ID: 1125519298

View in Genome Browser
Species Human (GRCh38)
Location 15:40339300-40339322
Sequence GGGTATGAAGATGCATCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125519291_1125519298 19 Left 1125519291 15:40339258-40339280 CCTGTGCTTTGTGGCATAGGCGC 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1125519298 15:40339300-40339322 GGGTATGAAGATGCATCTACTGG 0: 1
1: 0
2: 0
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125519298 Original CRISPR GGGTATGAAGATGCATCTAC TGG Intronic
902688756 1:18096515-18096537 GGGTACGAAGGTGCCTCTCCTGG - Intergenic
902958051 1:19940219-19940241 GGGTATCATGATGTATCTTCTGG - Intergenic
910043660 1:82886057-82886079 GGGTATAAATGTGCATCTACAGG - Intergenic
912577921 1:110692503-110692525 TGGGATGAAGATCCATCTACAGG + Intergenic
914979867 1:152404546-152404568 GTGTATGAAGATCCATCCAAAGG - Intergenic
919740389 1:200977644-200977666 GGGTGTGAACATGGATCTTCCGG + Intronic
919748996 1:201024903-201024925 GGGTCTGAGGATGCATCTGTTGG + Intergenic
920708974 1:208277103-208277125 GGGAATGAAGATGCATTCAGGGG + Intergenic
1065641696 10:27788815-27788837 GGGTATGCAAATGAATCTTCTGG - Intergenic
1076661751 10:132059995-132060017 GGGCATGAAGATGCAGCCTCTGG - Intergenic
1079417537 11:20253500-20253522 GGATTTGAAGATGGATCTCCAGG - Intergenic
1085593634 11:77789279-77789301 TTGTATGAAGATGCAGCTCCAGG + Intronic
1089358433 11:117870763-117870785 GGGTATGAGGATGCATTGAGGGG - Intronic
1090355739 11:126139359-126139381 GGGCCTGAAGACGCATCTACTGG + Intergenic
1092095736 12:5840449-5840471 GGGAATGAAGCTGCATATATTGG + Intronic
1092315812 12:7412327-7412349 GGGTTTGAAGATGTATCTGTGGG + Intronic
1092940529 12:13403320-13403342 GGGTATGAAGGTGCTTTGACAGG + Intergenic
1095570152 12:43675311-43675333 GGGTATGAAGATGAGACTAGTGG + Intergenic
1103922139 12:124404566-124404588 GGGTGTGGAGCTGCATTTACTGG - Intronic
1103951671 12:124554772-124554794 GGGCAGGAAGCTGCATCTCCCGG - Intronic
1105052245 12:133064955-133064977 GGATATTAAAATGCATTTACTGG + Intergenic
1110141233 13:72131863-72131885 GGGTATTAGGAGGCAACTACTGG + Intergenic
1111753373 13:92362002-92362024 TGATATGAATCTGCATCTACAGG - Intronic
1118756286 14:68846457-68846479 GGGTGTAAAGATGTATGTACAGG + Intergenic
1125519298 15:40339300-40339322 GGGTATGAAGATGCATCTACTGG + Intronic
1127159912 15:56171495-56171517 GGCTTTGAAGATGCAGCTACTGG + Intronic
1128154419 15:65383901-65383923 GGGCTTGATGATGTATCTACAGG + Exonic
1137334651 16:47535949-47535971 TGGTATGAAGATGCAACAATGGG + Intronic
1146540059 17:33686198-33686220 GGGTATGAAGGTGCAAGTACCGG + Intronic
1148002283 17:44396903-44396925 GGATATGGAGATGCCTCTTCTGG + Intronic
1149628713 17:58101564-58101586 GGGCATGAACATGCAGCTTCTGG + Intergenic
1156413171 18:36856303-36856325 GGGTATCAACATGCATATAATGG - Intronic
1159625906 18:70693728-70693750 GGGTAGGAAGAAGCATCTCTAGG + Intergenic
1168047388 19:53803872-53803894 TGGTATAAAAATGCATCCACAGG - Intronic
926343036 2:11920605-11920627 GTGCATGAAGAAGCAGCTACTGG - Intergenic
927511435 2:23646581-23646603 GGTCATGAGGATCCATCTACAGG + Intronic
935398696 2:102637891-102637913 GGGCATGAAGAGGCACCAACAGG - Intronic
935896204 2:107740340-107740362 TGGTATGAAGATGGAACTTCTGG + Intergenic
944640692 2:201722275-201722297 GGGTATGAAGTGGTATCTCCTGG - Intronic
947540132 2:230971393-230971415 GGGTATGAAGTGGCATCTCGTGG - Intergenic
1175169470 20:57070112-57070134 GGGGATGAGGATGGATCCACAGG - Intergenic
1178348615 21:31853220-31853242 GGGTATGTAGATATATATACAGG + Intergenic
1181523080 22:23460367-23460389 GGGTTCCAAGATGCAGCTACTGG + Intergenic
1185057599 22:48589067-48589089 GGGTCTGAAGATGGATTTTCTGG - Intronic
951486448 3:23217069-23217091 GGTTTTGAGGATGCATCTAAAGG - Intronic
951645562 3:24886734-24886756 GAGTATCAAGTTTCATCTACAGG - Intergenic
959090075 3:101892912-101892934 TGGCATGAAGATTCATCTAATGG + Intergenic
959631475 3:108511993-108512015 GGTGAGGAAAATGCATCTACAGG - Intronic
966598552 3:181750628-181750650 GGATATGAAAATACATCTTCAGG + Intergenic
979017569 4:115453352-115453374 AGGTATGAAGATGAATTTATAGG - Intergenic
985606497 5:860983-861005 GCGTATGAAGGTGCATGTATGGG - Intronic
989215765 5:38902834-38902856 GGGTATTCAGATGCATCTGGAGG - Intronic
1002023348 5:176380274-176380296 CGGTATGCAGAGGCATCTAAAGG - Exonic
1003903458 6:10676905-10676927 GATTATGAAGAGGCATCTTCTGG - Intronic
1006171336 6:32095153-32095175 GGGCATGAGGATGCATCTCTTGG - Intronic
1006479633 6:34281324-34281346 AAGTATGAAGATGCTACTACTGG + Exonic
1010471034 6:76228837-76228859 GGGTCTCAAGTTGTATCTACAGG + Intergenic
1019588251 7:1816192-1816214 GGGTTCCAAGATGCAGCTACTGG - Exonic
1027248238 7:76381610-76381632 GGGTATGAAGTGGTATCTCCTGG - Intergenic
1027589742 7:80102678-80102700 GGGTGTGAAGTGGCATCTTCCGG + Intergenic
1038758091 8:30360578-30360600 TGGTTTGAGGATGCTTCTACAGG - Intergenic
1039856407 8:41418543-41418565 TGCTATGAACATGCATGTACAGG - Intergenic
1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG + Exonic
1041683732 8:60622713-60622735 GGGTATTAAAATGCATGTCCTGG - Exonic
1042666814 8:71216099-71216121 GAGTATAAAGCTGGATCTACTGG + Intronic
1045470419 8:102507351-102507373 ATGTATAAAAATGCATCTACAGG - Intergenic
1053655938 9:40218418-40218440 GGCTTTGAAGATGCATTTAGGGG + Intergenic
1054368045 9:64364642-64364664 GGCTTTGAAGATGCATTTAGGGG + Intergenic
1056050854 9:82767402-82767424 TGGTATGAAGATTCATGTACAGG + Intergenic
1056685547 9:88756082-88756104 TGCTATGAACATTCATCTACAGG + Intergenic
1061841065 9:133358868-133358890 GGATGGGAAGATGCGTCTACGGG + Intronic
1188716769 X:33468114-33468136 GGGTATGAAGTTGCATTTAATGG + Intergenic
1195609581 X:106850935-106850957 GGGTATGTAGAAGCATATAGGGG - Intronic
1196813510 X:119646838-119646860 GTGTATGAAGCTGCATCCTCAGG - Intronic
1200255910 X:154582971-154582993 GGCTATGAACATGCTTGTACAGG - Intergenic
1200261859 X:154621432-154621454 GGCTATGAACATGCTTGTACAGG + Intergenic
1201289456 Y:12408526-12408548 GGGTAGGGAGAGGAATCTACAGG - Intergenic