ID: 1125516154

View in Genome Browser
Species Human (GRCh38)
Location 15:40322583-40322605
Sequence CAGGGAGAGCAGAGAGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125516148_1125516154 9 Left 1125516148 15:40322551-40322573 CCTTATAGAGAGGGAATGGGGAG No data
Right 1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG No data
1125516142_1125516154 25 Left 1125516142 15:40322535-40322557 CCAGAATTCTGGAAAGCCTTATA No data
Right 1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125516154 Original CRISPR CAGGGAGAGCAGAGAGCGGA AGG Intergenic
No off target data available for this crispr