATCTATAAAGTGG + Intergenic
1199858971 X:151782537-151782559 CACATCTGTCTTTTATAAATGGG + Intergenic
1202025979 Y:20524436-20524458 CACCTGTTCCTTCTATAGATAGG - Intergenic
1202275598 Y:23116111-23116133 CACCTGTGTTTTCTTCGAAGGGG - Intergenic
1202290430 Y:23304580-23304602 CACCTGTGTTTTCTTCGAAGGGG + Intergenic
1202428590 Y:24749830-24749852 CACCTGTGTTTTCTTCGAAGGGG - Intergenic
1202442201 Y:24920259-24920281 CACCTGTGTTTTCTTCGAAGGGG + Intergenic