ID: 1125515777

View in Genome Browser
Species Human (GRCh38)
Location 15:40320190-40320212
Sequence CCACACATTAAGTTGAACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125515777_1125515785 19 Left 1125515777 15:40320190-40320212 CCCTTGTTCAACTTAATGTGTGG No data
Right 1125515785 15:40320232-40320254 CTAGCCTATACATTCGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125515777 Original CRISPR CCACACATTAAGTTGAACAA GGG (reversed) Intergenic
No off target data available for this crispr