ID: 1125517804

View in Genome Browser
Species Human (GRCh38)
Location 15:40332506-40332528
Sequence CAGAAGGGCTGTGGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 8, 3: 66, 4: 527}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125517804_1125517814 13 Left 1125517804 15:40332506-40332528 CCTACTTCCCCACAGCCCTTCTG 0: 1
1: 0
2: 8
3: 66
4: 527
Right 1125517814 15:40332542-40332564 CCTGCTTCAGTCCCATTGTGAGG 0: 1
1: 0
2: 1
3: 11
4: 143
1125517804_1125517815 14 Left 1125517804 15:40332506-40332528 CCTACTTCCCCACAGCCCTTCTG 0: 1
1: 0
2: 8
3: 66
4: 527
Right 1125517815 15:40332543-40332565 CTGCTTCAGTCCCATTGTGAGGG 0: 1
1: 0
2: 1
3: 15
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125517804 Original CRISPR CAGAAGGGCTGTGGGGAAGT AGG (reversed) Intronic
900137610 1:1125020-1125042 CAGGAGGGATGTGGGGAAAGGGG + Intergenic
900300207 1:1973335-1973357 CAGCAGTGCTGTGGGGAGGGAGG + Intronic
901646468 1:10719509-10719531 AAGCAGCGCTGTGGGGAAGGTGG + Intronic
901884103 1:12210740-12210762 AAGTAGGGGTGGGGGGAAGTGGG - Intergenic
901953565 1:12768661-12768683 CAGGAGCCCTGTGGGGGAGTGGG - Intergenic
902070243 1:13728490-13728512 CAGCGGGGCTGTGGGGAAGAAGG + Intronic
902545352 1:17186343-17186365 CACGTGGGCTGAGGGGAAGTGGG + Intergenic
902615126 1:17619440-17619462 CAGCAGGTCTGTGGGGGAGTGGG + Exonic
902733022 1:18382431-18382453 GAGCAGGGCTTTGGGGAAGAAGG - Intergenic
902873229 1:19326516-19326538 GTGAAGGGCTGTGGGGCAGAAGG - Exonic
903070419 1:20724396-20724418 CAGAGGGGCTGGTGGGCAGTGGG - Exonic
903071477 1:20728974-20728996 CAGACAGGATGTGGGGAAGGAGG + Intronic
903319847 1:22536158-22536180 GAGTAGGGCTGTGGGGCAGGTGG + Intergenic
903426852 1:23259973-23259995 CTGAAGGACTGTGGGGAACAGGG + Intergenic
903664512 1:24998045-24998067 AGGAAGGGCTGTGGGGAGGCAGG + Intergenic
903745700 1:25585287-25585309 CAGCAGGTGTGTGGGGAAGCCGG + Intergenic
904049085 1:27627267-27627289 CTGAAGGGCTGTGTGGATCTGGG - Intronic
904311583 1:29632781-29632803 CTGGAGGGCTGAGGGGAAGAGGG - Intergenic
904615386 1:31746717-31746739 GAGAAGGGCTGCAGGGAAGTTGG - Intronic
904906069 1:33898201-33898223 CAGATGGGCTGTTGGGGAGTGGG - Intronic
904990609 1:34589698-34589720 GAGCAGGGCTCTGGGGAACTAGG + Intergenic
905538860 1:38744523-38744545 CAAAAGGGCTGGAGGGAACTAGG + Intergenic
906036253 1:42751870-42751892 CAGTGGGGGTGTGGGGACGTGGG - Intronic
906390131 1:45407958-45407980 CAGGAGAGATGTTGGGAAGTGGG - Intronic
906732112 1:48091804-48091826 CCCAAGGGCTGAAGGGAAGTTGG - Intergenic
908569990 1:65399642-65399664 GAGAAGGTCAGTGGGGAGGTGGG - Intronic
908602095 1:65751519-65751541 CAGAAGGGCACAGGGGATGTAGG - Intergenic
909022044 1:70442366-70442388 CAGATGGACTGTGAAGAAGTTGG - Intergenic
909032178 1:70555261-70555283 CAGTAGGGATGTGGGGCAGAGGG - Intergenic
909059615 1:70865266-70865288 CAGTAGGGGTGTGGTGAAGTGGG + Intronic
909520377 1:76561212-76561234 TGGGAGGGTTGTGGGGAAGTGGG + Intronic
912758823 1:112347821-112347843 CAGAAAGGGTGTAGGGAAATGGG + Intergenic
914462552 1:147898426-147898448 CAGAGGGGCTGTGGTAGAGTGGG - Intergenic
915524827 1:156469093-156469115 CAGGAGGACTGTGGGGATGAGGG + Intronic
915559073 1:156676075-156676097 AAGGAGGGCTGTGAGGAACTTGG + Intronic
916185127 1:162124274-162124296 CAGAAGGGCAGAGGGCAAGACGG - Intronic
916318597 1:163478364-163478386 CAGCATGGCTCTGGGGGAGTGGG - Intergenic
916874063 1:168949900-168949922 CAGATGGGCTGTGGGCTGGTTGG - Intergenic
918687868 1:187442224-187442246 CAGAAGGGGAGGGGGGGAGTTGG - Intergenic
919691276 1:200530664-200530686 CAGCTGCACTGTGGGGAAGTGGG - Intergenic
919770036 1:201152246-201152268 GAGAAGGAATGTGGGGAAGAGGG - Intronic
920420914 1:205832676-205832698 CAGAAGGGCTGACGGGGAGGGGG + Exonic
920979684 1:210821623-210821645 TAGAAGGAATGTGGAGAAGTGGG + Intronic
922091414 1:222399074-222399096 AAGAAGGGCAGTGGGGCAGATGG - Intergenic
922562617 1:226580150-226580172 CAGATGGGCTGTGTGGGAGGAGG + Intronic
922593330 1:226795463-226795485 AAGCAGGGCTGTGGGAAGGTCGG - Intergenic
922675819 1:227548191-227548213 CAGTTGGGCTGTGAGGAAGTGGG + Intergenic
923108145 1:230869430-230869452 GAGAGGGGCTTGGGGGAAGTGGG - Intronic
923538548 1:234871526-234871548 CAGCAGGGCTGGGGAGAAGCAGG - Intergenic
923652923 1:235890493-235890515 CAGAGGGGCAGGGGGTAAGTGGG - Intergenic
924088679 1:240480566-240480588 CAGAAGGGCCATGGAGAAATGGG + Intergenic
1063440878 10:6071958-6071980 GTGAAGGGCTGAGGGGACGTGGG + Intergenic
1063746875 10:8893810-8893832 CAGAAGTGCTGAGGTGCAGTGGG - Intergenic
1064137539 10:12763948-12763970 CAGGAGGGCTGTGGGGGTGGGGG - Intronic
1064944225 10:20770403-20770425 CAGATGGGATGTGTGGAAGACGG + Intergenic
1066228061 10:33403836-33403858 CAGCAGTGAGGTGGGGAAGTTGG + Intergenic
1068951180 10:62779149-62779171 CACAAGGGCTCGAGGGAAGTTGG + Intergenic
1069132397 10:64722677-64722699 TAGAGGGGCTGTGGGGATTTGGG + Intergenic
1069688448 10:70334391-70334413 CAGAAAGGCTGTTGGGGTGTTGG - Intronic
1069772381 10:70907937-70907959 CAGAAGGGCTGTGAGGAGCCTGG - Intergenic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1070660609 10:78303074-78303096 GGGAAGGGACGTGGGGAAGTTGG + Intergenic
1071041891 10:81319579-81319601 CAGGTCAGCTGTGGGGAAGTTGG + Intergenic
1071491312 10:86138575-86138597 CTGAAGAGCTGTGGGGAGGCTGG - Intronic
1072271735 10:93783506-93783528 CAGTGGGGCTGTGGGGAGGGAGG + Intronic
1072662616 10:97372006-97372028 CAGATGGGCTGTGGGAAGGTGGG - Intronic
1072733712 10:97865492-97865514 CAGCAGGGGAGTGGGAAAGTGGG - Exonic
1073042101 10:100614780-100614802 CAGAAGGGCAGTAGGTCAGTTGG + Intergenic
1073816688 10:107214818-107214840 CTGAAGGGGAGTGGGGAAGCTGG - Intergenic
1073875358 10:107915356-107915378 CAGAAGGGCAGCGGGGACGGAGG + Intergenic
1074494248 10:113965105-113965127 CTGATGAGCTGTGGGGAGGTGGG + Intergenic
1074535958 10:114328862-114328884 CAGATGTGGTGTGGGGATGTAGG - Intronic
1075525654 10:123183462-123183484 CAGAAGTGAGGTGGGGAAGAGGG - Intergenic
1076008318 10:126966013-126966035 AAGAAGGGTAGGGGGGAAGTGGG - Intronic
1076523012 10:131092858-131092880 CTGCAGGACTGTGGGGAAGCAGG - Exonic
1077223681 11:1428416-1428438 CAGAAGGGCTGTGAGGACAGTGG - Intronic
1077317363 11:1925476-1925498 CTGGGGGGCTGTGGGGAAGGGGG - Intronic
1077402537 11:2366313-2366335 CAGAAGGGCTCGGGTGGAGTGGG - Intergenic
1077713261 11:4556758-4556780 CAGATGGGATGTGAGGAAGGAGG - Intergenic
1078148043 11:8735585-8735607 AAGCTGGCCTGTGGGGAAGTGGG - Intronic
1078528851 11:12120926-12120948 GAGGAGGGCTGTGGGGAACAGGG + Intronic
1080520477 11:33064166-33064188 AAGAAACGCTGTGGGGAAGATGG + Intronic
1080851428 11:36073517-36073539 CTACAGGGCTGTGGGGAAGGGGG - Intronic
1081148803 11:39600798-39600820 CAGAAAGGGTGTGGGGAAAAGGG + Intergenic
1081337432 11:41883950-41883972 GGGAAGGGTAGTGGGGAAGTGGG + Intergenic
1081622015 11:44624255-44624277 CAGAGGGGCTGTGTGGAGGTGGG + Intergenic
1081648786 11:44809128-44809150 CAGATGGGCTGTGTGGCTGTGGG - Intronic
1082802516 11:57425339-57425361 AAGTGGGGCTGTGGTGAAGTGGG + Intronic
1083101146 11:60307289-60307311 AGGAAGGGCTGTGGGGGAGTGGG - Intronic
1083261181 11:61523955-61523977 CAGGAGGGGTGTGGGGAACTAGG + Intronic
1083854154 11:65384120-65384142 CAGCAAGGCTGTAGGGAAGTGGG - Intergenic
1083855743 11:65392227-65392249 TGGAAGGGCTGTGGGCAAGGGGG + Intronic
1083885959 11:65573638-65573660 CTGAAGGGCTGGGGGGCAGGGGG + Exonic
1083896637 11:65623422-65623444 CAGTGGGGCAGTGGGGAAGATGG - Intronic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084209543 11:67614699-67614721 CAGAGGAGCTGTGGGGCACTGGG - Intergenic
1084550005 11:69835476-69835498 CAGCAGGGCTGTGGGGCCCTCGG - Intergenic
1085198484 11:74686869-74686891 TAGTAGGGGTGTGGAGAAGTGGG + Intergenic
1085446280 11:76603306-76603328 AAGGAGGGCTGTGTGGATGTGGG + Intergenic
1085824712 11:79832739-79832761 AAAAGGGGCTGTGGTGAAGTAGG + Intergenic
1086875083 11:92086080-92086102 GAGAAGGGCTGAGGTGGAGTTGG + Intergenic
1087976542 11:104556630-104556652 AAGAAATGCTGTTGGGAAGTGGG - Intergenic
1088248255 11:107840103-107840125 CAGAAGAGTTGTGGGGAGGGAGG - Intronic
1088381762 11:109200868-109200890 AAGAAAGGATGTGGGGAAGGAGG - Intergenic
1088472722 11:110203362-110203384 AAGAAGGGTAGTGGGGAAGCAGG + Intronic
1088510254 11:110566324-110566346 GAGAAGGGTTGCAGGGAAGTGGG + Intergenic
1088706042 11:112465618-112465640 CAGAAGGGCTGTGCGCTAGAGGG + Intergenic
1088977148 11:114825945-114825967 CAAAAGGTCTTTGGGGAAATAGG - Intergenic
1089761547 11:120728903-120728925 AGGAAGGGTAGTGGGGAAGTGGG - Intronic
1089774964 11:120829668-120829690 GAGAAAGGCTGCCGGGAAGTGGG - Intronic
1089934121 11:122345771-122345793 CAGATGGGCTGAGGGGAAGGAGG - Intergenic
1090343265 11:126044740-126044762 CAGAAGGGCAGCAGGGAGGTGGG + Intronic
1090474188 11:127004564-127004586 CAGCATGGCAGTGGGGAAGATGG - Intergenic
1091335828 11:134764977-134764999 AAGAGGGGCTGTGGTGAAGTGGG - Intergenic
1091751324 12:3022856-3022878 CTGAAGGGGAGTGGGGAAGAGGG - Intronic
1092075986 12:5673964-5673986 CAGAAGAGGAGTGGGTAAGTTGG - Intronic
1092098186 12:5861561-5861583 TGGCAGGGCTGTGGGGAAGGAGG - Intronic
1092181955 12:6452207-6452229 GAGAAGGGCGGTGGGCAAGGAGG + Exonic
1092203477 12:6601619-6601641 CAGAAGGGGTTTGGGGAAGGGGG - Intronic
1092537801 12:9404131-9404153 CCCAAGAGCTGGGGGGAAGTGGG - Intergenic
1092818012 12:12327873-12327895 CAGAAGAGCAGAGGGGAAGGAGG + Exonic
1093023113 12:14221064-14221086 CCCAAGTGCTGTTGGGAAGTTGG - Intergenic
1094003145 12:25718157-25718179 CAGAAAGGATATGGGGAACTAGG - Intergenic
1094599664 12:31897694-31897716 CAAAAGGGTGGTGGGGGAGTCGG + Intergenic
1096672576 12:53209071-53209093 CACAGGGCCTGTGGGGAAGGAGG - Intergenic
1096843006 12:54390665-54390687 CAGAGGGGCTGGGGAGAAGAGGG - Intronic
1097327141 12:58289534-58289556 AAGAAGGGCTGGGAGGCAGTAGG + Intergenic
1097552835 12:61098069-61098091 CAGAAGAGGTGAGGGGACGTGGG - Intergenic
1097583835 12:61491465-61491487 AAGAAATGGTGTGGGGAAGTGGG + Intergenic
1098149841 12:67535391-67535413 CAGAAGGACTGTGGTGCAGCAGG + Intergenic
1099072548 12:78064108-78064130 AAGAATGGCAGTGGGGAAGGGGG + Intronic
1100233260 12:92631884-92631906 CAGAAGGACTGTGGGGTCCTGGG - Intergenic
1100358143 12:93851216-93851238 CAGCAATGCTGTGGGGCAGTGGG + Intronic
1101171951 12:102106776-102106798 CATTAGTTCTGTGGGGAAGTTGG - Intronic
1101777252 12:107806209-107806231 CAGATTGGGGGTGGGGAAGTGGG - Intergenic
1101813297 12:108126485-108126507 CAGATGGGCTGGGGGGATGCTGG + Intergenic
1101901099 12:108791851-108791873 CATCAGGGGTGTGGGGAAGTGGG + Intronic
1102512679 12:113426149-113426171 CAGAAGGGGTTTGGGGCAGGAGG - Intronic
1102990700 12:117313794-117313816 GAGAAAGGCTGTTGGGAAGTAGG - Intronic
1103619268 12:122176359-122176381 CAGGAGGGTAGTGGGGAGGTGGG + Intronic
1104021401 12:124994432-124994454 CAGAAGGTCCCAGGGGAAGTGGG - Intronic
1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG + Intronic
1105019596 12:132807358-132807380 CAGCAGGGGTGTGTGGAATTTGG - Intronic
1105440589 13:20412722-20412744 CAGAAGGCTTGGGGGGAATTAGG - Intronic
1105614197 13:21997687-21997709 GAGAAGGACAGTGGGGAAGTGGG - Intergenic
1105811552 13:24000648-24000670 CAGAAGCCCTGTGGGGAAAGAGG + Intronic
1107147520 13:37074206-37074228 CAGAAAGGCAGTGGGGGTGTGGG - Intergenic
1107542922 13:41409968-41409990 CAGATGGGCAGTGTGGAGGTGGG + Intergenic
1107685278 13:42891439-42891461 TGGCAAGGCTGTGGGGAAGTGGG - Intronic
1108037376 13:46305667-46305689 GGGAAGGGCGGTGGGGAGGTTGG + Intergenic
1108500669 13:51067003-51067025 CAGAAAGGCTGAGTGGAAGGAGG - Intergenic
1108862777 13:54882509-54882531 CAGAAGGGCTGAGTCGAGGTGGG - Intergenic
1109283716 13:60387325-60387347 GAGAAGGGAGGTGGGGAGGTGGG + Intergenic
1109737765 13:66509120-66509142 TAGTTGGGCTGAGGGGAAGTTGG - Intronic
1109954915 13:69553188-69553210 CAGAGAGGCTGTGGAGAAATAGG + Intergenic
1110644696 13:77868981-77869003 GTGAATGGTTGTGGGGAAGTGGG + Intergenic
1112009183 13:95279786-95279808 CAGAAAGGGGATGGGGAAGTGGG + Intronic
1112062588 13:95755911-95755933 CAGAAGAGAGGTGGGGAAGAGGG - Intronic
1112211724 13:97384502-97384524 GAGAAGAGGTGTGGGGCAGTGGG + Intronic
1112496527 13:99910116-99910138 CAGAAGGGCATTTGGGAAGCTGG - Intergenic
1112665104 13:101561120-101561142 GAGAAGGGTGGTGGGAAAGTTGG + Intronic
1113088086 13:106588616-106588638 CAGAGAGGCTGTGGGGAGGGTGG - Intergenic
1113749606 13:112768129-112768151 AAGAACGGCTATGAGGAAGTCGG - Intronic
1114689433 14:24566524-24566546 CAGCATGGTTGTAGGGAAGTGGG - Intergenic
1117547348 14:56804446-56804468 CTGAAGGGCTGTGAGGAACGGGG - Intronic
1117949928 14:61072518-61072540 GACAAGGGTTGTGGGGTAGTAGG - Intronic
1119386375 14:74260228-74260250 CAGAGGGCAGGTGGGGAAGTTGG - Intronic
1119476905 14:74935548-74935570 GAGAAGGGCAGTGGGGCGGTAGG - Intergenic
1119806900 14:77487992-77488014 CAGAAGGGCTGAGGGGATCAGGG + Intronic
1120042228 14:79767202-79767224 CAGTAGGGCTGGGAGGAAGAAGG - Intronic
1120370326 14:83626044-83626066 CAAAAGAGCAGTGGGGCAGTTGG + Intergenic
1121109544 14:91303257-91303279 AGGCAGGGCTTTGGGGAAGTGGG - Intronic
1122232811 14:100315374-100315396 AAGCAGTGCTGTGGGGAGGTCGG + Intergenic
1122601565 14:102924205-102924227 CACAAGGGCTGTGGGGACAGGGG - Intronic
1122855303 14:104557114-104557136 CAGATGGGCTGTGCGGAGGAGGG - Intronic
1123004892 14:105316406-105316428 GAGAAGGGCTGTGGGGCTGTGGG - Intronic
1123812859 15:23946429-23946451 CAGAAGGGATGTCAGGAGGTTGG + Intergenic
1123830418 15:24130315-24130337 CAGAAGGGGTGTGGAGGTGTAGG + Intergenic
1123850673 15:24352921-24352943 CAGAAGGGGTGTGGAGGTGTAGG + Intergenic
1123860445 15:24460727-24460749 CAGAAGGGGTGTGGAGGTGTAGG + Intergenic
1123972251 15:25518553-25518575 CAGAAGGGCTGTTAGAAAGAAGG + Intergenic
1124139364 15:27063883-27063905 GAGAAGGGGTGTGGGGAAGTGGG - Intronic
1124266071 15:28235524-28235546 CAGAAGGCTTGCGGGGAAGGAGG - Intronic
1124940600 15:34213999-34214021 CTCAGGGGCTGTTGGGAAGTGGG + Intergenic
1125517804 15:40332506-40332528 CAGAAGGGCTGTGGGGAAGTAGG - Intronic
1125721339 15:41846545-41846567 CTGCAGGGCTGTGGGGGTGTTGG + Intronic
1126065706 15:44824793-44824815 CAGGAGGCCTGTTGGGGAGTTGG + Intergenic
1126094129 15:45075774-45075796 CAGGAGGCCTGTTGGGGAGTTGG - Exonic
1126379501 15:48031375-48031397 AAGAAGGAGTGAGGGGAAGTGGG + Intergenic
1127022784 15:54768336-54768358 AGGAAGGGCAGTGGGGAGGTAGG + Intergenic
1127284107 15:57517671-57517693 CAGAAGGGCAGAGGTGGAGTGGG + Intronic
1127641158 15:60917119-60917141 CTGAAGAGCTGTGATGAAGTTGG - Intronic
1127711102 15:61598946-61598968 GAGAAGGGGTGGGGGGAAGACGG + Intergenic
1127977646 15:64009967-64009989 CAGTTGGGCTGTGGGTAAGAGGG + Intronic
1128730231 15:70015803-70015825 CAGGAGGGCTGCGGGGACCTGGG - Intergenic
1128878244 15:71219928-71219950 CAGAAAAGCTGTGTGGAGGTTGG + Intronic
1129256873 15:74338801-74338823 GCTCAGGGCTGTGGGGAAGTGGG - Intronic
1129332150 15:74833244-74833266 CTGAAGGGGTTTGGGGAAGTTGG - Intergenic
1129454548 15:75669752-75669774 CAGGAGGGCTGTTGGGCAGGGGG + Intergenic
1131085432 15:89572128-89572150 AAGGAGGGCAGTGGGGCAGTGGG - Intergenic
1131420628 15:92301831-92301853 CCCAAGTGCTGTGGGGAGGTTGG - Intergenic
1131445498 15:92495315-92495337 CAGAATGGATGTGGGAAAGAGGG - Intronic
1131627366 15:94135453-94135475 CAGAAGGGTTTTGGTGAGGTTGG - Intergenic
1132517531 16:372797-372819 CAGAGGTGCTGTGGGGCCGTGGG - Intronic
1132666456 16:1083278-1083300 CAGAGTGGGTGTGGGGAAGACGG + Intergenic
1132878513 16:2150708-2150730 CAAGAGGGAGGTGGGGAAGTGGG - Intronic
1133416971 16:5614317-5614339 CAGGAGGGCTCTGGGCCAGTGGG + Intergenic
1133442869 16:5835603-5835625 CAGAAACCCTGTGGGGAGGTTGG - Intergenic
1134609531 16:15597474-15597496 CAGAAGCACTGTGGGAAAGCTGG - Intronic
1135459128 16:22626406-22626428 GATAAGGGCTGTGGGGAAACAGG - Intergenic
1136059196 16:27713153-27713175 AAGAAGTGATGTGGGGAAGAGGG - Intronic
1136394943 16:29987570-29987592 CTGCAGGGCTGTGGGGCTGTGGG + Exonic
1136450583 16:30352340-30352362 CTGAAGGGCTGTGGGAACGACGG + Exonic
1137921042 16:52488924-52488946 CAGAGCTGCTGTGGGGAAATGGG - Intronic
1138113450 16:54342243-54342265 CAGAGGGGCTGTGGGATGGTGGG - Intergenic
1138342744 16:56301351-56301373 CAGAAGGGATGTGGGGGAGCCGG + Intronic
1139516335 16:67454458-67454480 CAGAAGGGCCCGGGGGAAGCAGG + Intronic
1140140973 16:72257277-72257299 CCTAGGGGCTGTGGGGAAATAGG - Intergenic
1141586009 16:85034034-85034056 CAGATGTGCTGTGGCGAGGTTGG - Intronic
1142248979 16:88982577-88982599 CGGGAGGGCTGTGGGGGAGGAGG - Intergenic
1142253300 16:89002496-89002518 CAGAAGAGCTGGGGGGACGGAGG + Intergenic
1142279463 16:89140209-89140231 CAGAGGGGCAGTGGGGAAGGCGG - Intronic
1142309494 16:89304067-89304089 CAGCAGGGCTGTAGAGAAGCTGG + Intronic
1142495884 17:306155-306177 CAGAAAGGGGCTGGGGAAGTCGG - Intronic
1142817904 17:2442062-2442084 AAGAAGGAATGTGGAGAAGTTGG + Intronic
1142977653 17:3655436-3655458 CAGAAGGGTAGAGGGGACGTTGG - Intronic
1143164991 17:4893165-4893187 GAGAAGGGCTGTGGGGATGGAGG + Intronic
1143592023 17:7890911-7890933 GAGAGGGGCTTTGGTGAAGTAGG - Intronic
1143734255 17:8899348-8899370 GAGAAGGGACGTGGGGAGGTGGG - Intronic
1143779725 17:9222967-9222989 CAGAAGGCCTGTGGGGAATGGGG - Intronic
1144461241 17:15460201-15460223 AAGAAGGCCAGTGGGGAAGCAGG - Intronic
1144613914 17:16751465-16751487 CAGCAGTGCTCTGGGGAAGGGGG + Intronic
1144620784 17:16817255-16817277 CAGATGGTCCATGGGGAAGTTGG - Intergenic
1145017706 17:19410034-19410056 CAGAAGGGTTGGGGTGAGGTGGG - Intergenic
1145133577 17:20381517-20381539 CAGCAGTGCTCTGGGGAAGGGGG + Intergenic
1145194391 17:20876504-20876526 TAGAAGGGCTGGAGGGAATTAGG + Intronic
1145255151 17:21318279-21318301 CAGCAGGGCTGTGCGGGAGGTGG + Intergenic
1145297647 17:21604559-21604581 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1145321455 17:21769676-21769698 CAGCAGGGCTGTGCGGGAGGTGG - Intergenic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1145983377 17:29027658-29027680 CAGAAGGGCTCTGGGGCACTGGG - Intronic
1146628446 17:34452763-34452785 CTGAAGAGCTGTGTGGAAGGTGG + Intergenic
1147400229 17:40176651-40176673 CAGAAGGAGTGTGGGGGAGGAGG - Intergenic
1147547147 17:41410632-41410654 GAGAAGACCTGTGGGGAGGTTGG - Intergenic
1147572173 17:41578158-41578180 CAGATGGTCCATGGGGAAGTTGG - Intergenic
1147767124 17:42844722-42844744 CAGAGGGGCAGTGGGGAGGCTGG - Exonic
1147768322 17:42851451-42851473 CAGAGGGGCAATGGGGAAGCTGG - Exonic
1148203708 17:45766326-45766348 CAGTAGGGAGGTGGGGAAGGCGG - Intergenic
1148559705 17:48598865-48598887 CAGAAGGGTTGTGGAGAAGCAGG - Intronic
1149084489 17:52698846-52698868 CAGAAGAGCTGTAGGAAATTTGG - Intergenic
1149552301 17:57549295-57549317 AAAAAGGGCAGTGGGGAGGTGGG - Intronic
1149575074 17:57706080-57706102 CAGCAGGGCTGTGGGGAGCTGGG - Intergenic
1150001833 17:61445164-61445186 CAGTAGGTCTGTGGCCAAGTAGG + Intergenic
1150007472 17:61478793-61478815 AAGTGGGGCTGTGGGGCAGTGGG - Intronic
1151617598 17:75224484-75224506 GAGAAGGGGTGGGGGGAAGCAGG + Intronic
1151785149 17:76271777-76271799 CTGCAGGGCTGCGGGGAAGGGGG - Intergenic
1151890572 17:76948571-76948593 CAGAAGGGCTGGGGCGGGGTAGG - Intronic
1152318148 17:79592913-79592935 AAGCAGGGGTGTGGGGTAGTGGG - Intergenic
1152526073 17:80888974-80888996 CAGGAGGGCAGTGGGGCAGGTGG + Intronic
1152632615 17:81417323-81417345 CTGGAGGGCTGTGGGGCGGTCGG - Intronic
1152726931 17:81952173-81952195 CAGAAGGGTTGAAGGGAAGCAGG + Intergenic
1153381355 18:4443305-4443327 CAGAACTGGTGAGGGGAAGTGGG - Intronic
1154111602 18:11573245-11573267 CTGAAAGGCCGTGGGGAGGTTGG + Intergenic
1155041742 18:22070647-22070669 CAGAAAGACTGTGGGCATGTCGG + Intergenic
1156065872 18:33141850-33141872 AAGAAGGGAGGTGGGGAAATAGG - Intronic
1156354872 18:36332259-36332281 CAGGATGTCTGTGGGGATGTAGG + Intronic
1156451128 18:37266968-37266990 CAGAAGGGCTGTGGGGAAAGGGG + Intronic
1157552349 18:48590389-48590411 CAGGAGGCCTGTGGGAAAGGGGG + Intronic
1157578453 18:48759246-48759268 GGGAATGGCTGTGGGCAAGTTGG - Intronic
1158374381 18:56847046-56847068 CAGAAGATATGAGGGGAAGTTGG + Intronic
1158725555 18:59968576-59968598 CTAGAGGGCTGTGGGGAAGGAGG + Intergenic
1158774730 18:60563718-60563740 CAGAAGAGCTGTGGGGATCGGGG - Intergenic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1159623166 18:70662672-70662694 GAGAAGGGCAGAGGGTAAGTAGG - Intergenic
1160225573 18:77008637-77008659 CAGAAGGGCCCTGGGGGAGCCGG - Intronic
1160251824 18:77210022-77210044 CAGGGAGGCTGTGGGGAAGCCGG + Intergenic
1160458416 18:79019188-79019210 CAGGAGGTCTGTGGGGGAGGAGG - Intergenic
1161222208 19:3122953-3122975 CAGAAGTGGTGTGGGGAAGCCGG - Exonic
1161590621 19:5127669-5127691 AGGGAGGGCTGTGGGGAAGCGGG + Intronic
1161737201 19:5998683-5998705 CACCGGGGCTGTGGGGAAGCTGG - Intronic
1162019058 19:7860461-7860483 CTGAAGGGCTCTGGGGAGGCGGG + Intronic
1163371355 19:16902931-16902953 GAGAAGGGCAGTGGGGAGGTGGG + Intronic
1163842983 19:19622711-19622733 CAAAAGGGCAGTGGGGAGGGAGG + Intergenic
1165521961 19:36321716-36321738 CAGAGGAGCTGTGGGGATGGTGG - Intergenic
1165633850 19:37323827-37323849 CAGAGGAGCTGTGGGGACGGTGG + Intronic
1166449547 19:42886666-42886688 GTGAAGGGCTGGGTGGAAGTTGG - Intronic
1166460845 19:42986962-42986984 GTGAAGGGCTGGGTGGAAGTTGG - Intronic
1166478139 19:43146949-43146971 GTGAAGGGCTGGGTGGAAGTTGG - Intronic
1168077611 19:53990066-53990088 CAGAAGGGCTGAGGGGTAGGGGG + Exonic
926332345 2:11835984-11836006 CAGGAGGGGTGTGGGGGAGGGGG - Intergenic
926657741 2:15427291-15427313 CAGAAGGGGGGTGGGAGAGTCGG - Intronic
926884182 2:17582217-17582239 CAGGAGGGGTGAGGGGAAGGAGG + Intronic
927131861 2:20066740-20066762 CTGAAGGGCAGTGTGGGAGTCGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
928083599 2:28331675-28331697 CAGCAAGGCTGTGGAGAAGTAGG + Intronic
928172905 2:29014769-29014791 CAGAAGCGGGGTGGGGAACTAGG + Intronic
928183830 2:29091477-29091499 CAGAAGAAGTGTGGGGAGGTGGG - Intergenic
928810868 2:35224258-35224280 CAGAAGAGGAGAGGGGAAGTGGG - Intergenic
928922374 2:36539136-36539158 CAGAGAGGCTGGGGAGAAGTGGG + Intronic
930378986 2:50603346-50603368 CAGAAAGGCTGTGGGGACGTGGG + Intronic
930713132 2:54568008-54568030 TAGGAGGTCTGTGGGGAGGTCGG - Intronic
932339233 2:70949557-70949579 CAGCAAGGATGTGGGGAAGTGGG - Intronic
932622070 2:73270668-73270690 CAAAAGGGGTGTGGGGAGGATGG - Intronic
932816591 2:74866703-74866725 CAGAAAAGCTGTGGGGGAGCAGG - Intronic
932841677 2:75088873-75088895 CAGATGAGCTGTGGGGAAGAGGG - Intronic
933047384 2:77556549-77556571 AAGGAGGGCTGTAGGGCAGTGGG - Intronic
933748906 2:85590692-85590714 GGGATGGGCTGTGGGGAAGTAGG + Intronic
934554758 2:95281428-95281450 CAGGAGGGTTGGGGGAAAGTGGG + Intronic
934844726 2:97655510-97655532 CAGAAGAGCAGTGAGGAATTAGG - Intergenic
935269358 2:101420207-101420229 CAGAGGGGAGGTGGGAAAGTAGG - Intronic
935627886 2:105186006-105186028 CAGCCAGGCTTTGGGGAAGTGGG + Intergenic
936095645 2:109528655-109528677 CAGCAGGGCCGTGGGGCAGGAGG + Intergenic
936843072 2:116797453-116797475 CAGTAGGGATGTGGGGGAGTGGG + Intergenic
937009319 2:118547999-118548021 CAGGTGGGCTTTGTGGAAGTGGG - Intergenic
937040607 2:118817799-118817821 CAGAATGGTGGTTGGGAAGTTGG - Intergenic
938124960 2:128664753-128664775 CAGGAGGGCAGTGAGGAAGCTGG + Intergenic
938143044 2:128812161-128812183 CAGCAGGGCTTTGGGGCAGGTGG - Intergenic
938995279 2:136671839-136671861 GAGAAGGGAGGGGGGGAAGTTGG + Intergenic
939141526 2:138359721-138359743 GTGAAGGGCTGTGGGGAAGGGGG + Intergenic
941958108 2:171225477-171225499 CAGCAAGGATGTGGAGAAGTTGG + Intronic
942676245 2:178429420-178429442 CAGAAGGGTTGCAGGAAAGTAGG - Intergenic
943046460 2:182867000-182867022 CAGAGGGGTTGGGGGGAAGGAGG + Exonic
943415156 2:187592122-187592144 CAAAATGGCTGTGGGCAAGTGGG + Intergenic
943728455 2:191276531-191276553 CACAAGGGCTGAGGGAAAGTAGG + Intronic
945062952 2:205924602-205924624 CTGGGGGGCTGTGGGGAGGTGGG + Intergenic
945829430 2:214765009-214765031 CAGCTGGGCAGTTGGGAAGTAGG - Intronic
946237303 2:218332052-218332074 CAGAAGGCCTGACTGGAAGTTGG + Intronic
946865002 2:224034790-224034812 CAGGGGGGCTGCGAGGAAGTGGG + Intronic
947535638 2:230939183-230939205 CAGAAGGGCTGTGGAGTTCTGGG + Intronic
947865967 2:233397918-233397940 AAGAGGGGCTGTGGGGTGGTGGG + Intronic
948095984 2:235334407-235334429 CTGCAGGGCTGTGGGGTAGGGGG - Intergenic
948270427 2:236669592-236669614 CAGAAGTGTGGTGGGGAATTTGG - Intergenic
948454465 2:238098364-238098386 CAGAAGCGGGGTGGGGAAGGCGG - Exonic
949008839 2:241667175-241667197 CAAGAGGGCTGTGGGGGAGTGGG - Intronic
1170441662 20:16385678-16385700 GAGAAGAGCAGTGGGGAAGGAGG + Intronic
1170470354 20:16662488-16662510 TAGAAGGGATGTGGGGCAGATGG - Intergenic
1171046305 20:21811544-21811566 GAGCAGGGGAGTGGGGAAGTGGG + Intergenic
1171196600 20:23204806-23204828 AAGAATTGGTGTGGGGAAGTGGG - Intergenic
1171340113 20:24420830-24420852 AGAAAGAGCTGTGGGGAAGTCGG + Intergenic
1171341208 20:24431106-24431128 CTGGAAGGCTGTGGGGAATTTGG - Intergenic
1171562925 20:26144159-26144181 TAGAAGGGCTGGAGGGAATTAGG + Intergenic
1171938435 20:31299685-31299707 GGGAAGGGCAGTGGGGATGTAGG + Intergenic
1172831963 20:37843463-37843485 GACTAGGGCTGTGGGGATGTGGG + Intronic
1173145992 20:40524757-40524779 CAGATGGCCTGTGGGAAAATTGG - Intergenic
1173597063 20:44265338-44265360 AAGAAGGGCTGTGGCAAAGATGG - Intronic
1174191342 20:48742849-48742871 CCCAGAGGCTGTGGGGAAGTGGG - Intronic
1174420998 20:50399173-50399195 AAGCAGGGCTGTGGGGGAGGGGG - Intergenic
1174538460 20:51271018-51271040 CAGAAGGGCAGAGGCGATGTTGG - Intergenic
1174929624 20:54798730-54798752 CAGCAAGGCTGTGGAGAAATAGG - Intergenic
1175113986 20:56668749-56668771 CAGAAGGGCTGTTTGGGACTGGG + Intergenic
1175332850 20:58176874-58176896 CAGAGGGGCTTTGGAGAAGCAGG + Intergenic
1176036214 20:63038351-63038373 CAGAGAGGATGTGGAGAAGTTGG - Intergenic
1176160055 20:63643136-63643158 CAGATGGGCCCTGGGGACGTCGG - Intronic
1176510852 21:7746443-7746465 CAGAAGGGCTGTGGTGAGGTGGG - Intronic
1178644965 21:34376972-34376994 CAGAAGGGCTGTGGTGAGGTGGG - Intronic
1180206416 21:46264153-46264175 CAGAGGGACTGTGAGGAAGTTGG - Exonic
1180223344 21:46374083-46374105 CAATTGGGCTGTGGGGAGGTGGG + Intronic
1180996852 22:19970161-19970183 CTGCAGGGCTCTGGGGAGGTGGG + Exonic
1182082762 22:27540993-27541015 CAGAAGGTCAGAGGGAAAGTCGG - Intergenic
1183030774 22:35102864-35102886 CTGCAGGGCTGTGGGGGAGGAGG - Intergenic
1183043750 22:35203295-35203317 CAGAAGGACTGCTGGGCAGTTGG - Intergenic
1183494834 22:38137191-38137213 CATAAGGGCTGTAGGGAGCTGGG - Intronic
1184298867 22:43543335-43543357 GAGAAGGGCTGGGGGCAGGTGGG - Intronic
1184657071 22:45947190-45947212 CAGAAGGGATGTGGGGAACCAGG + Intronic
1184760277 22:46539718-46539740 CAGGAGGGCTCTGGGGGAGGAGG + Intergenic
1184779310 22:46638403-46638425 CAGGAGGGAGGTGGGGCAGTAGG + Intronic
1184853911 22:47136269-47136291 CAAAGGGGCTGTGGGGACCTGGG - Intronic
1185073858 22:48672209-48672231 CCGATGGACTCTGGGGAAGTTGG + Intronic
1185318731 22:50190507-50190529 GGGAAGGGCTGTGGCGACGTGGG + Intronic
949735716 3:7169483-7169505 CAGAAGGGATGTGGGATAGTGGG + Intronic
949900369 3:8809616-8809638 CAGATGGTCTGTGGGGAGGCAGG + Intronic
950277011 3:11670451-11670473 CAAAAGGGCTGTTGGGACGCAGG - Intronic
950448555 3:13052678-13052700 CAGGAGGGCTGTGGGGAAACTGG - Intronic
952186090 3:30970400-30970422 CAGAAGAGCTGTGTTGAAGTAGG - Intergenic
952419667 3:33119627-33119649 CAGAAGGTCTGTGGGGGATTTGG + Intronic
953352585 3:42227122-42227144 GAGAAGGCCTGTGTGGTAGTGGG + Intergenic
953496311 3:43390280-43390302 CAGAAGGGCAGTGGGGAAGGAGG - Intronic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
954380841 3:50218255-50218277 TGGAGGGGCTGTGGGGAAGTGGG - Exonic
955060477 3:55488323-55488345 CAGAAGGGCTGGGGGGTGGGAGG - Intronic
955142657 3:56285106-56285128 CAGATGTGCTGGGGGGAGGTAGG - Intronic
955393268 3:58536508-58536530 CAGCAGGGCTGTGGGGGTGCTGG + Intronic
955933911 3:64083890-64083912 ATCAAGGGCTCTGGGGAAGTGGG + Intergenic
956172589 3:66444370-66444392 GAGAAAGGCTCTGGGGCAGTGGG - Intronic
956266898 3:67406504-67406526 CTGAAGGGCAGTTGGGAAGAGGG + Intronic
956303110 3:67793979-67794001 CAACAAGGCTGTGGAGAAGTAGG - Intergenic
956318630 3:67969147-67969169 CACCAGGGCTGTGCGGAAATGGG - Intergenic
956882963 3:73529604-73529626 CAAAAGGGCTGTGGGAGGGTGGG + Intronic
957559639 3:81805902-81805924 CAGCAGGGCTGTGGATAATTGGG + Intergenic
958004332 3:87792907-87792929 GGGAAGGGGTGTGGGGACGTGGG + Intergenic
958602504 3:96315400-96315422 GAGAAGGGCAGTGGGCAACTAGG - Intergenic
960540016 3:118851640-118851662 CCCAAGTGCTGTTGGGAAGTTGG - Intergenic
961559201 3:127717242-127717264 CAGAAGGCCCTTGGGGCAGTGGG - Intronic
961569046 3:127785193-127785215 CAGCAGGTGTGTGGGGAAGGAGG - Intronic
961594605 3:128006608-128006630 CAGAAGGGCTGAGGAGGAGGTGG + Intergenic
961806850 3:129495722-129495744 CAGAAAGGATGTGGGGAAACTGG + Intronic
962008591 3:131371898-131371920 CAGAAGGGAAGCGGGGAAGCAGG - Intergenic
962406539 3:135105463-135105485 AGGAAGGGCCTTGGGGAAGTAGG + Intronic
962580262 3:136791610-136791632 CGGAAGGCCTCTGGGTAAGTGGG + Intergenic
962814529 3:138986616-138986638 CAGAAGCACTTTGGGGCAGTGGG - Intergenic
962949516 3:140205000-140205022 CAGGAGGGGTGAGGGGAGGTGGG + Intronic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
965745991 3:171926471-171926493 GAGAAGGGTAGTAGGGAAGTGGG + Intronic
965824256 3:172714642-172714664 CAGAAGTACTGTGGGAAAGGTGG + Intergenic
966266046 3:178044669-178044691 GAGAAGGGATTGGGGGAAGTAGG + Intergenic
966645528 3:182242463-182242485 TACAAGTGCTGTGGGGAAGCAGG + Intergenic
966972955 3:185061915-185061937 CGGAAGGGCTAAGGGGAAGCAGG - Intergenic
967807684 3:193730005-193730027 CACAAGGGCTATGGGGATGCAGG + Intergenic
968614026 4:1569306-1569328 CAGGCGGGCTGTGGGGAGCTGGG - Intergenic
968919281 4:3514384-3514406 CCCAGGGGCTGTGGGGAAGGAGG + Intronic
969325338 4:6440870-6440892 CAGGAAGGGTGTAGGGAAGTGGG + Intronic
969459887 4:7323525-7323547 CAGGAGGGCTGGGAGGATGTGGG + Intronic
969464112 4:7344559-7344581 CAGAAGGGGAGTAGGGCAGTGGG + Intronic
969615729 4:8251669-8251691 CACAGGTGCTGTGGGGAAGCTGG - Intergenic
969623658 4:8291647-8291669 CAGAATGGCTCTGGGGAGGGGGG - Intronic
971483027 4:27131177-27131199 CAGTAGGGGAGTGGGGAAGAGGG + Intergenic
972251791 4:37309587-37309609 GAGAATGGCTGGGGGGAGGTGGG + Intronic
972330782 4:38062870-38062892 TAGGAGGGCTGAGGGGAAGAGGG + Intronic
972511022 4:39769351-39769373 AAGAAGGGCTGTTGGGAGGGAGG - Intronic
973195300 4:47432917-47432939 CTGCAAGGCTGAGGGGAAGTGGG - Intergenic
975242625 4:72079949-72079971 CAGAAGGGAAGAGGGGAAGTTGG - Intronic
975405211 4:73981419-73981441 CAGTTGGGCAGTGGGGCAGTGGG + Exonic
975610567 4:76198618-76198640 GAGAAGGGCTGTGGGGGTGGAGG - Intronic
976006786 4:80439756-80439778 CAGCTGGGCTCTGTGGAAGTGGG - Intronic
976759603 4:88533990-88534012 CAGGAGGGCAGTGGAGAAGAAGG - Intronic
976780177 4:88749962-88749984 TAGAGGGGCCCTGGGGAAGTGGG + Intronic
977193608 4:94030923-94030945 CAGAAGAGCTATGATGAAGTGGG - Intergenic
978734599 4:112071075-112071097 CAGATGGGCTTTGGGGAAGCTGG + Intergenic
978955600 4:114608910-114608932 TAAAAGGTCTATGGGGAAGTGGG - Intronic
979357688 4:119724660-119724682 CAGGAGGGGTGAGGGGAAATAGG + Intergenic
979956810 4:126963620-126963642 CAGAGGGAGTGTGGGGTAGTAGG - Intergenic
980893095 4:138835793-138835815 AAGAAGGACTTAGGGGAAGTGGG + Intergenic
982670417 4:158313945-158313967 CAGAAGGGCTGGTGGGCAGGTGG + Intergenic
982755208 4:159209656-159209678 TAGTAAGGTTGTGGGGAAGTAGG + Intronic
982881213 4:160719667-160719689 CAGAAAGGCAGTGGGTAAGTAGG + Intergenic
983251780 4:165353933-165353955 TGGAAAGGATGTGGGGAAGTTGG + Intergenic
983883422 4:172957427-172957449 CAGCAGGGCAGCGGGGCAGTAGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985042842 4:185909375-185909397 CAGAAGGGCTAGGGGTATGTGGG + Intronic
985833978 5:2257295-2257317 CAGAAGTTCTCTGGGGATGTTGG - Intergenic
986144713 5:5066461-5066483 CAGCAGGGCTGGGAGGAAATTGG + Intergenic
988407274 5:30839989-30840011 CAGGAGGGATGTGGGGAGGAGGG - Intergenic
988976992 5:36525582-36525604 GAGAAGGGTAGTGGGGAGGTAGG + Intergenic
989594384 5:43142647-43142669 CAGAATGGGGGTGGGGAGGTAGG - Intronic
991245885 5:64507455-64507477 CTGAAAGGGTGAGGGGAAGTAGG + Intronic
991290699 5:65031327-65031349 CTGAAGCACTGTGGGGAAGATGG + Intergenic
993027438 5:82662992-82663014 CAGAATAGCTGAGGGCAAGTTGG + Intergenic
994153228 5:96473812-96473834 CAGAAGGGAAGAGGGGATGTAGG + Intergenic
994750136 5:103727091-103727113 CAGAAGGTCTGGGGTGAAGATGG + Intergenic
995133337 5:108654061-108654083 GAGAAGGGCTGTGGGCATGCTGG - Intergenic
995638477 5:114223830-114223852 CAGAAGGGCTGTGTGGGGCTAGG + Intergenic
996288061 5:121818356-121818378 CAGGTGGGCTGAGGGGATGTGGG + Intergenic
996692665 5:126357385-126357407 CGGAAAGGCTGTTGGAAAGTTGG - Intergenic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997235547 5:132270213-132270235 CAGGCTGGCTGTGGGGTAGTGGG + Intronic
997411847 5:133696715-133696737 AAGAAGGGCTGTGGGGAAGGAGG + Intergenic
997460841 5:134051224-134051246 CTGGAGGGCTGTGGGAGAGTTGG - Intergenic
997997175 5:138596296-138596318 CAGAATGGAGGTGGGGCAGTGGG + Intergenic
998031292 5:138870830-138870852 CAGCCTGTCTGTGGGGAAGTAGG + Exonic
998775351 5:145594256-145594278 CAGTATGGGTGTGGGGAAATAGG - Intronic
999131357 5:149285804-149285826 CAGAAGGGCTCTTTGGGAGTGGG - Intronic
999251944 5:150188017-150188039 CACCAGGGCTGTGGGGATGGAGG + Intergenic
1000111649 5:158113781-158113803 GAGTAGGGCTTTGGGGAAGAAGG - Intergenic
1000325002 5:160165431-160165453 CAGAAGAGCAGTGAGGAAGGAGG + Intergenic
1000345537 5:160311129-160311151 GAGAAGGGCTGAGGGGCATTGGG - Intronic
1002044826 5:176536119-176536141 CGGGTGGGGTGTGGGGAAGTAGG - Intronic
1002297860 5:178241357-178241379 CAGAGGGGATGTGGGGAAGAGGG + Intronic
1002977935 6:2104154-2104176 GTGAAGGGCTGAGGGGCAGTAGG - Intronic
1003118147 6:3297040-3297062 CAGCAGGGCTGTGGGATAGAGGG - Intronic
1003270429 6:4603056-4603078 CAGCAAGGCTGTGGGGAAGTAGG - Intergenic
1003528673 6:6919870-6919892 CAGAAGCACTGGGTGGAAGTAGG - Intergenic
1004735901 6:18406235-18406257 CAGGAGTGCTGTGGGGAAGAGGG + Intronic
1005008294 6:21311961-21311983 CAGAAGGGGAGTAGGGAGGTGGG - Intergenic
1005504392 6:26457477-26457499 CAGGAGGGCTTGGGGGAAGCTGG - Intergenic
1005997560 6:30940693-30940715 CTCCAGGGCTCTGGGGAAGTGGG - Intergenic
1006136462 6:31899201-31899223 AAGAAGGGCTGTTGGGAGGGAGG - Intronic
1006224307 6:32523000-32523022 CAGAGAGGCTGAGGGGAAGGAGG + Intronic
1006750649 6:36374628-36374650 CATCAGGGCTGTGGGGAAGCTGG + Intronic
1007117180 6:39351035-39351057 CAGAAGGGTCTTGGGGAAGATGG - Intronic
1007211173 6:40194442-40194464 CAGTTGGGCAGAGGGGAAGTTGG + Intergenic
1007318783 6:41011302-41011324 CAGAAGATCTGAGGGGAAATGGG + Intergenic
1007783427 6:44266888-44266910 GGGAAGGGCTGTGGGAAAGCTGG - Intergenic
1007840625 6:44713089-44713111 CAGCAAGGTTGGGGGGAAGTTGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008949628 6:57141869-57141891 GAGAAGGGCTGAGGGGAGGAAGG + Intronic
1011118720 6:83926285-83926307 CAGAAGCCATGTGGGGAAGAAGG + Intronic
1011884383 6:92076049-92076071 CAGCAGCTCTGTGGGGAAGCAGG - Intergenic
1013414568 6:109913274-109913296 GAGAAGGGCTCTGGGGAACTGGG - Intergenic
1013846284 6:114456122-114456144 CAAAAGAGCTGTGGGAAAGAAGG - Intergenic
1014472592 6:121834790-121834812 CTGAAGGCCAGTGGGAAAGTTGG + Intergenic
1014937426 6:127400586-127400608 CAGAAGGTGAGTGGGGAAGCAGG + Intergenic
1018033791 6:159865178-159865200 CAGACAGACTGTGGGGATGTGGG + Intergenic
1018362968 6:163090470-163090492 CTGAAGAGCTGTGGGTAAGGTGG + Intronic
1018551653 6:165004771-165004793 AAAAAAGGCTCTGGGGAAGTGGG + Intergenic
1018745438 6:166758064-166758086 CAGCCTGGCTGTGGGCAAGTGGG - Intronic
1018953535 6:168393538-168393560 CAGAAGGGATGGGTGGAAGTGGG + Intergenic
1019911298 7:4101964-4101986 CAGAAGGGCTGTGGAGTGATGGG - Intronic
1020023263 7:4881941-4881963 AAGCAGGGGTGGGGGGAAGTGGG - Intronic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1022038819 7:26559891-26559913 CAGCAAGGGTGTGGGGAAATTGG - Intergenic
1022250223 7:28600074-28600096 AAGAAAGGCGGTGGGGAAGCAGG - Intronic
1022539623 7:31123666-31123688 CTGAAGGGCAGTGAGGAAGCGGG - Intergenic
1023867140 7:44243715-44243737 CAGAGGGGCTGTGGGGTTGCAGG - Intronic
1023981647 7:45073986-45074008 CAGCAGGGCAGGGTGGAAGTTGG - Intronic
1024135073 7:46398536-46398558 CAGCAGGAATATGGGGAAGTGGG - Intergenic
1024708227 7:51985180-51985202 GAGAAGTGCTCTGGGGAAGATGG + Intergenic
1024969956 7:55059902-55059924 GATAAGGGCTGGGTGGAAGTAGG + Intronic
1025702634 7:63834072-63834094 CAGAAGGAGTGTGGGGCAGCTGG + Intergenic
1027201207 7:76064925-76064947 CAGCAGCGGTGTGGAGAAGTAGG - Exonic
1027763496 7:82308956-82308978 GAGAAGGGCTATTTGGAAGTTGG + Intronic
1028206524 7:88023820-88023842 CAGGAGGGTAGGGGGGAAGTGGG - Intronic
1028628399 7:92904483-92904505 CAGAAGAGGGGTGGGGAAGGAGG - Intergenic
1028777816 7:94700456-94700478 TAGAAGGGATGTGGAGAAATTGG + Intergenic
1029855349 7:103509997-103510019 TAGAGGGGCTGTGGAGAAATAGG + Intronic
1030168376 7:106577112-106577134 CAGAAGGGCTGTGGGCAGCCTGG - Intergenic
1030707429 7:112708719-112708741 GATAAGGTCTGTGGGGGAGTAGG + Intergenic
1031615831 7:123877928-123877950 CAGAAGTGCTGTGGAAAAGGAGG + Intergenic
1033050582 7:138000922-138000944 AAGAAAGGCTCTGGGGAAGGTGG - Intronic
1035171067 7:157017817-157017839 CAGATGGGCCGAGGGGAAGCCGG - Intergenic
1035741107 8:1929517-1929539 CAGGAGGCCGGTGGGGAGGTGGG - Intronic
1036213778 8:6863190-6863212 TAGAAGGGACGTGGGGAAGCTGG + Intergenic
1036694040 8:10963165-10963187 GAGAAGGCCAGCGGGGAAGTGGG - Intronic
1036699828 8:11005394-11005416 TGGAAGGGCTGGAGGGAAGTGGG + Intronic
1036948047 8:13113703-13113725 TAGAAGGGCTTTGGGGAAAGGGG - Intronic
1037696542 8:21228769-21228791 CAGGAGGGCTGGGGTGGAGTGGG + Intergenic
1037916709 8:22777437-22777459 AAGAGGGGCTGTGGGGAGGGGGG + Intronic
1038513549 8:28163089-28163111 CAGCAGGTCACTGGGGAAGTGGG + Intronic
1039057402 8:33547955-33547977 CAAAAGGGGTGTGGGGATGGGGG - Exonic
1039428781 8:37509320-37509342 CAGAAGGTCTGTTGGGATGATGG - Intergenic
1039440959 8:37595067-37595089 CAGAGGGGCTGGGTGGAAGGAGG + Intergenic
1041597433 8:59672434-59672456 CAGGAGGGCTGTTTGGAAGCTGG - Intergenic
1041724400 8:61004708-61004730 CAGCAGGGCTGCGGGGGAGCTGG + Intergenic
1042368585 8:67964654-67964676 CAGAAAGGCTTTGGGGTATTTGG + Intronic
1042437811 8:68788377-68788399 CAGTATGGAAGTGGGGAAGTGGG - Intronic
1043747045 8:83887448-83887470 GAGAAGGGTAGTGGGGAACTAGG - Intergenic
1045138624 8:99252995-99253017 GCCAAGGGCTGTGGGGAAATAGG - Intronic
1045154188 8:99448596-99448618 CAGAAGGGCTGTGTGAAAACTGG - Intronic
1045358541 8:101411310-101411332 CAGCAGGGCTGTGGGAGAGATGG + Intergenic
1047334359 8:123921773-123921795 CAGGGCGGCTGTGGGGAGGTTGG + Intronic
1047594687 8:126366401-126366423 AGGAAGGGCTGTGGGGAGGTAGG + Intergenic
1047807820 8:128377873-128377895 CTCAAGTGCTGTTGGGAAGTTGG + Intergenic
1049050167 8:140188444-140188466 CAGCACAGCTGTTGGGAAGTTGG + Intronic
1049462700 8:142737416-142737438 CAAAAGGGGTGGGGAGAAGTGGG + Intergenic
1049602174 8:143513043-143513065 CCCAGGCGCTGTGGGGAAGTCGG + Intronic
1051264641 9:15298909-15298931 GAGAAGTGATGTGGGGAAGGGGG - Intronic
1052374253 9:27699922-27699944 AAGAAGGGATGTGGGTGAGTTGG + Intergenic
1054403734 9:64738982-64739004 CAGAAGACCTGTGGATAAGTGGG - Intergenic
1054813215 9:69451249-69451271 CAGAAGGGATGTGGGAAGCTTGG - Intronic
1055331589 9:75189658-75189680 CAGAAGAGGTGAGGGGAATTTGG - Intergenic
1055357751 9:75454791-75454813 CAGGGGGACTATGGGGAAGTTGG - Intergenic
1055667581 9:78567903-78567925 CACTAGGGCTGTGGGGAATGTGG + Intergenic
1057743512 9:97733343-97733365 CAGAAGGGGACTGGGGAAGTAGG - Intergenic
1057818269 9:98311679-98311701 CAGTGGGGCTGTGGGCAAGAGGG - Intronic
1057942421 9:99296626-99296648 CAGAAGGGGTGCGGGGAGGCCGG + Intergenic
1058349776 9:104008390-104008412 CAGAAGGGACGGGGAGAAGTAGG - Intergenic
1058439152 9:104991500-104991522 AAGAAGGGATGTGGGGCAATCGG + Intergenic
1058478614 9:105367757-105367779 CAGAGGGGCTGGGGTGAAGAGGG - Intronic
1059257626 9:112945586-112945608 CAAAAGGGCTGTAGGGAGATTGG - Intergenic
1059300670 9:113310397-113310419 CATAAAGGCTGAGGGGAAGGGGG - Intergenic
1059407345 9:114109361-114109383 AAGAAGGTCTGTGAGGAAGGAGG + Intergenic
1060198509 9:121638497-121638519 CAGGAGGGCTGTGGAGGAGGCGG + Intronic
1060540580 9:124427464-124427486 CAGCAGGGCTGTGTGGACATTGG + Intergenic
1060581362 9:124749892-124749914 CAGTTGAGCTGTGGGGAAGTAGG - Intronic
1060733234 9:126050778-126050800 CAGAAGGGGTGTGGAGATGGAGG + Intergenic
1060792233 9:126494287-126494309 CAAAAGGGCAGTGGGGAAGGGGG - Intronic
1061230725 9:129314294-129314316 CGGGAGGACAGTGGGGAAGTGGG - Intergenic
1061233214 9:129326940-129326962 CAGCAGGGCTGGGTGGGAGTGGG + Intergenic
1061412720 9:130430026-130430048 CTGAAGGGCTGAGGGGGAGCTGG + Intronic
1062038065 9:134391500-134391522 CAGGCGGGCTGTGGGGCAGGCGG + Intronic
1062041054 9:134404503-134404525 CAGAAGTGCTGTGTGGAAGCTGG - Intronic
1062166464 9:135110129-135110151 GGGAAGGGCTGTGTGGAGGTTGG + Intronic
1062303632 9:135889720-135889742 CAGAAGAGCTCAGGGGAAGGAGG - Intronic
1062345116 9:136110952-136110974 CAGAGGGGCTCTGGGGAGGGCGG - Intergenic
1062482541 9:136759255-136759277 CTGCAGTGCTGTGGGGAACTGGG - Intergenic
1203626136 Un_KI270750v1:25127-25149 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1185702521 X:2242033-2242055 CGGAAGGGGAGTGGGGAATTGGG - Intronic
1185859396 X:3563544-3563566 CAGAGATGCTTTGGGGAAGTAGG - Intergenic
1186188219 X:7042530-7042552 GTGAAGGGCTGGGTGGAAGTTGG - Intergenic
1186218601 X:7325979-7326001 CAGAAAGGCAGGGGGAAAGTTGG + Intronic
1186785801 X:12955155-12955177 AGGAAGGGGTGAGGGGAAGTAGG - Intergenic
1186864094 X:13701940-13701962 GAGAAGGGCTGTGGGTGAGGTGG - Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187500234 X:19833212-19833234 AAGAAGGACTGTGGGAAAGAGGG - Intronic
1187768840 X:22672543-22672565 AAGAAGGGCTGAAGGGAGGTTGG + Intergenic
1188206098 X:27360143-27360165 TGGGAGGGTTGTGGGGAAGTGGG + Intergenic
1192321204 X:70092049-70092071 CAGAAGGACAGTGGAGAAGTAGG + Intergenic
1192897929 X:75463793-75463815 CAGGAGGGATGTGGAGAAATAGG + Intronic
1193667575 X:84341154-84341176 CTGAAGGAGAGTGGGGAAGTAGG - Intronic
1194080868 X:89464146-89464168 CAGAAGGGTAGTGGGGAGGTAGG - Intergenic
1194827046 X:98576961-98576983 CAAAAGGGGTGTGGGGCATTCGG + Intergenic
1195009009 X:100716944-100716966 CAGAAAGGATGTGGGGAGATGGG - Intronic
1196107264 X:111910389-111910411 CAGCAGGGCTGTGGGAGAGAGGG + Intronic
1196937617 X:120745268-120745290 CAGAAGGGTGATGGGGAAGCAGG - Intergenic
1197970928 X:132114161-132114183 CAGCAGGGCTGTGAGCAGGTTGG + Intronic
1198766077 X:140080452-140080474 CTCAAGTGCTGTGGGGAGGTTGG - Intergenic
1198784920 X:140276759-140276781 GAGAAGGGTAGTGGGGATGTTGG - Intergenic
1198934778 X:141894914-141894936 CCGAAGGGGTGGGAGGAAGTTGG + Intronic
1199080457 X:143570883-143570905 CAGAAGAGCTGTGGTGAACTGGG - Intergenic
1200433543 Y:3120350-3120372 CAGAAGGGTAGTGGGGAGGTAGG - Intergenic
1200806699 Y:7441124-7441146 CAGAGATGCTTTGGGGAAGTAGG + Intergenic
1201471582 Y:14341064-14341086 CCCAAGTGCTGTTGGGAAGTTGG + Intergenic